Starting /dee2/code/volunteer_pipeline.sh SRR6958318 current disk space = 1549642579968 free memory = 1340480052 SRR6958318 SRAfilesize f3278eb9e53ddc6382c79db1f43b2b42 SRR6958318.sra SRR6958318.sra file validated SRR6958318 is paired end SRR6958318 is conventional basespace SRR6958318 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958318_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.20875 18.0 18.0 18.0 18.0 32.0 2 20.12675 18.0 18.0 18.0 18.0 28.0 3 27.052 27.0 27.0 28.0 25.0 30.0 4 27.14925 29.0 25.0 31.0 15.0 33.0 5 31.5045 32.0 32.0 33.0 30.0 33.0 6 35.56625 37.0 35.0 38.0 31.0 38.0 7 36.2675 38.0 36.0 38.0 33.0 38.0 8 36.2705 38.0 36.0 38.0 33.0 38.0 9 37.02825 38.0 38.0 38.0 35.0 38.0 10-14 37.286849999999994 38.0 38.0 38.0 36.6 38.0 15-19 37.483050000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.53275 38.0 38.0 38.0 37.8 38.0 25-29 37.475849999999994 38.0 38.0 38.0 37.2 38.0 30-34 37.4639 38.0 38.0 38.0 37.0 38.0 35-39 37.412 38.0 38.0 38.0 37.0 38.0 40-44 37.3892 38.0 38.0 38.0 37.0 38.0 45-49 37.401799999999994 38.0 38.0 38.0 37.0 38.0 50-54 37.38825 38.0 38.0 38.0 37.0 38.0 55-59 37.320299999999996 38.0 38.0 38.0 37.0 38.0 60-64 36.8432 38.0 38.0 38.0 36.2 38.0 65-69 37.0968 38.0 38.0 38.0 36.0 38.0 70-74 37.16205000000001 38.0 38.0 38.0 36.0 38.0 75-79 37.0341 38.0 38.0 38.0 35.8 38.0 80-84 37.007200000000005 38.0 38.0 38.0 35.4 38.0 85-89 36.9781 38.0 38.0 38.0 35.6 38.0 90-94 36.97355 38.0 38.0 38.0 35.2 38.0 95-99 36.855549999999994 38.0 38.0 38.0 34.8 38.0 100-104 36.721999999999994 38.0 38.0 38.0 34.6 38.0 105-109 36.5163 38.0 38.0 38.0 34.0 38.0 110-114 36.4334 38.0 38.0 38.0 33.8 38.0 115-119 36.3792 38.0 38.0 38.0 34.0 38.0 120-124 36.18135 38.0 37.4 38.0 33.2 38.0 125-129 35.832049999999995 38.0 36.6 38.0 31.2 38.0 130-134 35.46515 38.0 36.0 38.0 31.0 38.0 135-139 35.1383 38.0 36.0 38.0 30.4 38.0 140-144 34.6375 38.0 35.6 38.0 27.4 38.0 145-149 34.08195 38.0 34.2 38.0 26.2 38.0 150-151 29.189 34.5 26.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 2.0 18 1.0 19 2.0 20 2.0 21 2.0 22 1.0 23 6.0 24 11.0 25 12.0 26 12.0 27 18.0 28 24.0 29 35.0 30 33.0 31 45.0 32 87.0 33 116.0 34 163.0 35 350.0 36 988.0 37 2089.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 13.275 36.05 8.725 41.949999999999996 2 11.225 18.6 31.15 39.025 3 19.325 17.625 26.174999999999997 36.875 4 23.525 22.05 21.4 33.025 5 26.924999999999997 26.974999999999998 22.025 24.075 6 23.849999999999998 31.2 23.05 21.9 7 18.025 23.65 38.725 19.6 8 19.950000000000003 24.224999999999998 28.299999999999997 27.525 9 20.175 21.125 33.75 24.95 10-14 22.651132556627832 25.75628781439072 26.041302065103256 25.551277563878195 15-19 22.71 24.4 26.41 26.479999999999997 20-24 22.915 25.040000000000003 26.555 25.490000000000002 25-29 23.745 24.044999999999998 26.22 25.990000000000002 30-34 23.145 24.635 26.02 26.200000000000003 35-39 23.61 25.290000000000003 25.580000000000002 25.52 40-44 23.52 24.34 26.150000000000002 25.990000000000002 45-49 23.255 24.525 26.174999999999997 26.045 50-54 22.98 24.66 26.009999999999998 26.35 55-59 23.047304730473048 24.77747774777478 25.61256125612561 26.56265626562656 60-64 23.440186065325108 24.855900495500048 25.826676104762868 25.877237334411973 65-69 23.903684421305567 23.908690428514216 25.84100921105326 26.346615939126956 70-74 23.5 25.019999999999996 25.53 25.95 75-79 23.41 24.295 26.525 25.77 80-84 23.669999999999998 24.725 25.69 25.915 85-89 23.474999999999998 23.93 26.135 26.46 90-94 23.875 24.465 25.7 25.96 95-99 23.22 24.404999999999998 25.69 26.685 100-104 23.345 24.610000000000003 25.585 26.46 105-109 23.580000000000002 23.855 26.375 26.19 110-114 23.665 24.654999999999998 25.635 26.045 115-119 23.855 24.66 25.509999999999998 25.974999999999998 120-124 23.875 24.63 25.019999999999996 26.474999999999998 125-129 23.955000000000002 24.505 25.629999999999995 25.91 130-134 24.265 24.255 25.535000000000004 25.945 135-139 24.18 24.47 25.580000000000002 25.77 140-144 24.04 24.285 24.7 26.974999999999998 145-149 23.845 24.73 25.245 26.179999999999996 150-151 23.7125 23.4875 26.275 26.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 2.0 28 3.0 29 3.5 30 5.0 31 8.0 32 12.0 33 18.5 34 23.0 35 24.0 36 41.0 37 59.5 38 59.5 39 87.5 40 124.0 41 144.5 42 164.5 43 190.0 44 216.0 45 218.0 46 211.5 47 199.0 48 183.5 49 178.0 50 175.0 51 162.0 52 155.0 53 138.0 54 105.5 55 94.0 56 99.0 57 93.5 58 86.0 59 78.5 60 78.5 61 79.5 62 67.0 63 54.0 64 52.0 65 57.0 66 52.0 67 44.0 68 33.5 69 26.0 70 24.5 71 23.0 72 18.5 73 10.0 74 5.0 75 5.5 76 4.0 77 1.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.01 60-64 1.11 65-69 0.12 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24433249370277 98.5 2 0.7556675062972292 1.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.9375 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.1 0.0 0.0 0.0 0.0 126-127 1.2875 0.0 0.0 0.0 0.0 128-129 1.475 0.0 0.0 0.0 0.0 130-131 1.75 0.0 0.0 0.0 0.0 132-133 2.0 0.0 0.0 0.0 0.0 134-135 2.2750000000000004 0.0 0.0 0.0 0.0 136-137 2.575 0.0 0.0 0.0 0.0 138-139 2.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCCCTT 10 0.006830828 145.0 1 >>END_MODULE SRR6958318 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958318_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8265 33.0 33.0 34.0 32.0 34.0 2 33.0075 33.0 33.0 34.0 32.0 34.0 3 32.9675 34.0 33.0 34.0 32.0 34.0 4 32.93475 34.0 33.0 34.0 33.0 34.0 5 32.95625 34.0 33.0 34.0 33.0 34.0 6 37.166 38.0 38.0 38.0 37.0 38.0 7 37.20425 38.0 38.0 38.0 37.0 38.0 8 37.1925 38.0 38.0 38.0 37.0 38.0 9 37.18325 38.0 38.0 38.0 37.0 38.0 10-14 37.19375 38.0 38.0 38.0 37.0 38.0 15-19 37.2192 38.0 38.0 38.0 37.0 38.0 20-24 37.150499999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.109899999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.1053 38.0 38.0 38.0 37.0 38.0 35-39 37.0746 38.0 38.0 38.0 37.0 38.0 40-44 37.017649999999996 38.0 38.0 38.0 36.4 38.0 45-49 37.0495 38.0 38.0 38.0 37.0 38.0 50-54 36.99059999999999 38.0 38.0 38.0 36.6 38.0 55-59 36.955149999999996 38.0 38.0 38.0 36.4 38.0 60-64 36.8972 38.0 38.0 38.0 36.0 38.0 65-69 36.77685 38.0 38.0 38.0 35.8 38.0 70-74 36.7214 38.0 38.0 38.0 35.2 38.0 75-79 36.80975 38.0 38.0 38.0 35.8 38.0 80-84 36.7769 38.0 38.0 38.0 35.2 38.0 85-89 36.665949999999995 38.0 38.0 38.0 35.2 38.0 90-94 36.584799999999994 38.0 38.0 38.0 35.0 38.0 95-99 36.4904 38.0 38.0 38.0 34.4 38.0 100-104 36.361399999999996 38.0 38.0 38.0 34.2 38.0 105-109 36.2012 38.0 38.0 38.0 34.0 38.0 110-114 36.13865 38.0 38.0 38.0 33.8 38.0 115-119 36.02235 38.0 38.0 38.0 33.0 38.0 120-124 35.93165 38.0 37.8 38.0 32.8 38.0 125-129 35.77915 38.0 37.6 38.0 32.4 38.0 130-134 35.6347 38.0 36.4 38.0 32.2 38.0 135-139 35.4028 38.0 36.0 38.0 31.0 38.0 140-144 35.180249999999994 38.0 36.0 38.0 30.4 38.0 145-149 34.594 38.0 35.4 38.0 28.8 38.0 150-151 30.358999999999998 35.5 29.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 1.0 4 2.0 5 1.0 6 3.0 7 0.0 8 2.0 9 0.0 10 1.0 11 2.0 12 1.0 13 2.0 14 2.0 15 0.0 16 6.0 17 4.0 18 1.0 19 3.0 20 2.0 21 6.0 22 5.0 23 13.0 24 11.0 25 9.0 26 15.0 27 11.0 28 13.0 29 31.0 30 45.0 31 50.0 32 58.0 33 86.0 34 122.0 35 206.0 36 487.0 37 2785.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.500625782227786 17.94743429286608 13.016270337922403 28.53566958698373 2 30.12772351615327 24.117205108940645 23.916854495366895 21.838216879539193 3 22.28900576008014 27.748559979964938 26.84698221888305 23.115452041071876 4 27.07237665915352 31.129476584022036 20.135236664162285 21.66291009266216 5 25.77009767092412 32.15627347858753 19.88479839719509 22.188830453293264 6 23.830957739434858 34.53363340835209 20.730182545636406 20.905226306576644 7 22.85571392848212 19.904976244061015 33.833458364591145 23.40585146286572 8 23.425 22.6 22.900000000000002 31.075000000000003 9 24.375 23.075000000000003 26.5 26.05 10-14 26.061515378844714 26.046511627906977 22.83070767691923 25.061265316329084 15-19 25.90147536884221 25.861465366341584 23.640910227556887 24.596149037259316 20-24 25.826456614153535 25.751437859464865 23.85596399099775 24.566141535383846 25-29 26.81670417604401 25.371342835708926 23.50587646911728 24.306076519129782 30-34 26.207620762076207 25.292529252925295 24.132413241324134 24.367436743674368 35-39 26.510302060412084 25.520104020804162 23.109621924384875 24.85997199439888 40-44 26.34395159273891 25.908886332949944 23.453518027704156 24.293644046606993 45-49 26.183927589138374 25.523828574286146 24.288643296494474 24.003600540081013 50-54 26.376594148537137 25.486371592898227 24.296074018504626 23.840960240060017 55-59 26.710342068413684 25.71514302860572 23.339667933586718 24.234846969393878 60-64 26.116529132283073 25.566391597899475 24.301075268817204 24.016004001000248 65-69 26.453968095214282 25.503825573836075 23.75356303445517 24.288643296494474 70-74 26.52663165791448 24.90622655663916 24.016004001000248 24.551137784446112 75-79 26.224999999999998 25.03 24.375 24.37 80-84 26.57 25.569999999999997 23.755000000000003 24.104999999999997 85-89 26.327632763276327 25.247524752475247 23.96739673967397 24.457445744574457 90-94 26.195 25.045 24.709999999999997 24.05 95-99 26.38159539884971 25.83645911477869 23.865966491622906 23.915978994748688 100-104 26.16654163540885 25.386346586646663 24.48112028007002 23.96599149787447 105-109 26.191547886971744 25.456364091022753 24.391097774443608 23.960990247561888 110-114 26.406601650412604 25.626406601650416 24.131032758189548 23.835958989747436 115-119 26.74168542135534 26.131532883220803 23.705926481620406 23.420855213803453 120-124 26.216554138534633 25.76144036009002 24.391097774443608 23.63090772693173 125-129 26.776694173543387 26.281570392598148 23.6609152288072 23.280820205051263 130-134 26.216554138534633 25.736434108527135 24.226056514128533 23.820955238809702 135-139 26.936734183545884 25.461365341335334 24.44611152788197 23.15578894723681 140-144 26.652665266526654 25.30753075307531 24.182418241824184 23.857385738573857 145-149 27.04176044011003 25.886471617904476 23.98599649912478 23.085771442860715 150-151 25.453181647705964 26.92836604575572 24.390548818602326 23.22790348793599 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 2.5 28 2.0 29 1.0 30 1.0 31 4.0 32 8.0 33 7.0 34 12.0 35 23.5 36 31.0 37 47.5 38 64.5 39 87.5 40 117.5 41 133.0 42 147.5 43 157.0 44 164.0 45 189.5 46 196.5 47 190.5 48 186.0 49 182.5 50 179.5 51 167.5 52 149.0 53 114.5 54 104.0 55 108.0 56 110.5 57 113.0 58 107.5 59 100.5 60 87.0 61 80.5 62 83.5 63 76.0 64 72.5 65 68.0 66 52.5 67 51.0 68 48.0 69 35.5 70 31.0 71 24.0 72 18.5 73 18.5 74 12.0 75 8.5 76 7.0 77 4.5 78 3.5 79 2.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.17500000000000002 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 0.025 7 0.025 8 0.0 9 0.0 10-14 0.025 15-19 0.025 20-24 0.025 25-29 0.025 30-34 0.01 35-39 0.02 40-44 0.015 45-49 0.015 50-54 0.025 55-59 0.02 60-64 0.025 65-69 0.015 70-74 0.025 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.0 95-99 0.025 100-104 0.025 105-109 0.025 110-114 0.025 115-119 0.025 120-124 0.025 125-129 0.025 130-134 0.025 135-139 0.025 140-144 0.01 145-149 0.025 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98682877406281 97.7 2 0.8611955420466059 1.7000000000000002 3 0.10131712259371835 0.3 4 0.025329280648429587 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025329280648429587 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.9625 0.0 0.0 0.0 0.0 122-123 1.025 0.0 0.0 0.0 0.0 124-125 1.1 0.0 0.0 0.0 0.0 126-127 1.2875 0.0 0.0 0.0 0.0 128-129 1.475 0.0 0.0 0.0 0.0 130-131 1.75 0.0 0.0 0.0 0.0 132-133 2.025 0.0 0.0 0.0 0.0 134-135 2.325 0.0 0.0 0.0 0.0 136-137 2.625 0.0 0.0 0.0 0.0 138-139 2.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAATC 10 0.006830828 145.0 2 GGTATCT 10 0.006830828 145.0 1 TTTTTTT 45 6.5511256E-4 32.22222 145 >>END_MODULE Read 1049935 spots for SRR6958318.sra Written 1049935 spots for SRR6958318.sra Read 1049935 spots for SRR6958318.sra Written 1049935 spots for SRR6958318.sra Read 1049935 spots for SRR6958318.sra Written 1049935 spots for SRR6958318.sra Read 1049935 spots for SRR6958318.sra Written 1049935 spots for SRR6958318.sra Read 1049935 spots for SRR6958318.sra Written 1049935 spots for SRR6958318.sra Read 1049935 spots for SRR6958318.sra Read 1049935 spots for SRR6958318.sra Written 1049935 spots for SRR6958318.sra Written 1049935 spots for SRR6958318.sra Read 1049935 spots for SRR6958318.sra Written 1049935 spots for SRR6958318.sra Read 1049935 spots for SRR6958318.sra Written 1049935 spots for SRR6958318.sra Read 1049935 spots for SRR6958318.sra Written 1049935 spots for SRR6958318.sra Read 1049935 spots for SRR6958318.sra Read 1049935 spots for SRR6958318.sra Written 1049935 spots for SRR6958318.sra Written 1049935 spots for SRR6958318.sra Read 1049935 spots for SRR6958318.sra Written 1049935 spots for SRR6958318.sra Read 1049935 spots for SRR6958318.sra Written 1049935 spots for SRR6958318.sra Read 1049935 spots for SRR6958318.sra Written 1049935 spots for SRR6958318.sra Read 1049938 spots for SRR6958318.sra Written 1049938 spots for SRR6958318.sra Read 1049935 spots for SRR6958318.sra Written 1049935 spots for SRR6958318.sra Read 1049935 spots for SRR6958318.sra Read 1049935 spots for SRR6958318.sra Written 1049935 spots for SRR6958318.sra Read 1049935 spots for SRR6958318.sra Written 1049935 spots for SRR6958318.sra Written 1049935 spots for SRR6958318.sra SRR ids: ['SRR6958318.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0yvpj3ds SRR6958318.sra spots: 20998703 blocks: [[1, 1049935], [1049936, 2099870], [2099871, 3149805], [3149806, 4199740], [4199741, 5249675], [5249676, 6299610], [6299611, 7349545], [7349546, 8399480], [8399481, 9449415], [9449416, 10499350], [10499351, 11549285], [11549286, 12599220], [12599221, 13649155], [13649156, 14699090], [14699091, 15749025], [15749026, 16798960], [16798961, 17848895], [17848896, 18898830], [18898831, 19948765], [19948766, 20998703]] SRR6958318 file size 7094071 SRR6958318 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958318 SRR6958318_1.fastq SRR6958318_2.fastq Input file: SRR6958318_1.fastq Paired file: SRR6958318_2.fastq trimmed: SRR6958318-trimmed-pair1.fastq, SRR6958318-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:44:37 2024 >> started Fri Dec 6 19:45:00 2024 >> done (22.961s) 20998703 read pairs processed; of these: 32035 ( 0.15%) short read pairs filtered out after trimming by size control 40456 ( 0.19%) empty read pairs filtered out after trimming by size control 20926212 (99.65%) read pairs available; of these: 7546715 (36.06%) trimmed read pairs available after processing 13379497 (63.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 1 0.00% 21 8 0.00% 22 6 0.00% 23 4 0.00% 24 9 0.00% 25 9 0.00% 26 4 0.00% 27 6 0.00% 28 8 0.00% 29 3 0.00% 30 5 0.00% 31 7 0.00% 32 4 0.00% 33 5 0.00% 34 4 0.00% 35 6 0.00% 36 8 0.00% 37 9 0.00% 38 11 0.00% 39 12 0.00% 40 12 0.00% 41 8 0.00% 42 7 0.00% 43 13 0.00% 44 9 0.00% 45 14 0.00% 46 21 0.00% 47 17 0.00% 48 29 0.00% 49 24 0.00% 50 33 0.00% 51 26 0.00% 52 38 0.00% 53 36 0.00% 54 39 0.00% 55 46 0.00% 56 53 0.00% 57 59 0.00% 58 65 0.00% 59 66 0.00% 60 84 0.00% 61 90 0.00% 62 94 0.00% 63 121 0.00% 64 126 0.00% 65 126 0.00% 66 148 0.00% 67 172 0.00% 68 212 0.00% 69 214 0.00% 70 262 0.00% 71 278 0.00% 72 302 0.00% 73 386 0.00% 74 420 0.00% 75 505 0.00% 76 550 0.00% 77 650 0.00% 78 732 0.00% 79 800 0.00% 80 870 0.00% 81 990 0.00% 82 1184 0.01% 83 1352 0.01% 84 2562 0.01% 85 3495 0.02% 86 3585 0.02% 87 3548 0.02% 88 3780 0.02% 89 3876 0.02% 90 4115 0.02% 91 4216 0.02% 92 4467 0.02% 93 4545 0.02% 94 5002 0.02% 95 5328 0.03% 96 5615 0.03% 97 5819 0.03% 98 6229 0.03% 99 6461 0.03% 100 6912 0.03% 101 7422 0.04% 102 8068 0.04% 103 8581 0.04% 104 9141 0.04% 105 9696 0.05% 106 10150 0.05% 107 10788 0.05% 108 11411 0.05% 109 11823 0.06% 110 12570 0.06% 111 13242 0.06% 112 14047 0.07% 113 14826 0.07% 114 15951 0.08% 115 17103 0.08% 116 17745 0.08% 117 18932 0.09% 118 19814 0.09% 119 20051 0.10% 120 21437 0.10% 121 22238 0.11% 122 23250 0.11% 123 24500 0.12% 124 26448 0.13% 125 27240 0.13% 126 28430 0.14% 127 29793 0.14% 128 30555 0.15% 129 32172 0.15% 130 33613 0.16% 131 35271 0.17% 132 37322 0.18% 133 39875 0.19% 134 41982 0.20% 135 45100 0.22% 136 47272 0.23% 137 49949 0.24% 138 53295 0.25% 139 57495 0.27% 140 61565 0.29% 141 67141 0.32% 142 74963 0.36% 143 84055 0.40% 144 97428 0.47% 145 117800 0.56% 146 148262 0.71% 147 196185 0.94% 148 303587 1.45% 149 646444 3.09% 150 4699709 22.46% 151 13379497 63.94% 20926212 reads passed initial QC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=23 prefix-density=0.83 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=49.04 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.0 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.09 fanout-score-rank=23 prefix-density=0.60 prefix-fanout=2.6 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=67.76 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.3 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958318 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:46:05 Started mapping on | Dec 06 19:46:05 Finished on | Dec 06 19:47:25 Mapping speed, Million of reads per hour | 941.68 Number of input reads | 20926212 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 20086305 Uniquely mapped reads % | 95.99% Average mapped length | 297.58 Number of splices: Total | 23804124 Number of splices: Annotated (sjdb) | 22450132 Number of splices: GT/AG | 23494567 Number of splices: GC/AG | 283762 Number of splices: AT/AC | 9253 Number of splices: Non-canonical | 16542 Mismatch rate per base, % | 0.07% Deletion rate per base | 0.00% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 194701 % of reads mapped to multiple loci | 0.93% Number of reads mapped to too many loci | 40150 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.68% % of reads unmapped: other | 1.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 664321 664321 664321 N_multimapping 194701 194701 194701 N_noFeature 581450 19553921 708964 N_ambiguous 477436 2542 73824 UnstrandedReadsAssigned:19027419 PositiveStrandReadsAssigned:529842 NegativeStrandReadsAssigned:19303517 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958318 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958318-trimmed-pair1.fastq SRR6958318-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,926,212 reads, 19,352,999 reads pseudoaligned [quant] estimated average fragment length: 273.012 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52973 SRR6958318.ke.tsv 35125 SRR6958318.se.tsv 88098 total ==> SRR6958318.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 664.481 0 0 PNS24247 1044 771.988 63.5011 6.20141 PNS24249 1928 1655.99 50.1685 2.28398 PNS24246 1044 771.988 63.5011 6.20141 PNS24248 1044 771.988 63.5011 6.20141 PNS24244 1471 1198.99 19.3282 1.21534 PNS24243 293 79.5109 0 0 KQK14069 1603 1330.99 2392.2 135.501 KQK14071 474 217.958 45.2808 15.6625 ==> SRR6958318.se.tsv <== BRADI_1g14170v3 2646 BRADI_1g53295v3 205 BRADI_1g59795v3 181 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 338 BRADI_1g74790v3 127 BRADI_1g09890v3 0 BRADI_1g77505v3 245 BRADI_1g48960v3 0 SRR6958318 completed mapping pipeline successfully