Starting /dee2/code/volunteer_pipeline.sh SRR6958312 current disk space = 1549842440192 free memory = 1598505460 SRR6958312 SRAfilesize 9ca703faeb0877b6c35242c20072e550 SRR6958312.sra SRR6958312.sra file validated SRR6958312 is paired end SRR6958312 is conventional basespace SRR6958312 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958312_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.2075 30.0 18.0 33.0 18.0 33.0 2 27.55425 29.0 25.0 33.0 18.0 33.0 3 30.101 31.0 29.0 33.0 27.0 33.0 4 30.96975 33.0 30.0 33.0 27.0 33.0 5 32.54225 33.0 33.0 33.0 32.0 33.0 6 36.31775 38.0 36.0 38.0 33.0 38.0 7 36.7015 38.0 37.0 38.0 34.0 38.0 8 36.8605 38.0 38.0 38.0 35.0 38.0 9 37.42575 38.0 38.0 38.0 37.0 38.0 10-14 37.561699999999995 38.0 38.0 38.0 37.6 38.0 15-19 37.567449999999994 38.0 38.0 38.0 37.8 38.0 20-24 37.49055 38.0 38.0 38.0 37.8 38.0 25-29 37.489999999999995 38.0 38.0 38.0 37.6 38.0 30-34 37.1591 38.0 38.0 38.0 36.2 38.0 35-39 37.59374999999999 38.0 38.0 38.0 37.8 38.0 40-44 37.513799999999996 38.0 38.0 38.0 37.6 38.0 45-49 37.48635 38.0 38.0 38.0 37.6 38.0 50-54 37.255399999999995 38.0 38.0 38.0 36.8 38.0 55-59 37.373149999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.4829 38.0 38.0 38.0 37.0 38.0 65-69 37.18455 38.0 38.0 38.0 36.2 38.0 70-74 36.2403 38.0 36.6 38.0 30.8 38.0 75-79 37.256299999999996 38.0 38.0 38.0 36.2 38.0 80-84 37.27975000000001 38.0 38.0 38.0 36.6 38.0 85-89 36.2496 38.0 37.2 38.0 30.8 38.0 90-94 34.39855 38.0 34.8 38.0 21.0 38.0 95-99 35.9585 38.0 37.0 38.0 32.0 38.0 100-104 35.6745 38.0 37.0 38.0 29.8 38.0 105-109 35.8756 38.0 36.8 38.0 31.2 38.0 110-114 35.915749999999996 38.0 37.0 38.0 31.6 38.0 115-119 36.4761 38.0 38.0 38.0 34.0 38.0 120-124 36.574850000000005 38.0 38.0 38.0 34.2 38.0 125-129 36.5232 38.0 38.0 38.0 34.0 38.0 130-134 36.443149999999996 38.0 38.0 38.0 33.8 38.0 135-139 36.2333 38.0 37.8 38.0 33.4 38.0 140-144 35.519850000000005 38.0 36.0 38.0 31.2 38.0 145-149 34.8396 38.0 35.8 38.0 30.0 38.0 150-151 30.7965 35.5 29.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 0.0 20 1.0 21 0.0 22 1.0 23 2.0 24 2.0 25 6.0 26 12.0 27 20.0 28 31.0 29 29.0 30 41.0 31 61.0 32 76.0 33 110.0 34 183.0 35 300.0 36 897.0 37 2226.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.03948450781464 9.1033726350425 8.390457910611461 34.466684946531394 2 28.08202050512628 11.852963240810203 31.932983245811453 28.132033008252062 3 21.575 16.5 25.900000000000002 36.025 4 25.624999999999996 24.075 22.95 27.35 5 25.575 28.15 23.474999999999998 22.8 6 21.55 31.900000000000002 23.0 23.549999999999997 7 17.275 24.025 40.675 18.025 8 21.3 23.3 29.425 25.974999999999998 9 19.1 22.15 33.324999999999996 25.424999999999997 10-14 22.63 26.810000000000002 26.165 24.395 15-19 22.465 25.21 26.855 25.47 20-24 22.93573393348337 25.61140285071268 26.151537884471114 25.301325331332837 25-29 22.605 25.650000000000002 26.640000000000004 25.105 30-34 22.68 25.46 26.345000000000002 25.515 35-39 22.855 25.224999999999998 26.655 25.264999999999997 40-44 22.645 25.03 26.63 25.695 45-49 22.720000000000002 25.35 26.14 25.790000000000003 50-54 22.74 25.509999999999998 25.96 25.790000000000003 55-59 22.759999999999998 25.595000000000002 26.25 25.395 60-64 23.02 25.275 25.86 25.845000000000002 65-69 22.365 25.535000000000004 26.235000000000003 25.865 70-74 23.02 25.44 26.55 24.990000000000002 75-79 23.35 24.92 26.275 25.455 80-84 23.294999999999998 25.124999999999996 25.595000000000002 25.985000000000003 85-89 22.835 25.025 26.295 25.845000000000002 90-94 23.255 25.615 25.85 25.28 95-99 22.91 25.27 26.405 25.415 100-104 23.22 24.745 26.575 25.46 105-109 23.46 25.28 26.295 24.965 110-114 23.57 25.245 25.97 25.215 115-119 23.455000000000002 25.3 25.94 25.305 120-124 23.435 25.46 25.775 25.330000000000002 125-129 23.09 25.424999999999997 25.995 25.490000000000002 130-134 23.36 25.31 26.179999999999996 25.15 135-139 23.225 25.44 25.82 25.515 140-144 22.945 25.185000000000002 25.745 26.125 145-149 23.380000000000003 25.11 25.869999999999997 25.64 150-151 23.5 25.424999999999997 25.8625 25.2125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.5 26 3.5 27 2.5 28 2.0 29 4.5 30 9.0 31 14.5 32 17.0 33 19.5 34 28.0 35 35.5 36 44.0 37 56.5 38 84.0 39 112.0 40 124.0 41 146.0 42 178.0 43 205.5 44 216.5 45 214.0 46 210.0 47 208.5 48 204.0 49 190.0 50 168.0 51 142.0 52 133.5 53 129.0 54 114.5 55 99.5 56 95.0 57 87.0 58 80.0 59 81.5 60 72.0 61 67.5 62 56.5 63 50.0 64 52.0 65 47.5 66 37.5 67 32.0 68 30.5 69 26.5 70 21.0 71 12.5 72 11.0 73 8.5 74 4.5 75 5.0 76 3.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.825 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.025 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.6625 0.0 0.0 0.0 0.0 108-109 0.8375 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.4500000000000002 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.9874999999999998 0.0 0.0 0.0 0.0 124-125 2.175 0.0 0.0 0.0 0.0 126-127 2.4125 0.0 0.0 0.0 0.0 128-129 2.8 0.0 0.0 0.0 0.0 130-131 3.025 0.0 0.0 0.0 0.0 132-133 3.1875 0.0 0.0 0.0 0.0 134-135 3.4875 0.0 0.0 0.0 0.0 136-137 3.75 0.0 0.0 0.0 0.0 138-139 4.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCTGGG 10 0.0068449317 144.90001 7 GGAATAA 10 0.0068449317 144.90001 3 >>END_MODULE SRR6958312 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958312_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.76375 33.0 33.0 34.0 32.0 34.0 2 33.0695 34.0 33.0 34.0 32.0 34.0 3 33.02625 34.0 33.0 34.0 32.0 34.0 4 33.01 34.0 33.0 34.0 32.0 34.0 5 33.0155 34.0 33.0 34.0 32.0 34.0 6 37.14325 38.0 38.0 38.0 37.0 38.0 7 37.26375 38.0 38.0 38.0 37.0 38.0 8 37.20125 38.0 38.0 38.0 37.0 38.0 9 37.10125 38.0 38.0 38.0 37.0 38.0 10-14 36.956250000000004 38.0 38.0 38.0 36.4 38.0 15-19 36.9214 38.0 38.0 38.0 36.0 38.0 20-24 36.65325 38.0 38.0 38.0 35.2 38.0 25-29 36.67775 38.0 38.0 38.0 35.0 38.0 30-34 36.94955 38.0 38.0 38.0 36.2 38.0 35-39 36.94345 38.0 38.0 38.0 36.2 38.0 40-44 35.918899999999994 38.0 36.2 38.0 31.6 38.0 45-49 36.67065 38.0 37.6 38.0 34.4 38.0 50-54 36.95425 38.0 38.0 38.0 36.2 38.0 55-59 36.913900000000005 38.0 38.0 38.0 36.0 38.0 60-64 35.309250000000006 37.8 35.2 38.0 30.0 38.0 65-69 35.530199999999994 38.0 35.8 38.0 30.4 38.0 70-74 34.472849999999994 37.8 33.6 38.0 26.8 38.0 75-79 36.29459999999999 38.0 37.8 38.0 33.6 38.0 80-84 36.21745 38.0 38.0 38.0 33.6 38.0 85-89 36.1274 38.0 38.0 38.0 33.0 38.0 90-94 36.4593 38.0 38.0 38.0 34.4 38.0 95-99 36.5398 38.0 38.0 38.0 34.4 38.0 100-104 36.54430000000001 38.0 38.0 38.0 34.4 38.0 105-109 36.33585 38.0 38.0 38.0 34.0 38.0 110-114 36.178799999999995 38.0 38.0 38.0 33.6 38.0 115-119 35.993900000000004 38.0 38.0 38.0 33.0 38.0 120-124 35.20875 38.0 36.4 38.0 29.0 38.0 125-129 35.29135 38.0 36.0 38.0 29.6 38.0 130-134 35.656850000000006 38.0 36.6 38.0 32.0 38.0 135-139 35.3284 38.0 36.0 38.0 31.0 38.0 140-144 35.069100000000006 38.0 36.0 38.0 31.0 38.0 145-149 34.51875 38.0 36.0 38.0 28.6 38.0 150-151 29.712874999999997 35.5 28.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 2.0 5 2.0 6 2.0 7 0.0 8 0.0 9 0.0 10 2.0 11 0.0 12 1.0 13 1.0 14 1.0 15 3.0 16 2.0 17 2.0 18 2.0 19 2.0 20 5.0 21 6.0 22 4.0 23 6.0 24 10.0 25 21.0 26 27.0 27 28.0 28 33.0 29 41.0 30 48.0 31 73.0 32 94.0 33 106.0 34 169.0 35 264.0 36 719.0 37 2312.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.125 18.45 12.425 31.0 2 29.925 23.549999999999997 27.275 19.25 3 21.224999999999998 26.575 29.2 23.0 4 26.575 31.95 20.875 20.599999999999998 5 27.85 31.45 19.575 21.125 6 24.3 36.3 19.35 20.05 7 23.200000000000003 19.5 33.85 23.45 8 23.674999999999997 23.65 24.125 28.549999999999997 9 24.55 23.599999999999998 26.650000000000002 25.2 10-14 25.779999999999998 27.029999999999998 22.994999999999997 24.195 15-19 24.925 25.924999999999997 24.945 24.205 20-24 24.834999999999997 26.465 24.465 24.235 25-29 25.205 26.155 24.65 23.990000000000002 30-34 25.095 25.61 25.009999999999998 24.285 35-39 25.765 26.055 24.32 23.86 40-44 25.45 25.455 24.985 24.11 45-49 25.53 26.005 24.610000000000003 23.855 50-54 25.669999999999998 26.009999999999998 24.224999999999998 24.095 55-59 25.685000000000002 26.39 24.779999999999998 23.145 60-64 25.305 26.115 24.9 23.68 65-69 25.445 25.430000000000003 25.03 24.095 70-74 25.88 25.155 25.124999999999996 23.84 75-79 25.755 24.995 25.435000000000002 23.815 80-84 25.555 26.125 24.709999999999997 23.61 85-89 25.740000000000002 25.61 24.95 23.7 90-94 25.135 26.495 25.105 23.265 95-99 25.395 25.535000000000004 25.47 23.599999999999998 100-104 25.564999999999998 26.165 24.865000000000002 23.405 105-109 25.580000000000002 26.16 25.009999999999998 23.25 110-114 26.174999999999997 26.165 24.825 22.835 115-119 26.525 26.095000000000002 24.33 23.05 120-124 25.46 26.529999999999998 24.740000000000002 23.27 125-129 25.96 26.13 24.68 23.23 130-134 26.040000000000003 26.115 24.775 23.07 135-139 25.779999999999998 26.185000000000002 25.035 23.0 140-144 26.465 26.355 24.44 22.74 145-149 25.945 26.51 24.68 22.865 150-151 25.874999999999996 26.637499999999996 24.8625 22.625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 1.0 25 1.5 26 1.0 27 0.5 28 3.5 29 7.0 30 7.0 31 7.0 32 13.0 33 21.0 34 27.5 35 36.0 36 40.5 37 47.5 38 74.5 39 99.5 40 119.5 41 146.0 42 167.0 43 189.0 44 201.0 45 202.5 46 203.5 47 199.5 48 191.5 49 184.5 50 170.5 51 145.0 52 131.0 53 123.0 54 111.5 55 98.5 56 95.5 57 94.5 58 82.0 59 79.0 60 83.0 61 85.0 62 77.0 63 70.0 64 65.0 65 54.5 66 41.5 67 33.5 68 34.0 69 29.0 70 22.5 71 19.0 72 16.5 73 16.0 74 13.0 75 7.0 76 5.0 77 2.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26841574167507 98.375 2 0.6054490413723511 1.2 3 0.07568113017154389 0.22499999999999998 4 0.050454086781029264 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.47500000000000003 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.2625 0.0 0.0 0.0 0.0 116-117 1.425 0.0 0.0 0.0 0.0 118-119 1.5 0.0 0.0 0.0 0.0 120-121 1.6875 0.0 0.0 0.0 0.0 122-123 2.0125 0.0 0.0 0.0 0.0 124-125 2.175 0.0 0.0 0.0 0.0 126-127 2.4125 0.0 0.0 0.0 0.0 128-129 2.8 0.0 0.0 0.0 0.0 130-131 3.0375 0.0 0.0 0.0 0.0 132-133 3.2125000000000004 0.0 0.0 0.0 0.0 134-135 3.5125 0.0 0.0 0.0 0.0 136-137 3.7875 0.0 0.0 0.0 0.0 138-139 4.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGCGA 10 0.006830828 145.0 4 AAGCGAG 10 0.006830828 145.0 5 >>END_MODULE Read 1074870 spots for SRR6958312.sra Written 1074870 spots for SRR6958312.sra Read 1074870 spots for SRR6958312.sra Written 1074870 spots for SRR6958312.sra Read 1074870 spots for SRR6958312.sra Written 1074870 spots for SRR6958312.sra Read 1074870 spots for SRR6958312.sra Written 1074870 spots for SRR6958312.sra Read 1074870 spots for SRR6958312.sra Written 1074870 spots for SRR6958312.sra Read 1074870 spots for SRR6958312.sra Written 1074870 spots for SRR6958312.sra Read 1074870 spots for SRR6958312.sra Written 1074870 spots for SRR6958312.sra Read 1074872 spots for SRR6958312.sra Written 1074872 spots for SRR6958312.sra Read 1074870 spots for SRR6958312.sra Written 1074870 spots for SRR6958312.sra Read 1074870 spots for SRR6958312.sra Written 1074870 spots for SRR6958312.sra Read 1074870 spots for SRR6958312.sra Written 1074870 spots for SRR6958312.sra Read 1074870 spots for SRR6958312.sra Written 1074870 spots for SRR6958312.sra Read 1074870 spots for SRR6958312.sra Written 1074870 spots for SRR6958312.sra Read 1074870 spots for SRR6958312.sra Written 1074870 spots for SRR6958312.sra Read 1074870 spots for SRR6958312.sra Written 1074870 spots for SRR6958312.sra Read 1074870 spots for SRR6958312.sra Written 1074870 spots for SRR6958312.sra Read 1074870 spots for SRR6958312.sra Written 1074870 spots for SRR6958312.sra Read 1074870 spots for SRR6958312.sra Written 1074870 spots for SRR6958312.sra Read 1074870 spots for SRR6958312.sra Written 1074870 spots for SRR6958312.sra Read 1074870 spots for SRR6958312.sra Written 1074870 spots for SRR6958312.sra SRR ids: ['SRR6958312.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nxk3k78i SRR6958312.sra spots: 21497402 blocks: [[1, 1074870], [1074871, 2149740], [2149741, 3224610], [3224611, 4299480], [4299481, 5374350], [5374351, 6449220], [6449221, 7524090], [7524091, 8598960], [8598961, 9673830], [9673831, 10748700], [10748701, 11823570], [11823571, 12898440], [12898441, 13973310], [13973311, 15048180], [15048181, 16123050], [16123051, 17197920], [17197921, 18272790], [18272791, 19347660], [19347661, 20422530], [20422531, 21497402]] SRR6958312 file size 7263063 SRR6958312 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958312 SRR6958312_1.fastq SRR6958312_2.fastq Input file: SRR6958312_1.fastq Paired file: SRR6958312_2.fastq trimmed: SRR6958312-trimmed-pair1.fastq, SRR6958312-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:35:10 2024 >> started Fri Dec 6 19:35:33 2024 >> done (23.217s) 21497402 read pairs processed; of these: 15839 ( 0.07%) short read pairs filtered out after trimming by size control 14762 ( 0.07%) empty read pairs filtered out after trimming by size control 21466801 (99.86%) read pairs available; of these: 8199262 (38.20%) trimmed read pairs available after processing 13267539 (61.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 5 0.00% 21 6 0.00% 22 3 0.00% 23 8 0.00% 24 10 0.00% 25 10 0.00% 26 3 0.00% 27 6 0.00% 28 5 0.00% 29 8 0.00% 30 6 0.00% 31 7 0.00% 32 3 0.00% 33 4 0.00% 34 8 0.00% 35 8 0.00% 36 7 0.00% 37 4 0.00% 38 8 0.00% 39 12 0.00% 40 14 0.00% 41 18 0.00% 42 9 0.00% 43 16 0.00% 44 17 0.00% 45 15 0.00% 46 20 0.00% 47 24 0.00% 48 26 0.00% 49 29 0.00% 50 35 0.00% 51 31 0.00% 52 43 0.00% 53 50 0.00% 54 58 0.00% 55 61 0.00% 56 67 0.00% 57 73 0.00% 58 79 0.00% 59 91 0.00% 60 104 0.00% 61 129 0.00% 62 141 0.00% 63 164 0.00% 64 163 0.00% 65 190 0.00% 66 212 0.00% 67 261 0.00% 68 253 0.00% 69 305 0.00% 70 369 0.00% 71 429 0.00% 72 483 0.00% 73 590 0.00% 74 666 0.00% 75 744 0.00% 76 845 0.00% 77 948 0.00% 78 1019 0.00% 79 1118 0.01% 80 1266 0.01% 81 1440 0.01% 82 1704 0.01% 83 1876 0.01% 84 2823 0.01% 85 3382 0.02% 86 3551 0.02% 87 3876 0.02% 88 4130 0.02% 89 4294 0.02% 90 4700 0.02% 91 5032 0.02% 92 5352 0.02% 93 5860 0.03% 94 6207 0.03% 95 6595 0.03% 96 7131 0.03% 97 7499 0.03% 98 8089 0.04% 99 8743 0.04% 100 9323 0.04% 101 9829 0.05% 102 10717 0.05% 103 11457 0.05% 104 11943 0.06% 105 12932 0.06% 106 13526 0.06% 107 14160 0.07% 108 14878 0.07% 109 15726 0.07% 110 16639 0.08% 111 17478 0.08% 112 18514 0.09% 113 19400 0.09% 114 20540 0.10% 115 21613 0.10% 116 22878 0.11% 117 23743 0.11% 118 24850 0.12% 119 25713 0.12% 120 26859 0.13% 121 27616 0.13% 122 28773 0.13% 123 30728 0.14% 124 32042 0.15% 125 33423 0.16% 126 35256 0.16% 127 37022 0.17% 128 38224 0.18% 129 39633 0.18% 130 41341 0.19% 131 43493 0.20% 132 45762 0.21% 133 48421 0.23% 134 50294 0.23% 135 53053 0.25% 136 56741 0.26% 137 59629 0.28% 138 62932 0.29% 139 67668 0.32% 140 72471 0.34% 141 78266 0.36% 142 85854 0.40% 143 95186 0.44% 144 108786 0.51% 145 126936 0.59% 146 155185 0.72% 147 209521 0.98% 148 322643 1.50% 149 670272 3.12% 150 4975777 23.18% 151 13267539 61.80% 21466801 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=20 prefix-density=0.76 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=43.34 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.7 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=23 prefix-density=0.55 prefix-fanout=2.5 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=60.13 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.4 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958312 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:36:24 Started mapping on | Dec 06 19:36:25 Finished on | Dec 06 19:38:57 Mapping speed, Million of reads per hour | 508.42 Number of input reads | 21466801 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20797620 Uniquely mapped reads % | 96.88% Average mapped length | 296.65 Number of splices: Total | 24580440 Number of splices: Annotated (sjdb) | 23189427 Number of splices: GT/AG | 24243731 Number of splices: GC/AG | 283256 Number of splices: AT/AC | 9838 Number of splices: Non-canonical | 43615 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 252622 % of reads mapped to multiple loci | 1.18% Number of reads mapped to too many loci | 8817 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.65% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 427036 427036 427036 N_multimapping 252622 252622 252622 N_noFeature 730250 20207857 880690 N_ambiguous 515888 2482 77835 UnstrandedReadsAssigned:19551482 PositiveStrandReadsAssigned:587281 NegativeStrandReadsAssigned:19839095 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958312 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958312-trimmed-pair1.fastq SRR6958312-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,466,801 reads, 19,806,002 reads pseudoaligned [quant] estimated average fragment length: 267.884 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,182 rounds 52973 SRR6958312.ke.tsv 35125 SRR6958312.se.tsv 88098 total ==> SRR6958312.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 669.63 0 0 PNS24247 1044 777.116 49.1193 4.74937 PNS24249 1928 1661.12 26.5158 1.19943 PNS24246 1044 777.116 49.1193 4.74937 PNS24248 1044 777.116 49.1193 4.74937 PNS24244 1471 1204.12 31.1263 1.94236 PNS24243 293 84.5321 1 0.888891 KQK14069 1603 1336.12 3241.08 182.27 KQK14071 474 224.783 91.1416 30.4666 ==> SRR6958312.se.tsv <== BRADI_1g14170v3 3939 BRADI_1g53295v3 2434 BRADI_1g59795v3 119 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 381 BRADI_1g74790v3 102 BRADI_1g09890v3 0 BRADI_1g77505v3 281 BRADI_1g48960v3 1 SRR6958312 completed mapping pipeline successfully