Starting /dee2/code/volunteer_pipeline.sh SRR6958317 current disk space = 1549715562496 free memory = 1596674256 SRR6958317 SRAfilesize bccedec4f8c6732d1a7290d84cff33c5 SRR6958317.sra SRR6958317.sra file validated SRR6958317 is paired end SRR6958317 is conventional basespace SRR6958317 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958317_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.933 31.0 18.0 33.0 18.0 33.0 2 27.5095 29.0 25.0 31.0 18.0 33.0 3 30.842 31.0 29.0 33.0 27.0 33.0 4 32.42575 33.0 33.0 33.0 32.0 33.0 5 32.97725 33.0 33.0 34.0 33.0 34.0 6 37.118 38.0 37.0 38.0 36.0 38.0 7 37.33175 38.0 38.0 38.0 36.0 38.0 8 37.22325 38.0 38.0 38.0 36.0 38.0 9 37.59925 38.0 38.0 38.0 37.0 38.0 10-14 37.16074999999999 38.0 38.0 38.0 35.8 38.0 15-19 35.73394999999999 37.8 35.0 38.0 31.2 38.0 20-24 36.0672 38.0 36.8 38.0 30.0 38.0 25-29 37.5942 38.0 38.0 38.0 37.8 38.0 30-34 37.67465 38.0 38.0 38.0 38.0 38.0 35-39 37.602850000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.666599999999995 38.0 38.0 38.0 38.0 38.0 45-49 37.67985 38.0 38.0 38.0 38.0 38.0 50-54 37.65095 38.0 38.0 38.0 38.0 38.0 55-59 37.582800000000006 38.0 38.0 38.0 38.0 38.0 60-64 37.56265 38.0 38.0 38.0 38.0 38.0 65-69 37.57795 38.0 38.0 38.0 38.0 38.0 70-74 37.537049999999994 38.0 38.0 38.0 38.0 38.0 75-79 36.7201 38.0 37.6 38.0 33.8 38.0 80-84 37.44235 38.0 38.0 38.0 37.6 38.0 85-89 37.421 38.0 38.0 38.0 37.2 38.0 90-94 36.960950000000004 38.0 38.0 38.0 35.4 38.0 95-99 37.29735 38.0 38.0 38.0 37.0 38.0 100-104 37.27315 38.0 38.0 38.0 36.8 38.0 105-109 37.258900000000004 38.0 38.0 38.0 36.4 38.0 110-114 37.243700000000004 38.0 38.0 38.0 36.2 38.0 115-119 36.98479999999999 38.0 38.0 38.0 35.6 38.0 120-124 36.7538 38.0 38.0 38.0 34.8 38.0 125-129 36.7904 38.0 38.0 38.0 35.0 38.0 130-134 36.7166 38.0 38.0 38.0 35.0 38.0 135-139 36.6092 38.0 38.0 38.0 35.0 38.0 140-144 36.4555 38.0 38.0 38.0 34.2 38.0 145-149 36.08729999999999 38.0 38.0 38.0 33.4 38.0 150-151 32.412375 35.5 33.0 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 2.0 21 2.0 22 2.0 23 1.0 24 7.0 25 1.0 26 8.0 27 5.0 28 8.0 29 17.0 30 27.0 31 32.0 32 40.0 33 59.0 34 93.0 35 191.0 36 614.0 37 2888.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.278481012658226 10.962025316455696 6.227848101265822 38.53164556962025 2 22.7 13.725000000000001 33.125 30.45 3 21.224999999999998 18.05 24.3 36.425000000000004 4 25.381345336334082 25.98149537384346 22.43060765191298 26.206551637909474 5 25.874999999999996 30.725 22.85 20.549999999999997 6 22.230557639409852 32.483120780195044 23.080770192548137 22.20555138784696 7 17.9 24.5 40.150000000000006 17.45 8 18.8 24.925 29.849999999999998 26.424999999999997 9 20.125 20.424999999999997 33.25 26.200000000000003 10-14 22.025 27.595 25.545 24.834999999999997 15-19 22.455 26.490000000000002 26.02 25.035 20-24 22.285 26.56 26.27 24.884999999999998 25-29 22.945 25.81 26.265 24.98 30-34 22.26222622262226 26.05260526052605 26.32263226322632 25.36253625362536 35-39 22.322232223222322 26.51765176517652 25.67256725672567 25.48754875487549 40-44 22.41 26.615 25.915 25.06 45-49 22.634999999999998 26.41 25.729999999999997 25.224999999999998 50-54 22.295 26.400000000000002 25.869999999999997 25.435000000000002 55-59 23.05 26.119999999999997 25.474999999999998 25.355 60-64 22.689999999999998 26.240000000000002 25.435000000000002 25.635 65-69 22.737273727372738 25.452545254525454 26.4026402640264 25.40754075407541 70-74 23.15231523152315 25.74757475747575 26.067606760676064 25.032503250325032 75-79 22.605 25.4 25.91 26.085 80-84 22.522252225222523 25.467546754675467 26.46264626462646 25.54755475547555 85-89 23.0 26.345000000000002 26.075 24.58 90-94 23.235 25.465 25.94 25.36 95-99 22.673401010151522 25.553833074961247 25.948892333850075 25.823873581037155 100-104 22.830000000000002 25.874999999999996 25.805 25.490000000000002 105-109 23.11615580779039 25.65128256412821 25.716285814290714 25.51627581379069 110-114 23.246162308115405 25.6062803140157 26.306315315765787 24.841242062103106 115-119 23.312331233123313 25.447544754475448 25.532553255325535 25.70757075707571 120-124 22.82 25.965 25.8 25.415 125-129 23.407340734073408 25.50755075507551 25.347534753475347 25.73757375737574 130-134 23.935000000000002 26.185000000000002 24.69 25.19 135-139 23.355 25.66 25.240000000000002 25.745 140-144 23.14 25.775 25.83 25.255 145-149 22.855 25.985000000000003 25.53 25.629999999999995 150-151 23.150000000000002 26.087500000000002 25.775 24.9875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 0.5 27 0.5 28 3.0 29 5.0 30 12.5 31 18.0 32 14.0 33 19.0 34 30.5 35 42.0 36 60.5 37 87.5 38 105.5 39 118.5 40 143.5 41 165.5 42 189.0 43 204.5 44 204.0 45 206.0 46 220.5 47 215.5 48 189.0 49 175.0 50 154.5 51 142.5 52 126.0 53 112.5 54 116.5 55 98.5 56 87.5 57 75.0 58 52.5 59 53.5 60 49.5 61 50.0 62 54.0 63 48.0 64 43.0 65 45.5 66 41.0 67 28.0 68 30.5 69 34.5 70 28.0 71 22.0 72 23.0 73 15.0 74 12.5 75 12.5 76 4.5 77 1.0 78 1.0 79 0.5 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.25 2 0.0 3 0.0 4 0.025 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.01 75-79 0.0 80-84 0.01 85-89 0.0 90-94 0.0 95-99 0.015 100-104 0.0 105-109 0.005 110-114 0.005 115-119 0.01 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.8500000000000001 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.3625 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.875 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0125 112-113 2.4 0.0 0.0 0.0 0.025 114-115 2.7249999999999996 0.0 0.0 0.0 0.025 116-117 3.1125 0.0 0.0 0.0 0.025 118-119 3.4749999999999996 0.0 0.0 0.0 0.025 120-121 3.825 0.0 0.0 0.0 0.025 122-123 4.225 0.0 0.0 0.0 0.025 124-125 4.6625 0.0 0.0 0.0 0.025 126-127 5.2125 0.0 0.0 0.0 0.025 128-129 5.725 0.0 0.0 0.0 0.025 130-131 6.225 0.0 0.0 0.0 0.025 132-133 6.550000000000001 0.0 0.0 0.0 0.025 134-135 7.1 0.0 0.0 0.0 0.025 136-137 7.6875 0.0 0.0 0.0 0.025 138-139 8.25 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGAGT 10 0.006830828 145.0 3 AATATTA 10 0.006830828 145.0 5 >>END_MODULE SRR6958317 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958317_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.812 33.0 33.0 34.0 32.0 34.0 2 33.08975 33.0 33.0 34.0 32.0 34.0 3 33.22675 34.0 33.0 34.0 33.0 34.0 4 33.281 34.0 33.0 34.0 33.0 34.0 5 31.50375 33.0 33.0 34.0 27.0 34.0 6 37.016 38.0 38.0 38.0 36.0 38.0 7 37.33625 38.0 38.0 38.0 37.0 38.0 8 37.42625 38.0 38.0 38.0 37.0 38.0 9 37.42475 38.0 38.0 38.0 38.0 38.0 10-14 37.405649999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.432449999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.4405 38.0 38.0 38.0 38.0 38.0 25-29 37.41055 38.0 38.0 38.0 38.0 38.0 30-34 37.4231 38.0 38.0 38.0 38.0 38.0 35-39 37.257099999999994 38.0 38.0 38.0 37.6 38.0 40-44 37.0955 38.0 38.0 38.0 37.0 38.0 45-49 37.07025 38.0 38.0 38.0 36.8 38.0 50-54 37.2937 38.0 38.0 38.0 37.4 38.0 55-59 37.37135 38.0 38.0 38.0 38.0 38.0 60-64 37.2829 38.0 38.0 38.0 37.4 38.0 65-69 37.30245 38.0 38.0 38.0 37.8 38.0 70-74 37.25305 38.0 38.0 38.0 37.4 38.0 75-79 37.227700000000006 38.0 38.0 38.0 37.0 38.0 80-84 37.132999999999996 38.0 38.0 38.0 36.8 38.0 85-89 37.09485 38.0 38.0 38.0 36.6 38.0 90-94 36.9968 38.0 38.0 38.0 36.2 38.0 95-99 36.7595 38.0 38.0 38.0 35.4 38.0 100-104 36.82675 38.0 38.0 38.0 35.6 38.0 105-109 36.77435 38.0 38.0 38.0 35.4 38.0 110-114 36.7626 38.0 38.0 38.0 35.6 38.0 115-119 36.64515 38.0 38.0 38.0 35.0 38.0 120-124 35.702 38.0 36.8 38.0 29.8 38.0 125-129 36.17385 38.0 38.0 38.0 33.8 38.0 130-134 36.13590000000001 38.0 38.0 38.0 33.8 38.0 135-139 35.773199999999996 38.0 37.8 38.0 32.0 38.0 140-144 35.37775 38.0 36.8 38.0 30.8 38.0 145-149 35.06985 38.0 36.0 38.0 30.4 38.0 150-151 28.538125 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 0.0 5 0.0 6 0.0 7 2.0 8 2.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 4.0 17 2.0 18 3.0 19 5.0 20 2.0 21 2.0 22 3.0 23 3.0 24 8.0 25 3.0 26 12.0 27 13.0 28 21.0 29 20.0 30 34.0 31 28.0 32 53.0 33 68.0 34 90.0 35 191.0 36 498.0 37 2917.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.1 19.400000000000002 11.0 29.5 2 30.675 23.325000000000003 28.325 17.675 3 20.935467733866933 25.63781890945473 30.315157578789393 23.111555777888945 4 27.05 30.7 21.224999999999998 21.025 5 26.55 32.9 20.75 19.8 6 22.525000000000002 36.25 19.950000000000003 21.275 7 22.575 19.625 35.75 22.05 8 22.400000000000002 23.575 26.325 27.700000000000003 9 23.225 21.725 29.2 25.85 10-14 25.790000000000003 26.26 23.645 24.305 15-19 25.715 25.56 24.86 23.865 20-24 25.52 25.919999999999998 24.740000000000002 23.82 25-29 25.631281564078208 26.00630031501575 24.63123156157808 23.731186559327966 30-34 25.8 25.55 24.66 23.990000000000002 35-39 25.52 25.424999999999997 24.98 24.075 40-44 24.971248562428123 26.021301065053255 24.7862393119656 24.221211060553028 45-49 26.161308065403272 25.45127256362818 25.006250312515625 23.381169058452922 50-54 25.755 25.919999999999998 25.0 23.325000000000003 55-59 25.669999999999998 25.7 24.959999999999997 23.669999999999998 60-64 25.430000000000003 26.075 24.945 23.549999999999997 65-69 25.645 26.284999999999997 25.169999999999998 22.900000000000002 70-74 25.455 25.715 25.240000000000002 23.59 75-79 26.145000000000003 25.27 25.240000000000002 23.345 80-84 25.99129956497825 25.696284814240713 24.926246312315616 23.386169308465423 85-89 25.88 25.615 25.014999999999997 23.49 90-94 25.929999999999996 25.569999999999997 24.94 23.56 95-99 25.21 26.21 25.41 23.169999999999998 100-104 26.06 25.0 25.319999999999997 23.62 105-109 26.165 25.31 25.290000000000003 23.235 110-114 25.345000000000002 26.179999999999996 25.674999999999997 22.8 115-119 26.3 26.43 24.91 22.36 120-124 25.6 25.97 25.66 22.770000000000003 125-129 26.367636763676366 25.962596259625965 25.237523752375235 22.43224322432243 130-134 26.93 25.85 24.745 22.475 135-139 26.77 25.55 25.345000000000002 22.335 140-144 26.634999999999998 26.525 25.324999999999996 21.515 145-149 26.866343317165857 26.64633231661583 24.861243062153108 21.626081304065202 150-151 27.375 26.2125 24.775 21.637500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 2.0 24 1.5 25 0.5 26 0.5 27 3.5 28 5.5 29 4.5 30 7.0 31 13.5 32 15.5 33 19.5 34 33.5 35 43.0 36 51.0 37 67.0 38 84.5 39 104.5 40 129.5 41 147.5 42 163.0 43 191.5 44 214.5 45 206.0 46 191.5 47 188.0 48 182.5 49 174.0 50 156.5 51 136.0 52 123.0 53 112.0 54 103.5 55 89.0 56 83.0 57 90.0 58 82.5 59 72.0 60 63.5 61 60.0 62 67.5 63 70.5 64 65.0 65 51.5 66 45.5 67 48.0 68 41.0 69 36.5 70 36.0 71 28.0 72 20.5 73 22.0 74 19.5 75 10.0 76 4.0 77 5.0 78 5.0 79 1.5 80 0.5 81 1.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.8500000000000001 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.3625 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.9 0.0 0.0 0.0 0.0 110-111 2.1500000000000004 0.0 0.0 0.0 0.0 112-113 2.4 0.0 0.0 0.0 0.0 114-115 2.6875 0.0 0.0 0.0 0.0 116-117 3.0625 0.0 0.0 0.0 0.0 118-119 3.425 0.0 0.0 0.0 0.0 120-121 3.75 0.0 0.0 0.0 0.0 122-123 4.1375 0.0 0.0 0.0 0.0 124-125 4.5875 0.0 0.0 0.0 0.0 126-127 5.1375 0.0 0.0 0.0 0.0 128-129 5.65 0.0 0.0 0.0 0.0 130-131 6.15 0.0 0.0 0.0 0.0 132-133 6.475 0.0 0.0 0.0 0.0 134-135 7.0625 0.0 0.0 0.0 0.0 136-137 7.7125 0.0 0.0 0.0 0.0 138-139 8.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAAT 10 0.006830828 145.0 1 >>END_MODULE Read 1153981 spots for SRR6958317.sra Written 1153981 spots for SRR6958317.sra Read 1153981 spots for SRR6958317.sra Written 1153981 spots for SRR6958317.sra Read 1153981 spots for SRR6958317.sra Written 1153981 spots for SRR6958317.sra Read 1153981 spots for SRR6958317.sra Written 1153981 spots for SRR6958317.sra Read 1153981 spots for SRR6958317.sra Written 1153981 spots for SRR6958317.sra Read 1153981 spots for SRR6958317.sra Written 1153981 spots for SRR6958317.sra Read 1153981 spots for SRR6958317.sra Written 1153981 spots for SRR6958317.sra Read 1153981 spots for SRR6958317.sra Written 1153981 spots for SRR6958317.sra Read 1153981 spots for SRR6958317.sra Written 1153981 spots for SRR6958317.sra Read 1153981 spots for SRR6958317.sra Written 1153981 spots for SRR6958317.sra Read 1153981 spots for SRR6958317.sra Written 1153981 spots for SRR6958317.sra Read 1153981 spots for SRR6958317.sra Written 1153981 spots for SRR6958317.sra Read 1153981 spots for SRR6958317.sra Written 1153981 spots for SRR6958317.sra Read 1153981 spots for SRR6958317.sra Written 1153981 spots for SRR6958317.sra Read 1153981 spots for SRR6958317.sra Written 1153981 spots for SRR6958317.sra Read 1153987 spots for SRR6958317.sra Written 1153987 spots for SRR6958317.sra Read 1153981 spots for SRR6958317.sra Written 1153981 spots for SRR6958317.sra Read 1153981 spots for SRR6958317.sra Written 1153981 spots for SRR6958317.sra Read 1153981 spots for SRR6958317.sra Written 1153981 spots for SRR6958317.sra Read 1153981 spots for SRR6958317.sra Written 1153981 spots for SRR6958317.sra SRR ids: ['SRR6958317.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rj23ofq1 SRR6958317.sra spots: 23079626 blocks: [[1, 1153981], [1153982, 2307962], [2307963, 3461943], [3461944, 4615924], [4615925, 5769905], [5769906, 6923886], [6923887, 8077867], [8077868, 9231848], [9231849, 10385829], [10385830, 11539810], [11539811, 12693791], [12693792, 13847772], [13847773, 15001753], [15001754, 16155734], [16155735, 17309715], [17309716, 18463696], [18463697, 19617677], [19617678, 20771658], [20771659, 21925639], [21925640, 23079626]] SRR6958317 file size 7799227 SRR6958317 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958317 SRR6958317_1.fastq SRR6958317_2.fastq Input file: SRR6958317_1.fastq Paired file: SRR6958317_2.fastq trimmed: SRR6958317-trimmed-pair1.fastq, SRR6958317-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:39:29 2024 >> started Fri Dec 6 19:40:08 2024 >> done (38.684s) 23079626 read pairs processed; of these: 18996 ( 0.08%) short read pairs filtered out after trimming by size control 23130 ( 0.10%) empty read pairs filtered out after trimming by size control 23037500 (99.82%) read pairs available; of these: 8386206 (36.40%) trimmed read pairs available after processing 14651294 (63.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 9 0.00% 20 15 0.00% 21 7 0.00% 22 7 0.00% 23 7 0.00% 24 16 0.00% 25 13 0.00% 26 10 0.00% 27 15 0.00% 28 9 0.00% 29 16 0.00% 30 18 0.00% 31 11 0.00% 32 19 0.00% 33 17 0.00% 34 23 0.00% 35 26 0.00% 36 27 0.00% 37 30 0.00% 38 21 0.00% 39 26 0.00% 40 37 0.00% 41 42 0.00% 42 49 0.00% 43 40 0.00% 44 48 0.00% 45 44 0.00% 46 59 0.00% 47 63 0.00% 48 75 0.00% 49 79 0.00% 50 105 0.00% 51 95 0.00% 52 118 0.00% 53 116 0.00% 54 131 0.00% 55 150 0.00% 56 170 0.00% 57 185 0.00% 58 235 0.00% 59 256 0.00% 60 333 0.00% 61 339 0.00% 62 362 0.00% 63 396 0.00% 64 441 0.00% 65 511 0.00% 66 573 0.00% 67 608 0.00% 68 688 0.00% 69 883 0.00% 70 947 0.00% 71 1012 0.00% 72 1297 0.01% 73 1366 0.01% 74 1625 0.01% 75 1767 0.01% 76 2072 0.01% 77 2219 0.01% 78 2396 0.01% 79 2691 0.01% 80 3094 0.01% 81 3621 0.02% 82 4059 0.02% 83 4541 0.02% 84 5664 0.02% 85 6846 0.03% 86 7282 0.03% 87 7890 0.03% 88 8506 0.04% 89 9031 0.04% 90 9739 0.04% 91 10826 0.05% 92 11636 0.05% 93 12592 0.05% 94 13738 0.06% 95 14498 0.06% 96 15550 0.07% 97 16797 0.07% 98 17765 0.08% 99 18911 0.08% 100 20243 0.09% 101 21414 0.09% 102 23061 0.10% 103 24847 0.11% 104 26057 0.11% 105 27605 0.12% 106 29194 0.13% 107 30454 0.13% 108 31706 0.14% 109 33236 0.14% 110 34444 0.15% 111 36447 0.16% 112 38132 0.17% 113 39526 0.17% 114 41835 0.18% 115 44275 0.19% 116 45183 0.20% 117 46702 0.20% 118 48425 0.21% 119 49797 0.22% 120 51381 0.22% 121 53274 0.23% 122 55246 0.24% 123 57151 0.25% 124 60220 0.26% 125 61197 0.27% 126 63062 0.27% 127 64709 0.28% 128 66136 0.29% 129 68563 0.30% 130 69782 0.30% 131 72184 0.31% 132 74745 0.32% 133 77206 0.34% 134 79456 0.34% 135 81953 0.36% 136 84935 0.37% 137 87705 0.38% 138 90207 0.39% 139 94015 0.41% 140 96323 0.42% 141 101736 0.44% 142 107421 0.47% 143 113709 0.49% 144 125450 0.54% 145 139948 0.61% 146 162402 0.70% 147 201728 0.88% 148 283866 1.23% 149 535160 2.32% 150 4185193 18.17% 151 14651294 63.60% 23037500 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.28 fanout-score-rank=24 prefix-density=0.37 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=171.58 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=10.9 sequence=GCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=4.49 fanout-score-rank=20 prefix-density=0.27 prefix-fanout=3.8 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=15 fanout-score=135.67 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=21.2 sequence=CAAGAAGAAGGT SRR6958317 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:40:50 Started mapping on | Dec 06 19:40:50 Finished on | Dec 06 19:42:15 Mapping speed, Million of reads per hour | 975.71 Number of input reads | 23037500 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 22624827 Uniquely mapped reads % | 98.21% Average mapped length | 294.49 Number of splices: Total | 24315008 Number of splices: Annotated (sjdb) | 22790422 Number of splices: GT/AG | 24001997 Number of splices: GC/AG | 276008 Number of splices: AT/AC | 12774 Number of splices: Non-canonical | 24229 Mismatch rate per base, % | 0.07% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 168194 % of reads mapped to multiple loci | 0.73% Number of reads mapped to too many loci | 17394 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.60% % of reads unmapped: other | 0.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 257614 257614 257614 N_multimapping 168194 168194 168194 N_noFeature 1050538 21982797 1293727 N_ambiguous 481900 3410 84217 UnstrandedReadsAssigned:21092389 PositiveStrandReadsAssigned:638620 NegativeStrandReadsAssigned:21246883 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958317 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958317-trimmed-pair1.fastq SRR6958317-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,037,500 reads, 21,288,043 reads pseudoaligned [quant] estimated average fragment length: 250.938 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52973 SRR6958317.ke.tsv 35125 SRR6958317.se.tsv 88098 total ==> SRR6958317.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 686.524 0.000266559 2.75835e-05 PNS24247 1044 794.062 64.8969 5.80607 PNS24249 1928 1678.06 88.4376 3.74405 PNS24246 1044 794.062 64.8969 5.80607 PNS24248 1044 794.062 64.8969 5.80607 PNS24244 1471 1221.06 50.8714 2.9597 PNS24243 293 96.7571 0 0 KQK14069 1603 1353.06 452.336 23.7496 KQK14071 474 241.093 7.95542 2.34418 ==> SRR6958317.se.tsv <== BRADI_1g14170v3 526 BRADI_1g53295v3 805 BRADI_1g59795v3 528 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 663 BRADI_1g74790v3 476 BRADI_1g09890v3 0 BRADI_1g77505v3 366 BRADI_1g48960v3 0 SRR6958317 completed mapping pipeline successfully