Starting /dee2/code/volunteer_pipeline.sh SRR6958313 current disk space = 1549857955840 free memory = 1604147344 SRR6958313 SRAfilesize fb2ab66774b82f4f0f5e785d3abc521f SRR6958313.sra SRR6958313.sra file validated SRR6958313 is paired end SRR6958313 is conventional basespace SRR6958313 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958313_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.27025 32.0 18.0 33.0 18.0 33.0 2 29.71225 31.0 28.0 33.0 25.0 33.0 3 29.85975 31.0 29.0 33.0 25.0 33.0 4 31.4325 33.0 31.0 33.0 29.0 33.0 5 31.57625 33.0 31.0 33.0 29.0 34.0 6 36.67275 38.0 37.0 38.0 34.0 38.0 7 37.04575 38.0 38.0 38.0 36.0 38.0 8 37.13575 38.0 38.0 38.0 36.0 38.0 9 37.21525 38.0 38.0 38.0 36.0 38.0 10-14 37.2739 38.0 38.0 38.0 36.4 38.0 15-19 37.2513 38.0 38.0 38.0 36.4 38.0 20-24 37.39335 38.0 38.0 38.0 37.0 38.0 25-29 37.3531 38.0 38.0 38.0 36.8 38.0 30-34 37.162400000000005 38.0 38.0 38.0 36.2 38.0 35-39 37.117549999999994 38.0 38.0 38.0 36.2 38.0 40-44 36.95715 38.0 38.0 38.0 35.4 38.0 45-49 37.1642 38.0 38.0 38.0 36.0 38.0 50-54 37.148900000000005 38.0 38.0 38.0 36.0 38.0 55-59 36.6215 38.0 37.8 38.0 34.2 38.0 60-64 36.2949 38.0 37.2 38.0 33.2 38.0 65-69 35.9832 38.0 37.0 38.0 31.6 38.0 70-74 35.899950000000004 38.0 36.6 38.0 31.0 38.0 75-79 36.3459 38.0 37.0 38.0 33.6 38.0 80-84 36.38055000000001 38.0 37.4 38.0 33.6 38.0 85-89 35.89255 38.0 36.6 38.0 31.6 38.0 90-94 36.1596 38.0 37.0 38.0 33.0 38.0 95-99 35.8667 38.0 36.6 38.0 31.6 38.0 100-104 35.41735 38.0 36.0 38.0 29.2 38.0 105-109 35.01735 38.0 35.2 38.0 28.0 38.0 110-114 34.383050000000004 38.0 34.4 38.0 25.4 38.0 115-119 33.6344 37.2 33.4 38.0 19.0 38.0 120-124 33.618849999999995 37.4 33.6 38.0 20.6 38.0 125-129 34.0579 38.0 34.0 38.0 23.0 38.0 130-134 34.2368 38.0 34.0 38.0 24.0 38.0 135-139 34.058800000000005 38.0 34.0 38.0 23.4 38.0 140-144 33.072500000000005 37.4 33.4 38.0 17.4 38.0 145-149 31.383550000000003 36.0 31.6 38.0 11.2 38.0 150-151 26.364625 34.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 1.0 17 1.0 18 2.0 19 1.0 20 3.0 21 2.0 22 8.0 23 8.0 24 3.0 25 16.0 26 19.0 27 27.0 28 43.0 29 50.0 30 85.0 31 123.0 32 154.0 33 225.0 34 370.0 35 598.0 36 1106.0 37 1154.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.82245008094981 9.525094441446305 7.771181867242309 39.881273610361575 2 24.775 12.8 35.425000000000004 27.0 3 22.55 16.25 24.325 36.875 4 25.374999999999996 23.825 22.375 28.425 5 26.65832290362954 27.284105131414265 24.25531914893617 21.802252816020026 6 21.7 32.65 25.424999999999997 20.225 7 17.224999999999998 23.175 40.6 19.0 8 19.1 23.474999999999998 30.599999999999998 26.825 9 20.150000000000002 21.3 34.075 24.474999999999998 10-14 22.355 27.089999999999996 26.640000000000004 23.915 15-19 22.605 26.009999999999998 26.174999999999997 25.21 20-24 22.805 26.169999999999998 26.61 24.415 25-29 22.56 26.35 25.91 25.180000000000003 30-34 22.21 26.155 26.555 25.080000000000002 35-39 22.48 25.729999999999997 26.755000000000003 25.035 40-44 22.795 25.605 26.400000000000002 25.2 45-49 22.59 25.650000000000002 26.57 25.19 50-54 22.195 26.05 26.965 24.79 55-59 22.445 25.985000000000003 26.435 25.135 60-64 22.400000000000002 25.5 27.01 25.09 65-69 22.755 25.85 26.450000000000003 24.945 70-74 22.595000000000002 25.83 25.695 25.88 75-79 22.335 25.569999999999997 26.82 25.275 80-84 22.745 25.455 26.674999999999997 25.124999999999996 85-89 22.615 25.624999999999996 26.515 25.245 90-94 23.155 26.115 25.629999999999995 25.1 95-99 23.11 25.805 25.895000000000003 25.19 100-104 22.735 25.395 26.484999999999996 25.385 105-109 23.135 25.53 26.015 25.319999999999997 110-114 22.845 25.624999999999996 26.450000000000003 25.080000000000002 115-119 22.81 25.840000000000003 26.179999999999996 25.169999999999998 120-124 22.795 25.895000000000003 25.974999999999998 25.335 125-129 22.955000000000002 25.765 25.655 25.624999999999996 130-134 22.869999999999997 25.465 26.279999999999998 25.385 135-139 23.405 25.319999999999997 26.245 25.03 140-144 22.775000000000002 25.46 26.525 25.240000000000002 145-149 22.935 25.295 26.064999999999998 25.705 150-151 22.650000000000002 25.6125 25.112499999999997 26.625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 1.0 27 2.0 28 4.5 29 8.0 30 9.0 31 13.5 32 15.5 33 17.0 34 21.5 35 36.5 36 58.0 37 68.0 38 82.5 39 108.5 40 135.5 41 168.5 42 198.5 43 212.5 44 230.5 45 234.5 46 228.0 47 214.5 48 201.5 49 193.0 50 178.0 51 150.5 52 126.5 53 115.5 54 106.0 55 107.0 56 84.5 57 76.0 58 74.5 59 68.5 60 62.0 61 49.0 62 44.0 63 35.0 64 30.5 65 38.5 66 43.0 67 27.0 68 25.0 69 26.5 70 19.0 71 17.0 72 11.0 73 5.0 74 3.5 75 3.5 76 4.0 77 3.0 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.35 2 0.0 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44654088050314 98.825 2 0.4779874213836478 0.95 3 0.07547169811320754 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.0499999999999998 0.0 0.0 0.0 0.0 116-117 1.125 0.0 0.0 0.0 0.0 118-119 1.225 0.0 0.0 0.0 0.0 120-121 1.375 0.0 0.0 0.0 0.0 122-123 1.525 0.0 0.0 0.0 0.0 124-125 1.6625 0.0 0.0 0.0 0.0 126-127 1.7875 0.0 0.0 0.0 0.0 128-129 1.975 0.0 0.0 0.0 0.0 130-131 2.1 0.0 0.0 0.0 0.0 132-133 2.3 0.0 0.0 0.0 0.0 134-135 2.525 0.0 0.0 0.0 0.0 136-137 2.95 0.0 0.0 0.0 0.0 138-139 3.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATGCCG 10 0.006841402 144.925 145 >>END_MODULE SRR6958313 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958313_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.939 33.0 33.0 34.0 32.0 34.0 2 32.97175 33.0 33.0 34.0 32.0 34.0 3 32.888 33.0 33.0 34.0 32.0 34.0 4 32.9315 34.0 33.0 34.0 32.0 34.0 5 32.97375 34.0 33.0 34.0 32.0 34.0 6 37.0715 38.0 38.0 38.0 36.0 38.0 7 36.83825 38.0 38.0 38.0 35.0 38.0 8 36.841 38.0 38.0 38.0 36.0 38.0 9 36.971 38.0 38.0 38.0 36.0 38.0 10-14 36.9177 38.0 38.0 38.0 36.0 38.0 15-19 36.93735 38.0 38.0 38.0 35.8 38.0 20-24 37.0788 38.0 38.0 38.0 36.0 38.0 25-29 37.043800000000005 38.0 38.0 38.0 36.0 38.0 30-34 36.80315 38.0 38.0 38.0 35.4 38.0 35-39 36.778999999999996 38.0 38.0 38.0 34.8 38.0 40-44 36.650400000000005 38.0 38.0 38.0 34.8 38.0 45-49 36.7394 38.0 38.0 38.0 35.0 38.0 50-54 36.61919999999999 38.0 38.0 38.0 34.4 38.0 55-59 36.702549999999995 38.0 38.0 38.0 34.8 38.0 60-64 36.5111 38.0 38.0 38.0 33.8 38.0 65-69 36.58005 38.0 38.0 38.0 34.2 38.0 70-74 36.521249999999995 38.0 38.0 38.0 34.0 38.0 75-79 36.30695000000001 38.0 37.6 38.0 33.6 38.0 80-84 36.065999999999995 38.0 37.2 38.0 32.4 38.0 85-89 36.111149999999995 38.0 37.2 38.0 32.6 38.0 90-94 36.15945 38.0 37.2 38.0 33.4 38.0 95-99 36.04085 38.0 37.0 38.0 33.0 38.0 100-104 35.4765 38.0 36.2 38.0 30.2 38.0 105-109 34.94385 38.0 35.6 38.0 27.4 38.0 110-114 34.46065 38.0 35.0 38.0 24.4 38.0 115-119 34.30615 38.0 34.6 38.0 24.4 38.0 120-124 33.996649999999995 38.0 34.2 38.0 21.8 38.0 125-129 33.16355 37.8 33.4 38.0 16.2 38.0 130-134 32.3019 36.6 31.6 38.0 14.6 38.0 135-139 31.08145 35.6 28.2 38.0 14.0 38.0 140-144 30.8017 35.6 28.8 38.0 13.2 38.0 145-149 30.372750000000003 36.0 29.8 38.0 6.4 38.0 150-151 25.533749999999998 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 0.0 5 0.0 6 1.0 7 3.0 8 1.0 9 0.0 10 1.0 11 0.0 12 1.0 13 3.0 14 4.0 15 2.0 16 5.0 17 6.0 18 5.0 19 9.0 20 5.0 21 8.0 22 19.0 23 13.0 24 18.0 25 21.0 26 22.0 27 42.0 28 54.0 29 64.0 30 76.0 31 92.0 32 159.0 33 186.0 34 310.0 35 489.0 36 940.0 37 1437.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.85 18.275 12.0 33.875 2 29.5 22.7 28.625 19.175 3 22.05 28.000000000000004 28.575 21.375 4 25.900000000000002 31.2 21.525 21.375 5 27.125 34.4 18.925 19.55 6 21.575 37.875 21.2 19.35 7 20.95 20.25 35.925000000000004 22.875 8 23.575 23.05 24.45 28.925 9 23.400000000000002 22.825 28.725 25.05 10-14 25.86 26.284999999999997 24.215 23.64 15-19 25.3 26.325 24.965 23.41 20-24 25.15 26.26 24.81 23.78 25-29 25.295 25.979999999999997 24.545 24.18 30-34 24.86 26.61 25.040000000000003 23.49 35-39 24.69 26.525 25.005 23.78 40-44 25.629999999999995 26.005 24.585 23.78 45-49 25.045 25.985000000000003 25.3 23.669999999999998 50-54 25.765 25.590000000000003 25.715 22.93 55-59 25.974999999999998 25.755 25.19 23.080000000000002 60-64 25.424999999999997 26.025 25.46 23.09 65-69 25.28 26.1 25.635 22.985 70-74 25.369999999999997 26.200000000000003 24.765 23.665 75-79 25.169999999999998 26.185000000000002 25.230000000000004 23.415 80-84 25.35 26.3 25.03 23.32 85-89 25.505 26.419999999999998 25.124999999999996 22.95 90-94 25.424999999999997 26.26 25.629999999999995 22.685 95-99 25.580000000000002 26.424999999999997 25.34 22.655 100-104 25.080000000000002 25.669999999999998 25.885 23.365 105-109 25.15 26.290000000000003 25.385 23.175 110-114 25.679999999999996 26.525 24.785 23.01 115-119 25.195 26.135 25.674999999999997 22.994999999999997 120-124 25.645 26.545 25.4 22.41 125-129 26.1 26.045 25.405 22.45 130-134 25.795 26.240000000000002 25.575 22.39 135-139 25.790000000000003 25.965 25.575 22.67 140-144 26.284999999999997 26.38 25.34 21.995 145-149 26.11 26.555 24.795 22.54 150-151 26.0625 26.3125 24.95 22.675 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 3.5 28 5.5 29 7.0 30 12.0 31 14.5 32 15.5 33 22.0 34 25.5 35 32.5 36 45.0 37 72.0 38 90.0 39 100.5 40 122.0 41 149.0 42 181.0 43 190.5 44 197.0 45 201.0 46 197.5 47 199.5 48 191.0 49 185.0 50 181.0 51 165.0 52 147.0 53 125.5 54 109.5 55 102.0 56 94.0 57 90.5 58 89.0 59 75.5 60 57.0 61 58.5 62 61.5 63 50.5 64 57.5 65 59.0 66 44.5 67 36.0 68 30.0 69 29.5 70 25.0 71 17.0 72 12.0 73 7.0 74 4.5 75 3.0 76 1.0 77 2.0 78 1.0 79 0.5 80 0.5 81 1.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3195564516129 98.52499999999999 2 0.5796370967741935 1.15 3 0.07560483870967742 0.22499999999999998 4 0.025201612903225805 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.9 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.0750000000000002 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.3 0.0 0.0 0.0 0.0 122-123 1.45 0.0 0.0 0.0 0.0 124-125 1.5875 0.0 0.0 0.0 0.0 126-127 1.7 0.0 0.0 0.0 0.0 128-129 1.875 0.0 0.0 0.0 0.0 130-131 1.9625 0.0 0.0 0.0 0.0 132-133 2.175 0.0 0.0 0.0 0.0 134-135 2.4124999999999996 0.0 0.0 0.0 0.0 136-137 2.8625 0.0 0.0 0.0 0.0 138-139 3.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGCAAA 10 0.006830828 145.0 1 >>END_MODULE Read 822433 spots for SRR6958313.sra Written 822433 spots for SRR6958313.sra Read 822433 spots for SRR6958313.sra Written 822433 spots for SRR6958313.sra Read 822433 spots for SRR6958313.sra Written 822433 spots for SRR6958313.sra Read 822433 spots for SRR6958313.sra Written 822433 spots for SRR6958313.sra Read 822433 spots for SRR6958313.sra Written 822433 spots for SRR6958313.sra Read 822433 spots for SRR6958313.sra Written 822433 spots for SRR6958313.sra Read 822433 spots for SRR6958313.sra Written 822433 spots for SRR6958313.sra Read 822433 spots for SRR6958313.sra Written 822433 spots for SRR6958313.sra Read 822433 spots for SRR6958313.sra Written 822433 spots for SRR6958313.sra Read 822433 spots for SRR6958313.sra Written 822433 spots for SRR6958313.sra Read 822433 spots for SRR6958313.sra Written 822433 spots for SRR6958313.sra Read 822433 spots for SRR6958313.sra Written 822433 spots for SRR6958313.sra Read 822433 spots for SRR6958313.sra Written 822433 spots for SRR6958313.sra Read 822433 spots for SRR6958313.sra Written 822433 spots for SRR6958313.sra Read 822433 spots for SRR6958313.sra Written 822433 spots for SRR6958313.sra Read 822433 spots for SRR6958313.sra Written 822433 spots for SRR6958313.sra Read 822433 spots for SRR6958313.sra Written 822433 spots for SRR6958313.sra Read 822433 spots for SRR6958313.sra Written 822433 spots for SRR6958313.sra Read 822433 spots for SRR6958313.sra Written 822433 spots for SRR6958313.sra Read 822445 spots for SRR6958313.sra Written 822445 spots for SRR6958313.sra SRR ids: ['SRR6958313.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ursw7zy8 SRR6958313.sra spots: 16448672 blocks: [[1, 822433], [822434, 1644866], [1644867, 2467299], [2467300, 3289732], [3289733, 4112165], [4112166, 4934598], [4934599, 5757031], [5757032, 6579464], [6579465, 7401897], [7401898, 8224330], [8224331, 9046763], [9046764, 9869196], [9869197, 10691629], [10691630, 11514062], [11514063, 12336495], [12336496, 13158928], [13158929, 13981361], [13981362, 14803794], [14803795, 15626227], [15626228, 16448672]] SRR6958313 file size 5552214 SRR6958313 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958313 SRR6958313_1.fastq SRR6958313_2.fastq Input file: SRR6958313_1.fastq Paired file: SRR6958313_2.fastq trimmed: SRR6958313-trimmed-pair1.fastq, SRR6958313-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:34:05 2024 >> started Fri Dec 6 19:34:30 2024 >> done (24.871s) 16448672 read pairs processed; of these: 9514 ( 0.06%) short read pairs filtered out after trimming by size control 6495 ( 0.04%) empty read pairs filtered out after trimming by size control 16432663 (99.90%) read pairs available; of these: 6787619 (41.31%) trimmed read pairs available after processing 9645044 (58.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 3 0.00% 21 3 0.00% 22 2 0.00% 23 2 0.00% 24 1 0.00% 25 4 0.00% 26 5 0.00% 27 4 0.00% 28 3 0.00% 29 10 0.00% 30 7 0.00% 31 5 0.00% 32 5 0.00% 33 10 0.00% 34 9 0.00% 35 14 0.00% 36 7 0.00% 37 9 0.00% 38 9 0.00% 39 13 0.00% 40 10 0.00% 41 13 0.00% 42 17 0.00% 43 17 0.00% 44 25 0.00% 45 30 0.00% 46 31 0.00% 47 25 0.00% 48 43 0.00% 49 38 0.00% 50 51 0.00% 51 55 0.00% 52 55 0.00% 53 38 0.00% 54 63 0.00% 55 72 0.00% 56 63 0.00% 57 83 0.00% 58 94 0.00% 59 105 0.00% 60 138 0.00% 61 139 0.00% 62 160 0.00% 63 166 0.00% 64 189 0.00% 65 212 0.00% 66 240 0.00% 67 263 0.00% 68 351 0.00% 69 354 0.00% 70 410 0.00% 71 462 0.00% 72 546 0.00% 73 617 0.00% 74 639 0.00% 75 699 0.00% 76 785 0.00% 77 880 0.01% 78 981 0.01% 79 1112 0.01% 80 1214 0.01% 81 1380 0.01% 82 1630 0.01% 83 1846 0.01% 84 2463 0.01% 85 2841 0.02% 86 2763 0.02% 87 3094 0.02% 88 3179 0.02% 89 3419 0.02% 90 3508 0.02% 91 3920 0.02% 92 4081 0.02% 93 4567 0.03% 94 4874 0.03% 95 5051 0.03% 96 5467 0.03% 97 5840 0.04% 98 6102 0.04% 99 6310 0.04% 100 6859 0.04% 101 7183 0.04% 102 7629 0.05% 103 8295 0.05% 104 8935 0.05% 105 9306 0.06% 106 9702 0.06% 107 10185 0.06% 108 10429 0.06% 109 11203 0.07% 110 11509 0.07% 111 12150 0.07% 112 12921 0.08% 113 13785 0.08% 114 14820 0.09% 115 15623 0.10% 116 16499 0.10% 117 17162 0.10% 118 18062 0.11% 119 18595 0.11% 120 19670 0.12% 121 20632 0.13% 122 21633 0.13% 123 22899 0.14% 124 24551 0.15% 125 25891 0.16% 126 27302 0.17% 127 28644 0.17% 128 29996 0.18% 129 31525 0.19% 130 33507 0.20% 131 35775 0.22% 132 38205 0.23% 133 41608 0.25% 134 44337 0.27% 135 48359 0.29% 136 52990 0.32% 137 57137 0.35% 138 62425 0.38% 139 69306 0.42% 140 76702 0.47% 141 84994 0.52% 142 94526 0.58% 143 103286 0.63% 144 111387 0.68% 145 127346 0.77% 146 151819 0.92% 147 212303 1.29% 148 346535 2.11% 149 740478 4.51% 150 3677051 22.38% 151 9645044 58.69% 16432663 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=20 prefix-density=0.68 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=72.05 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=9.8 sequence=ATTTCTTCAAAACAAACTACTTGTCGAGGCTGGAGTCACGTGGAGGCTTCGCTGTCGAGGCGAATCCTTTTGGTGCCAACCTCGTCACTAGCCGGCACCCTATTCTCCTTCGCTTCCACCGAGCACCTCTTGTAAGGTTTGAAGCCTGTCCGGTGGGATTTCATATTCAGGTGTGACAATTCAATGGGAAGGGAAGCTATCGGACCGACCGATGTATCGAGTTCATGATCAATAATCGAGGCGCACTC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=26 prefix-density=0.51 prefix-fanout=2.4 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=442.51 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=13.7 sequence=AGCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958313 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:35:15 Started mapping on | Dec 06 19:35:16 Finished on | Dec 06 19:37:19 Mapping speed, Million of reads per hour | 480.96 Number of input reads | 16432663 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15853494 Uniquely mapped reads % | 96.48% Average mapped length | 296.25 Number of splices: Total | 18596596 Number of splices: Annotated (sjdb) | 17509907 Number of splices: GT/AG | 18338331 Number of splices: GC/AG | 216237 Number of splices: AT/AC | 6900 Number of splices: Non-canonical | 35128 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 204773 % of reads mapped to multiple loci | 1.25% Number of reads mapped to too many loci | 17323 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.52% % of reads unmapped: other | 0.66% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 380735 380735 380735 N_multimapping 204773 204773 204773 N_noFeature 665421 15335804 802816 N_ambiguous 439956 2135 60421 UnstrandedReadsAssigned:14748117 PositiveStrandReadsAssigned:515555 NegativeStrandReadsAssigned:14990257 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958313 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958313-trimmed-pair1.fastq SRR6958313-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,432,663 reads, 14,981,448 reads pseudoaligned [quant] estimated average fragment length: 271.279 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52973 SRR6958313.ke.tsv 35125 SRR6958313.se.tsv 88098 total ==> SRR6958313.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 666.218 0 0 PNS24247 1044 773.721 48.1453 6.39226 PNS24249 1928 1657.72 17.4017 1.07836 PNS24246 1044 773.721 48.1453 6.39226 PNS24248 1044 773.721 48.1453 6.39226 PNS24244 1471 1200.72 51.1623 4.37716 PNS24243 293 80.6526 0 0 KQK14069 1603 1332.72 4562.73 351.699 KQK14071 474 219.673 35.7223 16.705 ==> SRR6958313.se.tsv <== BRADI_1g14170v3 5050 BRADI_1g53295v3 1236 BRADI_1g59795v3 112 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 249 BRADI_1g74790v3 75 BRADI_1g09890v3 0 BRADI_1g77505v3 215 BRADI_1g48960v3 0 SRR6958313 completed mapping pipeline successfully