Starting /dee2/code/volunteer_pipeline.sh SRR6958315 current disk space = 1549721763840 free memory = 1599796064 SRR6958315 SRAfilesize f60dfee8dffffdb971e43a8c41d0b0ef SRR6958315.sra SRR6958315.sra file validated SRR6958315 is paired end SRR6958315 is conventional basespace SRR6958315 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958315_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.818 33.0 32.0 33.0 25.0 33.0 2 30.0785 31.0 29.0 33.0 25.0 33.0 3 31.287 33.0 31.0 33.0 28.0 33.0 4 31.55025 33.0 32.0 33.0 30.0 33.0 5 32.38625 33.0 33.0 33.0 32.0 34.0 6 36.619 38.0 37.0 38.0 34.0 38.0 7 37.1615 38.0 38.0 38.0 36.0 38.0 8 37.46025 38.0 38.0 38.0 37.0 38.0 9 37.23275 38.0 38.0 38.0 37.0 38.0 10-14 37.4442 38.0 38.0 38.0 37.4 38.0 15-19 37.4838 38.0 38.0 38.0 37.6 38.0 20-24 37.34155 38.0 38.0 38.0 37.0 38.0 25-29 36.855 38.0 38.0 38.0 35.6 38.0 30-34 36.8698 38.0 37.8 38.0 34.8 38.0 35-39 37.318200000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.52869999999999 38.0 38.0 38.0 38.0 38.0 45-49 37.56115 38.0 38.0 38.0 38.0 38.0 50-54 37.52535 38.0 38.0 38.0 38.0 38.0 55-59 37.053599999999996 38.0 38.0 38.0 35.6 38.0 60-64 36.88035 38.0 37.8 38.0 34.8 38.0 65-69 37.4336 38.0 38.0 38.0 37.0 38.0 70-74 37.4245 38.0 38.0 38.0 37.2 38.0 75-79 36.33155 38.0 37.2 38.0 32.4 38.0 80-84 36.6613 38.0 37.4 38.0 34.0 38.0 85-89 37.24705 38.0 38.0 38.0 36.6 38.0 90-94 37.32015 38.0 38.0 38.0 37.0 38.0 95-99 37.178700000000006 38.0 38.0 38.0 36.2 38.0 100-104 37.078500000000005 38.0 38.0 38.0 36.0 38.0 105-109 37.006449999999994 38.0 38.0 38.0 35.8 38.0 110-114 37.04735 38.0 38.0 38.0 36.0 38.0 115-119 36.86105 38.0 38.0 38.0 35.0 38.0 120-124 36.495850000000004 38.0 38.0 38.0 34.4 38.0 125-129 36.51775 38.0 38.0 38.0 34.2 38.0 130-134 36.025549999999996 38.0 37.0 38.0 32.0 38.0 135-139 34.6211 38.0 34.8 38.0 25.8 38.0 140-144 35.499199999999995 38.0 36.2 38.0 30.0 38.0 145-149 35.8224 38.0 37.2 38.0 32.8 38.0 150-151 32.346375 36.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 2.0 17 1.0 18 2.0 19 0.0 20 1.0 21 2.0 22 2.0 23 2.0 24 4.0 25 8.0 26 5.0 27 9.0 28 20.0 29 19.0 30 36.0 31 37.0 32 66.0 33 87.0 34 120.0 35 261.0 36 677.0 37 2637.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.386108273748725 8.248212461695607 6.869254341164453 41.49642492339122 2 27.0 12.425 33.800000000000004 26.775 3 22.3 15.75 25.35 36.6 4 26.650000000000002 23.625 22.525000000000002 27.200000000000003 5 27.375 27.325 24.125 21.175 6 21.4 31.95 24.4 22.25 7 17.9 23.7 40.025 18.375 8 19.275000000000002 23.150000000000002 30.599999999999998 26.974999999999998 9 19.1 21.5 34.75 24.65 10-14 22.75 26.064999999999998 26.185000000000002 25.0 15-19 22.86 25.185000000000002 26.91 25.045 20-24 22.795 25.480000000000004 26.5 25.224999999999998 25-29 22.645 24.755 26.46 26.14 30-34 22.759999999999998 25.474999999999998 26.47 25.295 35-39 22.195 24.95 27.36 25.495 40-44 22.470000000000002 25.814999999999998 26.515 25.2 45-49 23.115 24.87 26.290000000000003 25.724999999999998 50-54 23.145 25.130000000000003 26.055 25.669999999999998 55-59 22.634999999999998 25.61 26.369999999999997 25.385 60-64 23.085 25.56 25.995 25.36 65-69 22.932293229322934 25.947594759475944 25.82258225822582 25.297529752975294 70-74 23.810000000000002 25.169999999999998 26.095000000000002 24.925 75-79 23.244999999999997 24.955 26.235000000000003 25.564999999999998 80-84 22.805 25.81 26.26 25.124999999999996 85-89 23.41 25.430000000000003 25.885 25.275 90-94 23.11 25.44 25.69 25.759999999999998 95-99 23.34 25.130000000000003 25.929999999999996 25.6 100-104 23.395 25.61 25.569999999999997 25.424999999999997 105-109 23.395 25.365 25.490000000000002 25.75 110-114 22.975 25.180000000000003 26.474999999999998 25.369999999999997 115-119 23.205000000000002 25.485000000000003 25.455 25.855 120-124 23.335 25.405 25.795 25.465 125-129 23.494999999999997 25.505 25.314999999999998 25.685000000000002 130-134 23.330000000000002 26.029999999999998 24.905 25.735000000000003 135-139 23.400000000000002 25.759999999999998 25.525 25.314999999999998 140-144 23.810000000000002 24.73 25.7 25.759999999999998 145-149 23.685000000000002 25.869999999999997 24.725 25.72 150-151 24.349999999999998 26.0 25.025 24.625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 3.0 27 3.0 28 2.0 29 7.5 30 13.0 31 10.0 32 17.5 33 28.5 34 36.0 35 40.5 36 46.0 37 69.0 38 80.5 39 100.0 40 138.0 41 156.5 42 172.5 43 184.5 44 194.5 45 210.0 46 224.0 47 218.5 48 185.0 49 170.5 50 166.0 51 147.0 52 130.5 53 127.5 54 116.0 55 97.5 56 88.0 57 75.0 58 72.0 59 71.5 60 64.0 61 58.0 62 62.5 63 67.5 64 65.5 65 59.5 66 44.5 67 32.5 68 28.5 69 22.5 70 19.5 71 16.5 72 12.5 73 13.5 74 9.5 75 7.0 76 6.5 77 4.0 78 1.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32007051120625 98.6 2 0.6295643414756988 1.25 3 0.0503651473180559 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.9125000000000001 0.0 0.0 0.0 0.0 104-105 1.05 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 1.7625000000000002 0.0 0.0 0.0 0.0 114-115 2.1125 0.0 0.0 0.0 0.0 116-117 2.4875 0.0 0.0 0.0 0.0 118-119 2.7249999999999996 0.0 0.0 0.0 0.0 120-121 2.975 0.0 0.0 0.0 0.0 122-123 3.175 0.0 0.0 0.0 0.0 124-125 3.55 0.0 0.0 0.0 0.0 126-127 4.012499999999999 0.0 0.0 0.0 0.0 128-129 4.475 0.0 0.0 0.0 0.0 130-131 4.887499999999999 0.0 0.0 0.0 0.0 132-133 5.300000000000001 0.0 0.0 0.0 0.0 134-135 5.85 0.0 0.0 0.0 0.0 136-137 6.3875 0.0 0.0 0.0 0.0 138-139 6.949999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGTCT 10 0.006830828 145.0 5 >>END_MODULE SRR6958315 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958315_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.13875 34.0 33.0 34.0 32.0 34.0 2 33.28275 34.0 33.0 34.0 33.0 34.0 3 33.28925 34.0 33.0 34.0 33.0 34.0 4 33.2465 34.0 33.0 34.0 33.0 34.0 5 33.187 34.0 33.0 34.0 33.0 34.0 6 37.41925 38.0 38.0 38.0 37.0 38.0 7 37.507 38.0 38.0 38.0 38.0 38.0 8 37.41025 38.0 38.0 38.0 38.0 38.0 9 37.40125 38.0 38.0 38.0 38.0 38.0 10-14 37.37335 38.0 38.0 38.0 37.6 38.0 15-19 37.4753 38.0 38.0 38.0 38.0 38.0 20-24 37.45875 38.0 38.0 38.0 38.0 38.0 25-29 37.38845 38.0 38.0 38.0 37.8 38.0 30-34 37.4455 38.0 38.0 38.0 38.0 38.0 35-39 37.3503 38.0 38.0 38.0 37.2 38.0 40-44 37.02015 38.0 38.0 38.0 36.4 38.0 45-49 37.04945 38.0 38.0 38.0 36.4 38.0 50-54 37.1662 38.0 38.0 38.0 36.6 38.0 55-59 37.30605 38.0 38.0 38.0 37.0 38.0 60-64 37.2882 38.0 38.0 38.0 37.0 38.0 65-69 37.251850000000005 38.0 38.0 38.0 37.0 38.0 70-74 37.3147 38.0 38.0 38.0 37.0 38.0 75-79 37.23895 38.0 38.0 38.0 37.0 38.0 80-84 37.0846 38.0 38.0 38.0 36.2 38.0 85-89 36.9608 38.0 38.0 38.0 36.0 38.0 90-94 36.92145 38.0 38.0 38.0 35.8 38.0 95-99 36.783249999999995 38.0 38.0 38.0 35.2 38.0 100-104 36.752849999999995 38.0 38.0 38.0 34.8 38.0 105-109 36.856399999999994 38.0 38.0 38.0 35.4 38.0 110-114 36.6434 38.0 38.0 38.0 34.6 38.0 115-119 36.619299999999996 38.0 38.0 38.0 34.8 38.0 120-124 36.4425 38.0 38.0 38.0 34.2 38.0 125-129 36.25064999999999 38.0 38.0 38.0 33.8 38.0 130-134 36.18005 38.0 38.0 38.0 33.8 38.0 135-139 35.83454999999999 38.0 38.0 38.0 33.0 38.0 140-144 35.46145 38.0 36.6 38.0 31.0 38.0 145-149 35.1704 38.0 36.8 38.0 31.0 38.0 150-151 30.86925 35.5 29.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 1.0 5 0.0 6 0.0 7 1.0 8 0.0 9 2.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 1.0 17 0.0 18 5.0 19 3.0 20 2.0 21 2.0 22 4.0 23 6.0 24 8.0 25 6.0 26 16.0 27 18.0 28 22.0 29 23.0 30 31.0 31 48.0 32 65.0 33 59.0 34 111.0 35 189.0 36 396.0 37 2975.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.475 19.475 10.775 34.275 2 30.075000000000003 24.15 28.725 17.05 3 21.325 25.35 28.549999999999997 24.775 4 25.4 32.324999999999996 20.9 21.375 5 27.325 32.875 20.7 19.1 6 22.675 36.15 21.075 20.1 7 21.55 18.525 36.325 23.599999999999998 8 23.325000000000003 23.125 25.45 28.1 9 22.55 23.599999999999998 28.275 25.575 10-14 25.435000000000002 26.71 23.294999999999998 24.560000000000002 15-19 26.001300065003253 25.81129056452823 24.181209060453025 24.0062003100155 20-24 25.490000000000002 26.22 24.68 23.61 25-29 25.540000000000003 25.540000000000003 24.685000000000002 24.235 30-34 25.705 25.385 24.63 24.279999999999998 35-39 25.430000000000003 26.075 24.36 24.135 40-44 25.145 25.324999999999996 25.035 24.495 45-49 26.08 25.455 24.555 23.91 50-54 25.865 25.405 25.06 23.669999999999998 55-59 25.775 25.509999999999998 24.87 23.845 60-64 25.979999999999997 25.0 24.93 24.09 65-69 25.585 25.415 25.045 23.955000000000002 70-74 25.735000000000003 25.674999999999997 24.575 24.015 75-79 25.495 25.480000000000004 24.81 24.215 80-84 25.485000000000003 25.650000000000002 24.490000000000002 24.375 85-89 25.215 25.465 25.255 24.065 90-94 25.445 26.02 24.9 23.635 95-99 25.616280814040703 25.906295314765735 24.62123106155308 23.85619280964048 100-104 25.480000000000004 25.674999999999997 25.174999999999997 23.669999999999998 105-109 26.305 26.384999999999998 24.765 22.545 110-114 25.985000000000003 26.040000000000003 24.985 22.99 115-119 26.187618761876188 25.937593759375936 24.697469746974697 23.17731773177318 120-124 26.119999999999997 26.25 24.235 23.395 125-129 26.245 26.305 24.33 23.119999999999997 130-134 26.279999999999998 26.534999999999997 24.834999999999997 22.35 135-139 26.435 26.27 24.515 22.78 140-144 26.941347067353366 26.46132306615331 24.456222811140556 22.14110705535277 145-149 26.85 26.875 24.265 22.009999999999998 150-151 27.019254813703427 26.731682920730183 24.731182795698924 21.517879469867466 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.5 25 2.0 26 4.5 27 4.5 28 4.0 29 5.5 30 6.0 31 12.5 32 17.5 33 16.5 34 25.0 35 32.0 36 34.5 37 51.0 38 82.0 39 103.5 40 123.5 41 146.0 42 163.0 43 180.5 44 191.5 45 198.5 46 192.0 47 191.0 48 195.5 49 184.0 50 166.0 51 145.5 52 131.5 53 121.5 54 106.5 55 94.0 56 87.5 57 88.5 58 90.0 59 83.5 60 73.5 61 69.0 62 74.5 63 72.5 64 59.0 65 52.0 66 54.0 67 52.0 68 43.0 69 37.5 70 33.5 71 27.5 72 21.5 73 16.5 74 11.0 75 7.5 76 5.0 77 2.0 78 1.0 79 1.0 80 1.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11504424778761 98.0 2 0.7332490518331226 1.4500000000000002 3 0.1011378002528445 0.3 4 0.025284450063211124 0.1 5 0.0 0.0 6 0.025284450063211124 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.1749999999999998 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 2.0875000000000004 0.0 0.0 0.0 0.0 116-117 2.4625000000000004 0.0 0.0 0.0 0.0 118-119 2.7 0.0 0.0 0.0 0.0 120-121 2.925 0.0 0.0 0.0 0.0 122-123 3.125 0.0 0.0 0.0 0.0 124-125 3.5125 0.0 0.0 0.0 0.0 126-127 4.0375 0.0 0.0 0.0 0.0 128-129 4.55 0.0 0.0 0.0 0.0 130-131 5.0 0.0 0.0 0.0 0.0 132-133 5.4375 0.0 0.0 0.0 0.0 134-135 6.0375 0.0 0.0 0.0 0.0 136-137 6.6125 0.0 0.0 0.0 0.0 138-139 7.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCGGCG 10 0.006830828 145.0 8 >>END_MODULE Read 1193311 spots for SRR6958315.sra Written 1193311 spots for SRR6958315.sra Read 1193311 spots for SRR6958315.sra Written 1193311 spots for SRR6958315.sra Read 1193311 spots for SRR6958315.sra Written 1193311 spots for SRR6958315.sra Read 1193311 spots for SRR6958315.sra Written 1193311 spots for SRR6958315.sra Read 1193311 spots for SRR6958315.sra Written 1193311 spots for SRR6958315.sra Read 1193311 spots for SRR6958315.sra Written 1193311 spots for SRR6958315.sra Read 1193311 spots for SRR6958315.sra Written 1193311 spots for SRR6958315.sra Read 1193311 spots for SRR6958315.sra Written 1193311 spots for SRR6958315.sra Read 1193311 spots for SRR6958315.sra Written 1193311 spots for SRR6958315.sra Read 1193311 spots for SRR6958315.sra Written 1193311 spots for SRR6958315.sra Read 1193311 spots for SRR6958315.sra Written 1193311 spots for SRR6958315.sra Read 1193311 spots for SRR6958315.sra Written 1193311 spots for SRR6958315.sra Read 1193311 spots for SRR6958315.sra Written 1193311 spots for SRR6958315.sra Read 1193311 spots for SRR6958315.sra Written 1193311 spots for SRR6958315.sra Read 1193311 spots for SRR6958315.sra Written 1193311 spots for SRR6958315.sra Read 1193311 spots for SRR6958315.sra Written 1193311 spots for SRR6958315.sra Read 1193311 spots for SRR6958315.sra Written 1193311 spots for SRR6958315.sra Read 1193311 spots for SRR6958315.sra Written 1193311 spots for SRR6958315.sra Read 1193326 spots for SRR6958315.sra Written 1193326 spots for SRR6958315.sra Read 1193311 spots for SRR6958315.sra Written 1193311 spots for SRR6958315.sra SRR ids: ['SRR6958315.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w16wkud7 SRR6958315.sra spots: 23866235 blocks: [[1, 1193311], [1193312, 2386622], [2386623, 3579933], [3579934, 4773244], [4773245, 5966555], [5966556, 7159866], [7159867, 8353177], [8353178, 9546488], [9546489, 10739799], [10739800, 11933110], [11933111, 13126421], [13126422, 14319732], [14319733, 15513043], [15513044, 16706354], [16706355, 17899665], [17899666, 19092976], [19092977, 20286287], [20286288, 21479598], [21479599, 22672909], [22672910, 23866235]] SRR6958315 file size 8065783 SRR6958315 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958315 SRR6958315_1.fastq SRR6958315_2.fastq Input file: SRR6958315_1.fastq Paired file: SRR6958315_2.fastq trimmed: SRR6958315-trimmed-pair1.fastq, SRR6958315-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:39:24 2024 >> started Fri Dec 6 19:39:48 2024 >> done (23.720s) 23866235 read pairs processed; of these: 11826 ( 0.05%) short read pairs filtered out after trimming by size control 11584 ( 0.05%) empty read pairs filtered out after trimming by size control 23842825 (99.90%) read pairs available; of these: 8652782 (36.29%) trimmed read pairs available after processing 15190043 (63.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 9 0.00% 20 12 0.00% 21 13 0.00% 22 13 0.00% 23 9 0.00% 24 10 0.00% 25 7 0.00% 26 15 0.00% 27 11 0.00% 28 8 0.00% 29 16 0.00% 30 8 0.00% 31 23 0.00% 32 13 0.00% 33 24 0.00% 34 18 0.00% 35 23 0.00% 36 18 0.00% 37 23 0.00% 38 25 0.00% 39 28 0.00% 40 29 0.00% 41 40 0.00% 42 33 0.00% 43 52 0.00% 44 42 0.00% 45 40 0.00% 46 43 0.00% 47 54 0.00% 48 68 0.00% 49 55 0.00% 50 95 0.00% 51 91 0.00% 52 91 0.00% 53 89 0.00% 54 125 0.00% 55 115 0.00% 56 130 0.00% 57 179 0.00% 58 207 0.00% 59 221 0.00% 60 235 0.00% 61 297 0.00% 62 332 0.00% 63 360 0.00% 64 394 0.00% 65 474 0.00% 66 479 0.00% 67 598 0.00% 68 672 0.00% 69 736 0.00% 70 858 0.00% 71 974 0.00% 72 1094 0.00% 73 1261 0.01% 74 1511 0.01% 75 1576 0.01% 76 1824 0.01% 77 2100 0.01% 78 2318 0.01% 79 2575 0.01% 80 2957 0.01% 81 3438 0.01% 82 3773 0.02% 83 4139 0.02% 84 5378 0.02% 85 6084 0.03% 86 6476 0.03% 87 7090 0.03% 88 7794 0.03% 89 8433 0.04% 90 9161 0.04% 91 9875 0.04% 92 10821 0.05% 93 11722 0.05% 94 12842 0.05% 95 13816 0.06% 96 14645 0.06% 97 15853 0.07% 98 16793 0.07% 99 17830 0.07% 100 19599 0.08% 101 20402 0.09% 102 22078 0.09% 103 23193 0.10% 104 24571 0.10% 105 26009 0.11% 106 27315 0.11% 107 28617 0.12% 108 30158 0.13% 109 31610 0.13% 110 33063 0.14% 111 34697 0.15% 112 36315 0.15% 113 38279 0.16% 114 40111 0.17% 115 41781 0.18% 116 43285 0.18% 117 45008 0.19% 118 46547 0.20% 119 47345 0.20% 120 48947 0.21% 121 50470 0.21% 122 52395 0.22% 123 53963 0.23% 124 56805 0.24% 125 58556 0.25% 126 60201 0.25% 127 62256 0.26% 128 63606 0.27% 129 65346 0.27% 130 67165 0.28% 131 69241 0.29% 132 72100 0.30% 133 73773 0.31% 134 75976 0.32% 135 78814 0.33% 136 81905 0.34% 137 84599 0.35% 138 87614 0.37% 139 92238 0.39% 140 95370 0.40% 141 99848 0.42% 142 110204 0.46% 143 127252 0.53% 144 127079 0.53% 145 144927 0.61% 146 174884 0.73% 147 230210 0.97% 148 335277 1.41% 149 610832 2.56% 150 4369222 18.33% 151 15190043 63.71% 23842825 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=32 prefix-density=0.51 prefix-fanout=2.5 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=44.20 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.3 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.78 fanout-score-rank=23 prefix-density=0.40 prefix-fanout=3.0 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=150.49 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=9.3 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958315 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:40:41 Started mapping on | Dec 06 19:40:41 Finished on | Dec 06 19:42:38 Mapping speed, Million of reads per hour | 733.63 Number of input reads | 23842825 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 23399490 Uniquely mapped reads % | 98.14% Average mapped length | 294.94 Number of splices: Total | 26423946 Number of splices: Annotated (sjdb) | 24785443 Number of splices: GT/AG | 26079964 Number of splices: GC/AG | 309548 Number of splices: AT/AC | 11630 Number of splices: Non-canonical | 22804 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.00% Deletion average length | 1.43 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 192315 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 14132 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.66% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 259810 259810 259810 N_multimapping 192315 192315 192315 N_noFeature 945799 22762928 1129445 N_ambiguous 538642 3148 86298 UnstrandedReadsAssigned:21915049 PositiveStrandReadsAssigned:633414 NegativeStrandReadsAssigned:22183747 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958315 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958315-trimmed-pair1.fastq SRR6958315-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,842,825 reads, 22,248,169 reads pseudoaligned [quant] estimated average fragment length: 255.365 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,209 rounds 52973 SRR6958315.ke.tsv 35125 SRR6958315.se.tsv 88098 total ==> SRR6958315.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 682.223 0 0 PNS24247 1044 789.635 91.061 7.72581 PNS24249 1928 1673.63 47.4079 1.8977 PNS24246 1044 789.635 91.061 7.72581 PNS24248 1044 789.635 91.061 7.72581 PNS24244 1471 1216.63 37.4091 2.05994 PNS24243 293 95.345 0 0 KQK14069 1603 1348.63 1363.29 67.7222 KQK14071 474 237.761 48.4101 13.6406 ==> SRR6958315.se.tsv <== BRADI_1g14170v3 1689 BRADI_1g53295v3 272 BRADI_1g59795v3 676 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 604 BRADI_1g74790v3 125 BRADI_1g09890v3 0 BRADI_1g77505v3 399 BRADI_1g48960v3 0 SRR6958315 completed mapping pipeline successfully