Starting /dee2/code/volunteer_pipeline.sh SRR6958316 current disk space = 1549719584768 free memory = 1597670684 SRR6958316 SRAfilesize a04d99fa4d5ca1518487c564da00baee SRR6958316.sra SRR6958316.sra file validated SRR6958316 is paired end SRR6958316 is conventional basespace SRR6958316 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958316_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.13425 34.0 33.0 34.0 32.0 34.0 2 33.3525 34.0 33.0 34.0 33.0 34.0 3 33.31225 34.0 33.0 34.0 33.0 34.0 4 32.976 33.0 33.0 34.0 32.0 34.0 5 33.195 34.0 33.0 34.0 33.0 34.0 6 37.01125 38.0 37.0 38.0 35.0 38.0 7 37.223 38.0 38.0 38.0 36.0 38.0 8 37.3895 38.0 38.0 38.0 37.0 38.0 9 37.5835 38.0 38.0 38.0 37.0 38.0 10-14 37.5637 38.0 38.0 38.0 38.0 38.0 15-19 37.51434999999999 38.0 38.0 38.0 37.8 38.0 20-24 37.603899999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.5843 38.0 38.0 38.0 38.0 38.0 30-34 37.51010000000001 38.0 38.0 38.0 37.6 38.0 35-39 37.5045 38.0 38.0 38.0 37.8 38.0 40-44 37.506099999999996 38.0 38.0 38.0 37.4 38.0 45-49 37.4687 38.0 38.0 38.0 37.2 38.0 50-54 37.39345 38.0 38.0 38.0 37.0 38.0 55-59 37.30105 38.0 38.0 38.0 37.0 38.0 60-64 37.0971 38.0 38.0 38.0 36.6 38.0 65-69 37.22065 38.0 38.0 38.0 36.4 38.0 70-74 37.14005 38.0 38.0 38.0 36.0 38.0 75-79 37.04035 38.0 38.0 38.0 36.0 38.0 80-84 37.003699999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.96125 38.0 38.0 38.0 35.2 38.0 90-94 36.82 38.0 38.0 38.0 35.0 38.0 95-99 36.62675 38.0 38.0 38.0 34.0 38.0 100-104 36.2889 38.0 37.8 38.0 32.8 38.0 105-109 36.18655 38.0 37.8 38.0 32.6 38.0 110-114 35.954049999999995 38.0 37.4 38.0 31.6 38.0 115-119 35.6306 38.0 36.6 38.0 30.4 38.0 120-124 35.504949999999994 38.0 36.4 38.0 30.6 38.0 125-129 35.275349999999996 38.0 36.0 38.0 29.0 38.0 130-134 34.87795 38.0 35.6 38.0 27.8 38.0 135-139 34.0003 38.0 33.2 38.0 24.0 38.0 140-144 33.7033 38.0 33.0 38.0 22.4 38.0 145-149 33.118 38.0 33.0 38.0 18.2 38.0 150-151 26.346125 32.0 17.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 0.0 16 1.0 17 2.0 18 3.0 19 7.0 20 1.0 21 2.0 22 8.0 23 10.0 24 13.0 25 14.0 26 17.0 27 21.0 28 26.0 29 34.0 30 36.0 31 47.0 32 72.0 33 94.0 34 159.0 35 293.0 36 831.0 37 2307.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.05 9.85 9.75 36.35 2 24.275 11.675 33.575 30.475 3 22.15 15.525 26.650000000000002 35.675000000000004 4 25.424999999999997 22.8 23.75 28.025 5 26.974999999999998 26.75 23.400000000000002 22.875 6 24.575 30.3 22.425 22.7 7 19.125 21.925 38.4 20.549999999999997 8 21.825 22.825 28.075 27.275 9 20.225 22.1 31.825 25.85 10-14 23.98 25.485000000000003 25.005 25.53 15-19 24.302011407985592 24.186930851596117 25.748023616531572 25.76303412388672 20-24 24.095 24.735 25.095 26.075 25-29 23.549999999999997 24.325 25.874999999999996 26.25 30-34 23.635 24.529999999999998 25.15 26.685 35-39 24.165 24.224999999999998 25.4 26.21 40-44 24.08 24.395 24.89 26.634999999999998 45-49 24.18 24.15 25.374999999999996 26.295 50-54 23.845 24.315 25.685000000000002 26.155 55-59 24.0 24.185000000000002 25.595000000000002 26.22 60-64 23.949959807073956 24.432274919614148 25.406953376205788 26.210811897106108 65-69 24.445 23.825 25.509999999999998 26.22 70-74 23.965 24.474999999999998 25.295 26.265 75-79 24.40488097619524 24.324864972994597 25.18503700740148 26.085217043408683 80-84 24.36 24.5 25.2 25.94 85-89 24.953743061459218 23.883582537380608 24.64369655448317 26.518977846677 90-94 25.345000000000002 23.599999999999998 25.25 25.805 95-99 24.37 23.805 25.095 26.729999999999997 100-104 24.94 24.14 25.264999999999997 25.655 105-109 25.140028005601124 23.999799959992 24.64492898579716 26.21524304860972 110-114 23.974999999999998 24.42 24.975 26.63 115-119 24.356217810890545 24.221211060553028 25.11125556277814 26.311315565778287 120-124 24.215 24.775 24.925 26.085 125-129 24.2797118847539 24.479791916766708 24.939975990396157 26.300520208083235 130-134 24.15 24.635 24.740000000000002 26.474999999999998 135-139 24.902490249024904 24.727472747274728 24.977497749774976 25.392539253925396 140-144 24.335 24.43 25.035 26.200000000000003 145-149 24.39 24.795 24.425 26.39 150-151 25.05 24.5625 24.212500000000002 26.174999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.5 28 2.0 29 3.0 30 4.5 31 4.5 32 7.0 33 15.5 34 22.5 35 22.5 36 27.5 37 43.0 38 60.0 39 88.5 40 112.5 41 121.5 42 139.0 43 170.5 44 185.0 45 181.5 46 187.5 47 199.5 48 193.5 49 180.0 50 165.0 51 163.0 52 155.0 53 126.0 54 115.0 55 117.0 56 112.5 57 104.5 58 97.5 59 87.0 60 85.5 61 78.0 62 72.0 63 68.0 64 70.0 65 71.5 66 59.0 67 46.0 68 45.0 69 42.0 70 32.0 71 30.5 72 24.0 73 15.0 74 13.0 75 14.0 76 8.0 77 3.5 78 4.0 79 1.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.06999999999999999 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.48 65-69 0.0 70-74 0.0 75-79 0.02 80-84 0.0 85-89 0.015 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.02 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.04 130-134 0.0 135-139 0.01 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1681371313335 98.35000000000001 2 0.8318628686664987 1.6500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 1.0499999999999998 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.575 0.0 0.0 0.0 0.0 110-111 1.7375 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.2125 0.0 0.0 0.0 0.0 116-117 2.5625 0.0 0.0 0.0 0.0 118-119 2.8375 0.0 0.0 0.0 0.0 120-121 3.075 0.0 0.0 0.0 0.0 122-123 3.325 0.0 0.0 0.0 0.0 124-125 3.6125 0.0 0.0 0.0 0.0 126-127 4.025 0.0 0.0 0.0 0.0 128-129 4.4 0.0 0.0 0.0 0.0 130-131 4.85 0.0 0.0 0.0 0.0 132-133 5.275 0.0 0.0 0.0 0.0 134-135 5.725 0.0 0.0 0.0 0.0 136-137 6.2125 0.0 0.0 0.0 0.0 138-139 6.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGTTGT 10 0.006843168 144.91249 5 >>END_MODULE SRR6958316 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958316_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90025 33.0 33.0 34.0 32.0 34.0 2 32.9685 34.0 33.0 34.0 32.0 34.0 3 32.95625 34.0 33.0 34.0 32.0 34.0 4 32.9475 34.0 33.0 34.0 33.0 34.0 5 32.8655 34.0 33.0 34.0 32.0 34.0 6 37.033 38.0 38.0 38.0 37.0 38.0 7 37.15275 38.0 38.0 38.0 37.0 38.0 8 37.104 38.0 38.0 38.0 37.0 38.0 9 37.10125 38.0 38.0 38.0 37.0 38.0 10-14 37.03745 38.0 38.0 38.0 37.0 38.0 15-19 37.0147 38.0 38.0 38.0 37.0 38.0 20-24 36.98055000000001 38.0 38.0 38.0 37.0 38.0 25-29 36.93345 38.0 38.0 38.0 36.8 38.0 30-34 36.94535 38.0 38.0 38.0 37.0 38.0 35-39 36.941700000000004 38.0 38.0 38.0 37.0 38.0 40-44 36.83795 38.0 38.0 38.0 36.8 38.0 45-49 36.8621 38.0 38.0 38.0 36.4 38.0 50-54 36.773849999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.762800000000006 38.0 38.0 38.0 36.0 38.0 60-64 36.725199999999994 38.0 38.0 38.0 36.0 38.0 65-69 36.6468 38.0 38.0 38.0 35.8 38.0 70-74 36.6733 38.0 38.0 38.0 36.0 38.0 75-79 36.60025 38.0 38.0 38.0 35.4 38.0 80-84 36.555249999999994 38.0 38.0 38.0 35.2 38.0 85-89 36.4128 38.0 38.0 38.0 34.8 38.0 90-94 36.3212 38.0 38.0 38.0 34.2 38.0 95-99 36.2284 38.0 38.0 38.0 34.0 38.0 100-104 36.13685 38.0 38.0 38.0 34.0 38.0 105-109 36.026050000000005 38.0 38.0 38.0 33.8 38.0 110-114 35.78165 38.0 38.0 38.0 32.8 38.0 115-119 35.589150000000004 38.0 37.4 38.0 32.4 38.0 120-124 35.4992 38.0 37.2 38.0 32.0 38.0 125-129 35.38465 38.0 36.4 38.0 31.4 38.0 130-134 35.1802 38.0 36.0 38.0 31.0 38.0 135-139 34.9222 38.0 36.0 38.0 28.6 38.0 140-144 34.53994999999999 38.0 35.8 38.0 27.6 38.0 145-149 33.6386 38.0 33.6 38.0 21.4 38.0 150-151 29.784875 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 8.0 4 2.0 5 1.0 6 3.0 7 1.0 8 0.0 9 4.0 10 1.0 11 3.0 12 3.0 13 0.0 14 3.0 15 2.0 16 3.0 17 5.0 18 4.0 19 3.0 20 8.0 21 5.0 22 4.0 23 5.0 24 15.0 25 17.0 26 9.0 27 24.0 28 24.0 29 21.0 30 29.0 31 54.0 32 63.0 33 84.0 34 135.0 35 202.0 36 503.0 37 2725.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.324999999999996 17.95 12.575 30.15 2 29.543172690763054 22.188755020080322 26.179718875502004 22.08835341365462 3 22.85857824667169 25.521225822657623 26.6767143933685 24.943481537302187 4 27.448518332496235 29.90959316926168 21.044701155198393 21.597187343043696 5 28.790160642570285 31.501004016064254 19.703815261044177 20.005020080321284 6 24.893350062735255 34.80552070263488 18.193224592220826 22.107904642409036 7 22.383939774153074 18.946047678795484 34.027603513174405 24.642409033877037 8 24.090338770388957 22.05771643663739 24.51693851944793 29.33500627352572 9 23.764115432873275 22.58469259723965 24.993726474278542 28.65746549560853 10-14 25.69535093884928 25.740536198413494 22.823576664323728 25.740536198413494 15-19 26.077564553400983 25.46468401486989 23.03325630463177 25.42449512709736 20-24 26.10463948584053 25.080337417152037 23.699538059851374 25.115485037156056 25-29 25.83869023704299 25.441944556046604 23.19204499799116 25.527320208919246 30-34 25.217085780253978 25.357626863424183 23.520554133413643 25.904733222908195 35-39 25.78183826113147 25.330053712163043 23.568093971186187 25.3200140555193 40-44 26.46291277727592 25.07276924621098 23.471845829569407 24.992472146943694 45-49 26.061427280939476 24.887082204155377 23.326307337147444 25.725183177757703 50-54 26.056620821202692 24.711374360004015 23.98353578957936 25.248469029213933 55-59 26.345111423408955 24.8444087532624 23.710098373820518 25.10038144950813 60-64 26.444455599618493 24.361226846041863 23.97971989357964 25.214597660760003 65-69 26.460550090343304 25.060228869704876 23.05259987954226 25.426621160409557 70-74 26.221195843164818 25.332597017922588 23.259199759024046 25.18700737988855 75-79 26.521804586741602 24.624880814974656 23.947408039343603 24.90590655894013 80-84 26.511767953028553 24.83063180609224 23.922316455060972 24.735283785818236 85-89 26.332697520329283 24.947294448348558 23.597028410802128 25.12297962052003 90-94 26.7603513174404 24.82308657465496 24.065244667503137 24.351317440401505 95-99 26.52374736419319 25.183251330454866 23.712220102419924 24.58078120293202 100-104 26.91129963355253 25.189498519150643 23.6182922544049 24.280909592891923 105-109 26.06033227927521 24.976158209105055 24.18310495407318 24.780404557546554 110-114 26.566265060240962 25.51706827309237 23.59437751004016 24.322289156626507 115-119 26.773076343924107 25.342568890227373 23.656075892184912 24.228278873663605 120-124 26.867844948784896 25.53223538863226 23.759791122715406 23.840128539867443 125-129 26.87578419071518 25.62107904642409 23.498117942283564 24.005018820577163 130-134 26.839674731452668 25.64501556068668 23.7375765485393 23.777733159321354 135-139 26.96245733788396 25.722746436458543 23.60469785183698 23.710098373820518 140-144 27.45619760028114 25.7693659320247 23.224057432602038 23.550379035092124 145-149 27.365831618053114 25.940057231788742 23.781314323008182 22.912796827149958 150-151 28.134019324883923 25.561551010164386 23.01417994729577 23.290249717655918 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 7.0 2 5.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 2.0 29 3.0 30 4.5 31 5.5 32 5.5 33 9.0 34 18.0 35 21.0 36 27.0 37 38.5 38 57.5 39 84.0 40 106.0 41 119.0 42 136.5 43 171.0 44 183.5 45 181.0 46 174.5 47 159.5 48 162.0 49 165.5 50 160.5 51 141.0 52 121.0 53 122.5 54 124.5 55 113.0 56 102.0 57 107.0 58 110.0 59 101.0 60 101.0 61 100.5 62 86.0 63 76.5 64 72.0 65 70.0 66 71.5 67 72.0 68 62.0 69 48.5 70 37.5 71 33.0 72 33.0 73 26.5 74 18.0 75 12.5 76 9.0 77 5.0 78 2.0 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.475 4 0.44999999999999996 5 0.4 6 0.375 7 0.375 8 0.375 9 0.375 10-14 0.41000000000000003 15-19 0.47000000000000003 20-24 0.42 25-29 0.44 30-34 0.385 35-39 0.395 40-44 0.37 45-49 0.37 50-54 0.38999999999999996 55-59 0.38 60-64 0.395 65-69 0.38 70-74 0.40499999999999997 75-79 0.365 80-84 0.365 85-89 0.38999999999999996 90-94 0.375 95-99 0.41000000000000003 100-104 0.395 105-109 0.385 110-114 0.4 115-119 0.385 120-124 0.42 125-129 0.375 130-134 0.38999999999999996 135-139 0.38 140-144 0.40499999999999997 145-149 0.40499999999999997 150-151 0.3875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11369967080273 97.85000000000001 2 0.6583945302608255 1.3 3 0.17726006583945303 0.525 4 0.0 0.0 5 0.02532286654849329 0.125 6 0.0 0.0 7 0.0 0.0 8 0.02532286654849329 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.0750000000000002 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.425 0.0 0.0 0.0 0.0 108-109 1.6 0.0 0.0 0.0 0.0 110-111 1.7625 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.2625 0.0 0.0 0.0 0.0 116-117 2.6125 0.0 0.0 0.0 0.0 118-119 2.8875 0.0 0.0 0.0 0.0 120-121 3.1125 0.0 0.0 0.0 0.0 122-123 3.3499999999999996 0.0 0.0 0.0 0.0 124-125 3.6375 0.0 0.0 0.0 0.0 126-127 4.05 0.0 0.0 0.0 0.0 128-129 4.4 0.0 0.0 0.0 0.0 130-131 4.875 0.0 0.0 0.0 0.0 132-133 5.3 0.0 0.0 0.0 0.0 134-135 5.737500000000001 0.0 0.0 0.0 0.0 136-137 6.2125 0.0 0.0 0.0 0.0 138-139 6.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1249755 spots for SRR6958316.sra Written 1249755 spots for SRR6958316.sra Read 1249755 spots for SRR6958316.sra Written 1249755 spots for SRR6958316.sra Read 1249755 spots for SRR6958316.sra Written 1249755 spots for SRR6958316.sra Read 1249755 spots for SRR6958316.sra Written 1249755 spots for SRR6958316.sra Read 1249755 spots for SRR6958316.sra Written 1249755 spots for SRR6958316.sra Read 1249756 spots for SRR6958316.sra Written 1249756 spots for SRR6958316.sra Read 1249755 spots for SRR6958316.sra Written 1249755 spots for SRR6958316.sra Read 1249755 spots for SRR6958316.sra Written 1249755 spots for SRR6958316.sra Read 1249755 spots for SRR6958316.sra Written 1249755 spots for SRR6958316.sra Read 1249755 spots for SRR6958316.sra Written 1249755 spots for SRR6958316.sra Read 1249755 spots for SRR6958316.sra Written 1249755 spots for SRR6958316.sra Read 1249755 spots for SRR6958316.sra Written 1249755 spots for SRR6958316.sra Read 1249755 spots for SRR6958316.sra Written 1249755 spots for SRR6958316.sra Read 1249755 spots for SRR6958316.sra Written 1249755 spots for SRR6958316.sra Read 1249755 spots for SRR6958316.sra Written 1249755 spots for SRR6958316.sra Read 1249755 spots for SRR6958316.sra Written 1249755 spots for SRR6958316.sra Read 1249755 spots for SRR6958316.sra Written 1249755 spots for SRR6958316.sra Read 1249755 spots for SRR6958316.sra Written 1249755 spots for SRR6958316.sra Read 1249755 spots for SRR6958316.sra Written 1249755 spots for SRR6958316.sra Read 1249755 spots for SRR6958316.sra Written 1249755 spots for SRR6958316.sra SRR ids: ['SRR6958316.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8w1o8ryc SRR6958316.sra spots: 24995101 blocks: [[1, 1249755], [1249756, 2499510], [2499511, 3749265], [3749266, 4999020], [4999021, 6248775], [6248776, 7498530], [7498531, 8748285], [8748286, 9998040], [9998041, 11247795], [11247796, 12497550], [12497551, 13747305], [13747306, 14997060], [14997061, 16246815], [16246816, 17496570], [17496571, 18746325], [18746326, 19996080], [19996081, 21245835], [21245836, 22495590], [22495591, 23745345], [23745346, 24995101]] SRR6958316 file size 8448319 SRR6958316 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958316 SRR6958316_1.fastq SRR6958316_2.fastq Input file: SRR6958316_1.fastq Paired file: SRR6958316_2.fastq trimmed: SRR6958316-trimmed-pair1.fastq, SRR6958316-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:39:13 2024 >> started Fri Dec 6 19:39:38 2024 >> done (25.156s) 24995101 read pairs processed; of these: 34024 ( 0.14%) short read pairs filtered out after trimming by size control 92538 ( 0.37%) empty read pairs filtered out after trimming by size control 24868539 (99.49%) read pairs available; of these: 11751743 (47.26%) trimmed read pairs available after processing 13116796 (52.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 5 0.00% 21 5 0.00% 22 3 0.00% 23 7 0.00% 24 9 0.00% 25 10 0.00% 26 5 0.00% 27 1 0.00% 28 5 0.00% 29 8 0.00% 30 6 0.00% 31 8 0.00% 32 7 0.00% 33 9 0.00% 34 11 0.00% 35 9 0.00% 36 7 0.00% 37 16 0.00% 38 17 0.00% 39 12 0.00% 40 7 0.00% 41 22 0.00% 42 22 0.00% 43 25 0.00% 44 20 0.00% 45 34 0.00% 46 37 0.00% 47 46 0.00% 48 42 0.00% 49 52 0.00% 50 66 0.00% 51 57 0.00% 52 90 0.00% 53 97 0.00% 54 120 0.00% 55 154 0.00% 56 142 0.00% 57 159 0.00% 58 194 0.00% 59 220 0.00% 60 263 0.00% 61 326 0.00% 62 346 0.00% 63 444 0.00% 64 490 0.00% 65 516 0.00% 66 549 0.00% 67 707 0.00% 68 775 0.00% 69 880 0.00% 70 1085 0.00% 71 1296 0.01% 72 1411 0.01% 73 1605 0.01% 74 1935 0.01% 75 1996 0.01% 76 2405 0.01% 77 2727 0.01% 78 2965 0.01% 79 3376 0.01% 80 3847 0.02% 81 4279 0.02% 82 5024 0.02% 83 5505 0.02% 84 7323 0.03% 85 8716 0.04% 86 9178 0.04% 87 9659 0.04% 88 10416 0.04% 89 11236 0.05% 90 11879 0.05% 91 12824 0.05% 92 13939 0.06% 93 14772 0.06% 94 16275 0.07% 95 17140 0.07% 96 18124 0.07% 97 19274 0.08% 98 19916 0.08% 99 21019 0.08% 100 22378 0.09% 101 23330 0.09% 102 25408 0.10% 103 26526 0.11% 104 28148 0.11% 105 29327 0.12% 106 30856 0.12% 107 31748 0.13% 108 33136 0.13% 109 34016 0.14% 110 34697 0.14% 111 37191 0.15% 112 38688 0.16% 113 40219 0.16% 114 42698 0.17% 115 44449 0.18% 116 45932 0.18% 117 47427 0.19% 118 48385 0.19% 119 49387 0.20% 120 51434 0.21% 121 52868 0.21% 122 55125 0.22% 123 57623 0.23% 124 59938 0.24% 125 62335 0.25% 126 63390 0.25% 127 65333 0.26% 128 67105 0.27% 129 68757 0.28% 130 70915 0.29% 131 72555 0.29% 132 75114 0.30% 133 79417 0.32% 134 80943 0.33% 135 84739 0.34% 136 87932 0.35% 137 90229 0.36% 138 93122 0.37% 139 98755 0.40% 140 102604 0.41% 141 109792 0.44% 142 118188 0.48% 143 128706 0.52% 144 144364 0.58% 145 167208 0.67% 146 203286 0.82% 147 270756 1.09% 148 409443 1.65% 149 882806 3.55% 150 6794798 27.32% 151 13116796 52.74% 24868539 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=20 prefix-density=0.65 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=43.37 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.3 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.73 fanout-score-rank=22 prefix-density=0.50 prefix-fanout=3.0 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=132.74 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=6.4 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTT SRR6958316 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:40:35 Started mapping on | Dec 06 19:40:35 Finished on | Dec 06 19:42:45 Mapping speed, Million of reads per hour | 688.67 Number of input reads | 24868539 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 23871014 Uniquely mapped reads % | 95.99% Average mapped length | 294.16 Number of splices: Total | 27524440 Number of splices: Annotated (sjdb) | 25897687 Number of splices: GT/AG | 27149037 Number of splices: GC/AG | 328168 Number of splices: AT/AC | 10823 Number of splices: Non-canonical | 36412 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 2.62 Insertion rate per base | 0.01% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 244751 % of reads mapped to multiple loci | 0.98% Number of reads mapped to too many loci | 41332 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.97% % of reads unmapped: other | 0.89% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 771357 771357 771357 N_multimapping 244751 244751 244751 N_noFeature 737398 23258008 895757 N_ambiguous 546283 2954 93610 UnstrandedReadsAssigned:22587333 PositiveStrandReadsAssigned:610052 NegativeStrandReadsAssigned:22881647 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958316 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958316-trimmed-pair1.fastq SRR6958316-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,868,539 reads, 22,905,874 reads pseudoaligned [quant] estimated average fragment length: 254.047 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52973 SRR6958316.ke.tsv 35125 SRR6958316.se.tsv 88098 total ==> SRR6958316.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 683.309 0 0 PNS24247 1044 790.953 86.6638 6.98748 PNS24249 1928 1674.95 66.8194 2.54409 PNS24246 1044 790.953 86.6638 6.98748 PNS24248 1044 790.953 86.6638 6.98748 PNS24244 1471 1217.95 36.1892 1.89488 PNS24243 293 92.493 0 0 KQK14069 1603 1349.95 4196.32 198.237 KQK14071 474 234.833 142.119 38.5946 ==> SRR6958316.se.tsv <== BRADI_1g14170v3 4988 BRADI_1g53295v3 336 BRADI_1g59795v3 410 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 435 BRADI_1g74790v3 222 BRADI_1g09890v3 0 BRADI_1g77505v3 314 BRADI_1g48960v3 1 SRR6958316 completed mapping pipeline successfully