Starting /dee2/code/volunteer_pipeline.sh SRR6958314 current disk space = 1549679108096 free memory = 1602212656 SRR6958314 SRAfilesize bc9d80954d02b6cac0ed7a892cbffe49 SRR6958314.sra SRR6958314.sra file validated SRR6958314 is paired end SRR6958314 is conventional basespace SRR6958314 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958314_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.75175 31.0 18.0 33.0 18.0 33.0 2 27.06725 29.0 25.0 31.0 18.0 33.0 3 30.8485 31.0 29.0 33.0 27.0 33.0 4 31.821 33.0 32.0 33.0 30.0 33.0 5 32.59475 33.0 33.0 33.0 32.0 34.0 6 36.86925 38.0 37.0 38.0 35.0 38.0 7 37.263 38.0 38.0 38.0 36.0 38.0 8 37.37825 38.0 38.0 38.0 37.0 38.0 9 37.37525 38.0 38.0 38.0 37.0 38.0 10-14 35.932550000000006 37.8 35.4 38.0 31.2 38.0 15-19 37.48455 38.0 38.0 38.0 37.6 38.0 20-24 37.55145 38.0 38.0 38.0 38.0 38.0 25-29 37.467949999999995 38.0 38.0 38.0 37.8 38.0 30-34 37.1929 38.0 38.0 38.0 36.8 38.0 35-39 37.334450000000004 38.0 38.0 38.0 37.2 38.0 40-44 37.28315 38.0 38.0 38.0 36.8 38.0 45-49 36.611599999999996 38.0 37.2 38.0 32.0 38.0 50-54 37.334649999999996 38.0 38.0 38.0 36.8 38.0 55-59 37.322649999999996 38.0 38.0 38.0 36.8 38.0 60-64 37.2824 38.0 38.0 38.0 37.0 38.0 65-69 37.20235000000001 38.0 38.0 38.0 36.6 38.0 70-74 37.26505 38.0 38.0 38.0 37.0 38.0 75-79 37.221500000000006 38.0 38.0 38.0 36.6 38.0 80-84 37.18055 38.0 38.0 38.0 36.6 38.0 85-89 35.84009999999999 38.0 36.0 38.0 29.8 38.0 90-94 34.7219 37.8 33.6 38.0 25.6 38.0 95-99 36.7048 38.0 37.8 38.0 34.6 38.0 100-104 36.8326 38.0 38.0 38.0 35.0 38.0 105-109 36.73199999999999 38.0 38.0 38.0 34.8 38.0 110-114 36.700849999999996 38.0 38.0 38.0 34.6 38.0 115-119 36.45295 38.0 38.0 38.0 34.2 38.0 120-124 36.29494999999999 38.0 38.0 38.0 33.8 38.0 125-129 36.0749 38.0 38.0 38.0 33.4 38.0 130-134 36.097049999999996 38.0 37.4 38.0 33.2 38.0 135-139 35.9733 38.0 37.2 38.0 32.6 38.0 140-144 35.5248 38.0 36.0 38.0 31.2 38.0 145-149 33.4113 37.6 32.6 38.0 24.2 38.0 150-151 30.939999999999998 35.5 29.5 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 2.0 17 0.0 18 3.0 19 1.0 20 5.0 21 3.0 22 2.0 23 5.0 24 3.0 25 6.0 26 7.0 27 14.0 28 18.0 29 29.0 30 33.0 31 51.0 32 74.0 33 97.0 34 199.0 35 315.0 36 897.0 37 2231.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 49.21752738654147 11.424100156494523 5.190401669274909 34.16797078768909 2 23.674999999999997 13.475000000000001 31.974999999999998 30.875000000000004 3 20.8 17.0 25.224999999999998 36.975 4 26.724999999999998 25.650000000000002 20.625 27.0 5 26.35 28.925 23.200000000000003 21.525 6 21.65 33.975 21.7 22.675 7 17.45 22.0 40.949999999999996 19.6 8 19.900000000000002 23.599999999999998 30.275000000000002 26.224999999999998 9 20.775 21.625 32.35 25.25 10-14 23.169999999999998 25.740000000000002 25.465 25.624999999999996 15-19 23.005 24.89 25.905 26.200000000000003 20-24 22.85 25.369999999999997 26.3 25.480000000000004 25-29 23.22 25.314999999999998 25.805 25.66 30-34 23.49 24.91 26.545 25.055 35-39 23.119999999999997 25.180000000000003 25.94 25.759999999999998 40-44 23.455000000000002 24.605 26.1 25.840000000000003 45-49 22.75 25.155 25.8 26.295 50-54 23.200000000000003 25.715 25.995 25.09 55-59 23.544999999999998 25.074999999999996 25.56 25.82 60-64 22.98 25.035 25.575 26.41 65-69 23.74 25.019999999999996 26.16 25.080000000000002 70-74 23.794999999999998 25.14 25.145 25.919999999999998 75-79 23.085 25.44 25.679999999999996 25.795 80-84 23.419999999999998 25.074999999999996 25.53 25.974999999999998 85-89 23.91 25.195 25.46 25.435000000000002 90-94 23.419999999999998 25.19 25.779999999999998 25.61 95-99 24.044999999999998 24.4 25.669999999999998 25.885 100-104 23.13 25.295 25.585 25.990000000000002 105-109 24.310000000000002 24.65 25.235000000000003 25.805 110-114 23.785 25.1 25.424999999999997 25.69 115-119 23.830000000000002 24.915000000000003 25.46 25.795 120-124 24.07 24.66 24.855 26.415 125-129 24.05 25.230000000000004 24.975 25.745 130-134 24.495 25.11 25.069999999999997 25.324999999999996 135-139 24.05 25.275 24.87 25.805 140-144 24.165 25.47 24.33 26.035000000000004 145-149 24.44 24.57 25.424999999999997 25.564999999999998 150-151 23.799999999999997 25.112499999999997 25.324999999999996 25.7625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 0.0 28 3.5 29 4.5 30 4.5 31 11.5 32 17.0 33 24.5 34 29.0 35 35.0 36 49.5 37 70.5 38 87.0 39 112.5 40 127.5 41 136.0 42 170.0 43 206.5 44 221.5 45 202.0 46 181.0 47 190.0 48 187.0 49 158.5 50 148.5 51 143.5 52 120.0 53 99.0 54 99.0 55 99.0 56 86.5 57 87.0 58 90.0 59 81.5 60 86.5 61 84.0 62 72.5 63 63.0 64 63.0 65 64.0 66 53.5 67 48.0 68 42.0 69 32.0 70 28.0 71 22.0 72 15.0 73 13.5 74 9.0 75 5.5 76 3.5 77 3.0 78 2.0 79 2.0 80 2.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.6040775232821546 1.2 3 0.0 0.0 4 0.025169896803423106 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.9750000000000001 0.0 0.0 0.0 0.0 102-103 1.2000000000000002 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.8375 0.0 0.0 0.0 0.0 108-109 2.125 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.675 0.0 0.0 0.0 0.0 114-115 3.075 0.0 0.0 0.0 0.0 116-117 3.4000000000000004 0.0 0.0 0.0 0.0 118-119 3.7 0.0 0.0 0.0 0.0 120-121 4.0375 0.0 0.0 0.0 0.0 122-123 4.574999999999999 0.0 0.0 0.0 0.0 124-125 4.9875 0.0 0.0 0.0 0.0 126-127 5.5625 0.0 0.0 0.0 0.0 128-129 6.15 0.0 0.0 0.0 0.0 130-131 6.8125 0.0 0.0 0.0 0.0 132-133 7.3875 0.0 0.0 0.0 0.0 134-135 7.949999999999999 0.0 0.0 0.0 0.0 136-137 8.4375 0.0 0.0 0.0 0.0 138-139 8.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGCTGT 10 0.0068343505 144.975 9 CAGGCTG 10 0.0068343505 144.975 8 >>END_MODULE SRR6958314 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958314_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.532 33.0 33.0 34.0 32.0 34.0 2 32.82525 33.0 33.0 34.0 32.0 34.0 3 32.9065 34.0 33.0 34.0 32.0 34.0 4 32.33925 34.0 33.0 34.0 31.0 34.0 5 32.78775 34.0 33.0 34.0 32.0 34.0 6 37.10275 38.0 38.0 38.0 37.0 38.0 7 37.134 38.0 38.0 38.0 37.0 38.0 8 37.04525 38.0 38.0 38.0 37.0 38.0 9 37.01825 38.0 38.0 38.0 37.0 38.0 10-14 36.6278 38.0 37.8 38.0 35.2 38.0 15-19 36.888999999999996 38.0 38.0 38.0 36.4 38.0 20-24 36.998000000000005 38.0 38.0 38.0 37.0 38.0 25-29 36.89375 38.0 38.0 38.0 36.6 38.0 30-34 36.936400000000006 38.0 38.0 38.0 36.8 38.0 35-39 36.55585 38.0 38.0 38.0 35.2 38.0 40-44 36.405 38.0 38.0 38.0 34.2 38.0 45-49 36.6423 38.0 38.0 38.0 35.6 38.0 50-54 36.525749999999995 38.0 38.0 38.0 35.0 38.0 55-59 36.19755 38.0 37.8 38.0 32.4 38.0 60-64 36.4471 38.0 38.0 38.0 34.4 38.0 65-69 36.20485 38.0 38.0 38.0 33.2 38.0 70-74 36.149950000000004 38.0 37.8 38.0 33.2 38.0 75-79 36.54494999999999 38.0 38.0 38.0 35.2 38.0 80-84 36.475699999999996 38.0 38.0 38.0 35.0 38.0 85-89 36.38875 38.0 38.0 38.0 34.6 38.0 90-94 34.48035 38.0 34.6 38.0 25.8 38.0 95-99 35.89385 38.0 37.8 38.0 32.8 38.0 100-104 36.11095 38.0 38.0 38.0 34.0 38.0 105-109 35.31835 38.0 36.6 38.0 28.6 38.0 110-114 35.90805 38.0 38.0 38.0 33.4 38.0 115-119 35.784800000000004 38.0 38.0 38.0 33.0 38.0 120-124 35.5354 38.0 37.4 38.0 32.0 38.0 125-129 35.0548 38.0 36.2 38.0 28.8 38.0 130-134 34.8475 38.0 36.0 38.0 29.2 38.0 135-139 34.593900000000005 38.0 35.8 38.0 28.2 38.0 140-144 34.10685 38.0 35.4 38.0 24.4 38.0 145-149 32.11825 37.6 31.8 38.0 11.6 38.0 150-151 26.85575 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 10.0 4 3.0 5 2.0 6 2.0 7 2.0 8 2.0 9 0.0 10 6.0 11 2.0 12 3.0 13 6.0 14 6.0 15 3.0 16 3.0 17 2.0 18 1.0 19 4.0 20 8.0 21 11.0 22 11.0 23 8.0 24 10.0 25 17.0 26 19.0 27 29.0 28 31.0 29 38.0 30 58.0 31 53.0 32 78.0 33 111.0 34 166.0 35 308.0 36 676.0 37 2296.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.175 19.825 8.525 25.474999999999998 2 29.125 23.150000000000002 27.400000000000002 20.325 3 21.6 26.3 28.925 23.175 4 26.474999999999998 31.175000000000004 19.925 22.425 5 26.625 34.35 18.975 20.05 6 23.925 35.0 19.55 21.525 7 23.849999999999998 19.0 35.05 22.1 8 23.425 22.575 23.9 30.099999999999998 9 24.5 22.925 25.974999999999998 26.6 10-14 25.740000000000002 26.32 23.145 24.795 15-19 25.39 25.729999999999997 24.21 24.67 20-24 25.275 25.45 24.959999999999997 24.315 25-29 25.540000000000003 25.885 23.799999999999997 24.775 30-34 25.8 24.915000000000003 25.245 24.04 35-39 25.95 25.585 23.945 24.52 40-44 25.669999999999998 25.669999999999998 24.16 24.5 45-49 25.835 26.179999999999996 23.69 24.295 50-54 25.885 25.314999999999998 24.615000000000002 24.185000000000002 55-59 25.8 25.525 24.13 24.545 60-64 25.779999999999998 25.305 24.255 24.66 65-69 25.740000000000002 25.374999999999996 24.865000000000002 24.02 70-74 25.885 25.259999999999998 24.265 24.59 75-79 26.125 24.855 24.610000000000003 24.41 80-84 26.009999999999998 25.240000000000002 24.36 24.39 85-89 26.13 25.515 24.54 23.815 90-94 26.155 25.36 24.37 24.115000000000002 95-99 26.08 25.115 24.385 24.42 100-104 26.945000000000004 25.145 24.48 23.43 105-109 26.009999999999998 25.53 24.325 24.135 110-114 26.669999999999998 25.615 23.880000000000003 23.835 115-119 27.185 25.295 23.705000000000002 23.815 120-124 27.339999999999996 25.61 23.830000000000002 23.22 125-129 26.775 25.82 24.185000000000002 23.22 130-134 27.775 25.314999999999998 23.880000000000003 23.03 135-139 27.47 25.6 23.985 22.945 140-144 27.365000000000002 25.755 24.05 22.830000000000002 145-149 27.63 25.685000000000002 24.54 22.145 150-151 27.725 26.087500000000002 23.6875 22.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 2.0 23 1.5 24 1.0 25 2.0 26 2.0 27 2.5 28 3.5 29 4.0 30 6.5 31 10.5 32 11.5 33 11.5 34 17.0 35 27.5 36 38.0 37 49.5 38 72.5 39 85.5 40 108.5 41 146.0 42 151.5 43 170.0 44 189.5 45 185.5 46 178.0 47 179.0 48 180.5 49 173.5 50 162.5 51 148.5 52 135.0 53 121.5 54 116.0 55 104.5 56 105.0 57 107.5 58 94.5 59 90.5 60 103.5 61 97.5 62 80.0 63 73.5 64 77.0 65 71.5 66 52.5 67 43.0 68 45.5 69 40.0 70 31.0 71 29.5 72 18.5 73 12.5 74 11.0 75 7.0 76 3.5 77 3.0 78 1.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11347517730496 97.82499999999999 2 0.7092198581560284 1.4000000000000001 3 0.07598784194528875 0.22499999999999998 4 0.025329280648429587 0.1 5 0.025329280648429587 0.125 6 0.025329280648429587 0.15 7 0.025329280648429587 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 7 0.17500000000000002 No Hit CACACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAG 6 0.15 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.45 0.0 0.0 0.0 0.0 106-107 1.7625000000000002 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.2874999999999996 0.0 0.0 0.0 0.0 112-113 2.6 0.0 0.0 0.0 0.0 114-115 3.0 0.0 0.0 0.0 0.0 116-117 3.325 0.0 0.0 0.0 0.0 118-119 3.65 0.0 0.0 0.0 0.0 120-121 3.9875000000000003 0.0 0.0 0.0 0.0 122-123 4.525 0.0 0.0 0.0 0.0 124-125 4.949999999999999 0.0 0.0 0.0 0.0 126-127 5.5375 0.0 0.0 0.0 0.0 128-129 6.15 0.0 0.0 0.0 0.0 130-131 6.762499999999999 0.0 0.0 0.0 0.0 132-133 7.3125 0.0 0.0 0.0 0.0 134-135 7.9125 0.0 0.0 0.0 0.0 136-137 8.475 0.0 0.0 0.0 0.0 138-139 8.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTCGG 10 0.006830828 145.0 3 ATAACCG 10 0.006830828 145.0 7 AAGAGGG 25 8.7132835E-4 87.0 2 >>END_MODULE Read 1342445 spots for SRR6958314.sra Written 1342445 spots for SRR6958314.sra Read 1342445 spots for SRR6958314.sra Written 1342445 spots for SRR6958314.sra Read 1342445 spots for SRR6958314.sra Written 1342445 spots for SRR6958314.sra Read 1342445 spots for SRR6958314.sra Written 1342445 spots for SRR6958314.sra Read 1342445 spots for SRR6958314.sra Written 1342445 spots for SRR6958314.sra Read 1342445 spots for SRR6958314.sra Written 1342445 spots for SRR6958314.sra Read 1342445 spots for SRR6958314.sra Written 1342445 spots for SRR6958314.sra Read 1342445 spots for SRR6958314.sra Written 1342445 spots for SRR6958314.sra Read 1342445 spots for SRR6958314.sra Written 1342445 spots for SRR6958314.sra Read 1342445 spots for SRR6958314.sra Written 1342445 spots for SRR6958314.sra Read 1342445 spots for SRR6958314.sra Written 1342445 spots for SRR6958314.sra Read 1342454 spots for SRR6958314.sra Written 1342454 spots for SRR6958314.sra Read 1342445 spots for SRR6958314.sra Written 1342445 spots for SRR6958314.sra Read 1342445 spots for SRR6958314.sra Written 1342445 spots for SRR6958314.sra Read 1342445 spots for SRR6958314.sra Written 1342445 spots for SRR6958314.sra Read 1342445 spots for SRR6958314.sra Written 1342445 spots for SRR6958314.sra Read 1342445 spots for SRR6958314.sra Written 1342445 spots for SRR6958314.sra Read 1342445 spots for SRR6958314.sra Written 1342445 spots for SRR6958314.sra Read 1342445 spots for SRR6958314.sra Written 1342445 spots for SRR6958314.sra Read 1342445 spots for SRR6958314.sra Written 1342445 spots for SRR6958314.sra SRR ids: ['SRR6958314.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vjxrskmf SRR6958314.sra spots: 26848909 blocks: [[1, 1342445], [1342446, 2684890], [2684891, 4027335], [4027336, 5369780], [5369781, 6712225], [6712226, 8054670], [8054671, 9397115], [9397116, 10739560], [10739561, 12082005], [12082006, 13424450], [13424451, 14766895], [14766896, 16109340], [16109341, 17451785], [17451786, 18794230], [18794231, 20136675], [20136676, 21479120], [21479121, 22821565], [22821566, 24164010], [24164011, 25506455], [25506456, 26848909]] SRR6958314 file size 9076513 SRR6958314 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958314 SRR6958314_1.fastq SRR6958314_2.fastq Input file: SRR6958314_1.fastq Paired file: SRR6958314_2.fastq trimmed: SRR6958314-trimmed-pair1.fastq, SRR6958314-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:37:38 2024 >> started Fri Dec 6 19:38:05 2024 >> done (26.937s) 26848909 read pairs processed; of these: 48554 ( 0.18%) short read pairs filtered out after trimming by size control 45357 ( 0.17%) empty read pairs filtered out after trimming by size control 26754998 (99.65%) read pairs available; of these: 10700954 (40.00%) trimmed read pairs available after processing 16054044 (60.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 12 0.00% 20 14 0.00% 21 11 0.00% 22 20 0.00% 23 19 0.00% 24 23 0.00% 25 30 0.00% 26 15 0.00% 27 28 0.00% 28 27 0.00% 29 21 0.00% 30 25 0.00% 31 28 0.00% 32 26 0.00% 33 24 0.00% 34 24 0.00% 35 35 0.00% 36 27 0.00% 37 39 0.00% 38 35 0.00% 39 52 0.00% 40 49 0.00% 41 61 0.00% 42 60 0.00% 43 56 0.00% 44 52 0.00% 45 53 0.00% 46 72 0.00% 47 102 0.00% 48 101 0.00% 49 114 0.00% 50 144 0.00% 51 158 0.00% 52 168 0.00% 53 188 0.00% 54 208 0.00% 55 219 0.00% 56 248 0.00% 57 284 0.00% 58 309 0.00% 59 382 0.00% 60 412 0.00% 61 490 0.00% 62 570 0.00% 63 626 0.00% 64 654 0.00% 65 704 0.00% 66 834 0.00% 67 915 0.00% 68 1054 0.00% 69 1222 0.00% 70 1358 0.01% 71 1604 0.01% 72 1835 0.01% 73 2054 0.01% 74 2268 0.01% 75 2606 0.01% 76 2946 0.01% 77 3410 0.01% 78 3623 0.01% 79 4115 0.02% 80 4572 0.02% 81 5267 0.02% 82 6014 0.02% 83 6925 0.03% 84 9539 0.04% 85 11111 0.04% 86 11820 0.04% 87 12530 0.05% 88 13327 0.05% 89 13752 0.05% 90 14833 0.06% 91 16086 0.06% 92 17182 0.06% 93 18540 0.07% 94 19460 0.07% 95 20909 0.08% 96 22200 0.08% 97 23563 0.09% 98 24722 0.09% 99 26340 0.10% 100 28005 0.10% 101 30011 0.11% 102 32041 0.12% 103 33531 0.13% 104 35460 0.13% 105 37368 0.14% 106 39011 0.15% 107 40628 0.15% 108 42082 0.16% 109 44028 0.16% 110 45851 0.17% 111 48289 0.18% 112 50346 0.19% 113 52988 0.20% 114 55550 0.21% 115 57658 0.22% 116 59683 0.22% 117 61221 0.23% 118 62851 0.23% 119 64250 0.24% 120 66219 0.25% 121 68453 0.26% 122 70852 0.26% 123 73969 0.28% 124 76718 0.29% 125 79215 0.30% 126 81634 0.31% 127 83235 0.31% 128 84413 0.32% 129 87452 0.33% 130 88041 0.33% 131 90757 0.34% 132 94772 0.35% 133 98868 0.37% 134 101672 0.38% 135 106083 0.40% 136 108307 0.40% 137 111012 0.41% 138 114674 0.43% 139 120035 0.45% 140 124298 0.46% 141 131190 0.49% 142 141434 0.53% 143 151141 0.56% 144 168714 0.63% 145 192020 0.72% 146 224255 0.84% 147 286390 1.07% 148 401039 1.50% 149 750980 2.81% 150 5066691 18.94% 151 16054044 60.00% 26754998 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=3.08 fanout-score-rank=22 prefix-density=0.84 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=42.31 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=27 prefix-density=0.63 prefix-fanout=2.4 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=71.06 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=4.3 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR6958314 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:38:50 Started mapping on | Dec 06 19:38:50 Finished on | Dec 06 19:40:42 Mapping speed, Million of reads per hour | 859.98 Number of input reads | 26754998 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 26205240 Uniquely mapped reads % | 97.95% Average mapped length | 293.39 Number of splices: Total | 29312203 Number of splices: Annotated (sjdb) | 27488549 Number of splices: GT/AG | 28941159 Number of splices: GC/AG | 337708 Number of splices: AT/AC | 10719 Number of splices: Non-canonical | 22617 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 175715 % of reads mapped to multiple loci | 0.66% Number of reads mapped to too many loci | 16061 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.04% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 407176 407176 407176 N_multimapping 175715 175715 175715 N_noFeature 926856 25407915 1202116 N_ambiguous 619167 3669 98225 UnstrandedReadsAssigned:24659217 PositiveStrandReadsAssigned:793656 NegativeStrandReadsAssigned:24904899 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958314 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958314-trimmed-pair1.fastq SRR6958314-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,754,998 reads, 24,950,091 reads pseudoaligned [quant] estimated average fragment length: 252.246 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,217 rounds 52973 SRR6958314.ke.tsv 35125 SRR6958314.se.tsv 88098 total ==> SRR6958314.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 685.361 0 0 PNS24247 1044 792.754 74.6567 5.63678 PNS24249 1928 1676.75 58.9729 2.10515 PNS24246 1044 792.754 74.6567 5.63678 PNS24248 1044 792.754 74.6567 5.63678 PNS24244 1471 1219.75 48.0569 2.35821 PNS24243 293 99.5073 0 0 KQK14069 1603 1351.75 4953.48 219.338 KQK14071 474 242.173 91.6583 22.654 ==> SRR6958314.se.tsv <== BRADI_1g14170v3 5718 BRADI_1g53295v3 315 BRADI_1g59795v3 334 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 343 BRADI_1g74790v3 123 BRADI_1g09890v3 0 BRADI_1g77505v3 277 BRADI_1g48960v3 0 SRR6958314 completed mapping pipeline successfully