Starting /dee2/code/volunteer_pipeline.sh SRR6958319 current disk space = 1549610246144 free memory = 1339759708 SRR6958319 SRAfilesize 7e7284639c79d15cb78bfe158938331d SRR6958319.sra SRR6958319.sra file validated SRR6958319 is paired end SRR6958319 is conventional basespace SRR6958319 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958319_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.4945 30.0 18.0 33.0 18.0 33.0 2 29.077 31.0 27.0 33.0 18.0 33.0 3 30.21975 31.0 29.0 33.0 25.0 33.0 4 32.016 33.0 31.0 33.0 29.0 33.0 5 31.872 33.0 31.0 33.0 29.0 34.0 6 35.67175 37.0 35.0 38.0 31.0 38.0 7 36.45725 38.0 37.0 38.0 34.0 38.0 8 37.24675 38.0 38.0 38.0 36.0 38.0 9 37.45375 38.0 38.0 38.0 37.0 38.0 10-14 37.455349999999996 38.0 38.0 38.0 37.2 38.0 15-19 37.487199999999994 38.0 38.0 38.0 37.8 38.0 20-24 37.6009 38.0 38.0 38.0 38.0 38.0 25-29 37.525549999999996 38.0 38.0 38.0 37.8 38.0 30-34 37.386399999999995 38.0 38.0 38.0 37.2 38.0 35-39 37.50425 38.0 38.0 38.0 37.6 38.0 40-44 37.585249999999995 38.0 38.0 38.0 38.0 38.0 45-49 37.5432 38.0 38.0 38.0 37.8 38.0 50-54 37.33835 38.0 38.0 38.0 37.0 38.0 55-59 37.4058 38.0 38.0 38.0 37.4 38.0 60-64 37.5453 38.0 38.0 38.0 38.0 38.0 65-69 37.5681 38.0 38.0 38.0 38.0 38.0 70-74 37.237300000000005 38.0 38.0 38.0 36.4 38.0 75-79 37.49145 38.0 38.0 38.0 37.6 38.0 80-84 37.4875 38.0 38.0 38.0 37.4 38.0 85-89 37.2064 38.0 38.0 38.0 36.6 38.0 90-94 35.95425 38.0 36.8 38.0 31.0 38.0 95-99 36.2535 38.0 37.4 38.0 33.0 38.0 100-104 36.277550000000005 38.0 37.8 38.0 33.4 38.0 105-109 36.4379 38.0 38.0 38.0 33.8 38.0 110-114 36.188900000000004 38.0 37.6 38.0 32.8 38.0 115-119 36.78635 38.0 38.0 38.0 34.8 38.0 120-124 36.91215 38.0 38.0 38.0 35.0 38.0 125-129 36.8736 38.0 38.0 38.0 35.0 38.0 130-134 36.791999999999994 38.0 38.0 38.0 35.0 38.0 135-139 36.736000000000004 38.0 38.0 38.0 35.0 38.0 140-144 36.34975 38.0 38.0 38.0 33.8 38.0 145-149 35.780100000000004 38.0 36.6 38.0 33.0 38.0 150-151 30.123125 35.5 19.0 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 1.0 22 0.0 23 4.0 24 6.0 25 4.0 26 9.0 27 10.0 28 15.0 29 19.0 30 23.0 31 26.0 32 65.0 33 92.0 34 131.0 35 244.0 36 666.0 37 2682.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.25235151840903 11.824778285407149 7.712980381617844 39.209889814565976 2 24.75 12.85 32.1 30.3 3 20.7 19.35 23.575 36.375 4 25.474999999999998 26.075 21.7 26.75 5 25.374999999999996 29.925 23.225 21.475 6 20.775 32.675 24.25 22.3 7 16.45 23.775 40.25 19.525000000000002 8 20.325 25.775 28.025 25.874999999999996 9 18.075 23.625 34.449999999999996 23.849999999999998 10-14 21.77 27.42 26.229999999999997 24.58 15-19 22.705000000000002 26.205000000000002 26.31 24.779999999999998 20-24 21.958055958756695 26.217528404825067 26.422743881075128 25.40167175534311 25-29 21.98 26.465 26.625 24.93 30-34 21.5 26.400000000000002 26.97 25.130000000000003 35-39 22.42 26.08 26.545 24.955 40-44 22.015 26.200000000000003 26.645000000000003 25.14 45-49 22.285 26.474999999999998 25.695 25.545 50-54 22.59 25.874999999999996 26.090000000000003 25.445 55-59 21.82 26.555 26.19 25.435000000000002 60-64 22.285 26.474999999999998 26.145000000000003 25.095 65-69 22.54 26.284999999999997 26.55 24.625 70-74 22.02 25.995 26.055 25.929999999999996 75-79 22.7 26.38 25.635 25.285000000000004 80-84 22.31 25.874999999999996 26.334999999999997 25.480000000000004 85-89 22.32 26.035000000000004 26.47 25.174999999999997 90-94 22.49 26.325 25.61 25.575 95-99 22.59 25.86 26.284999999999997 25.264999999999997 100-104 21.87 25.86 27.165 25.105 105-109 23.01 24.93 26.405 25.655 110-114 22.16 25.745 26.640000000000004 25.455 115-119 22.900000000000002 25.86 25.96 25.28 120-124 23.205000000000002 26.155 25.685000000000002 24.955 125-129 22.68 25.919999999999998 25.94 25.46 130-134 22.650000000000002 25.779999999999998 25.869999999999997 25.7 135-139 22.785 26.11 25.790000000000003 25.314999999999998 140-144 23.18 25.885 25.555 25.380000000000003 145-149 22.61 25.985000000000003 25.855 25.55 150-151 22.8 25.4625 26.237500000000004 25.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 1.5 28 3.0 29 7.0 30 8.0 31 9.0 32 17.5 33 28.0 34 38.5 35 51.5 36 57.5 37 70.5 38 89.0 39 115.0 40 143.5 41 169.5 42 204.5 43 213.5 44 225.0 45 239.5 46 235.5 47 223.0 48 206.0 49 191.5 50 167.5 51 141.0 52 119.0 53 113.0 54 108.5 55 92.5 56 79.0 57 66.0 58 53.0 59 51.0 60 55.0 61 47.0 62 41.5 63 38.0 64 37.5 65 42.5 66 39.5 67 27.5 68 23.0 69 27.5 70 25.5 71 17.0 72 11.0 73 8.5 74 6.0 75 6.5 76 4.0 77 1.0 78 0.5 79 0.0 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.9750000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.105 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69879518072288 99.3 2 0.25100401606425704 0.5 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0251004016064257 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTTAATCTTGTCCATGATGCCCTTCTTCTCGCCGGTGCCGTCGGTCCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.44999999999999996 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.6499999999999999 0.0 0.0 0.0 0.0 112-113 0.7749999999999999 0.0 0.0 0.0 0.0 114-115 0.85 0.0 0.0 0.0 0.0 116-117 1.025 0.0 0.0 0.0 0.0 118-119 1.1375 0.0 0.0 0.0 0.0 120-121 1.3 0.0 0.0 0.0 0.0 122-123 1.525 0.0 0.0 0.0 0.0 124-125 1.6124999999999998 0.0 0.0 0.0 0.0 126-127 1.875 0.0 0.0 0.0 0.0 128-129 2.0625 0.0 0.0 0.0 0.0 130-131 2.1875 0.0 0.0 0.0 0.0 132-133 2.4625 0.0 0.0 0.0 0.0 134-135 2.8 0.0 0.0 0.0 0.0 136-137 2.9749999999999996 0.0 0.0 0.0 0.0 138-139 3.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958319 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958319_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1075 34.0 33.0 34.0 32.0 34.0 2 33.19425 34.0 33.0 34.0 33.0 34.0 3 33.235 34.0 33.0 34.0 33.0 34.0 4 33.26 34.0 33.0 34.0 33.0 34.0 5 33.1125 34.0 33.0 34.0 33.0 34.0 6 37.2165 38.0 38.0 38.0 37.0 38.0 7 37.21975 38.0 38.0 38.0 37.0 38.0 8 37.275 38.0 38.0 38.0 37.0 38.0 9 37.1215 38.0 38.0 38.0 37.0 38.0 10-14 37.0887 38.0 38.0 38.0 36.6 38.0 15-19 37.095949999999995 38.0 38.0 38.0 36.8 38.0 20-24 37.1324 38.0 38.0 38.0 37.0 38.0 25-29 37.14549999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.29365 38.0 38.0 38.0 37.2 38.0 35-39 37.33925000000001 38.0 38.0 38.0 38.0 38.0 40-44 37.38270000000001 38.0 38.0 38.0 37.8 38.0 45-49 37.273 38.0 38.0 38.0 37.4 38.0 50-54 37.18725 38.0 38.0 38.0 37.2 38.0 55-59 36.9133 38.0 38.0 38.0 36.0 38.0 60-64 36.4851 38.0 38.0 38.0 34.0 38.0 65-69 36.7863 38.0 38.0 38.0 35.6 38.0 70-74 36.9309 38.0 38.0 38.0 35.8 38.0 75-79 36.972 38.0 38.0 38.0 36.0 38.0 80-84 36.76285 38.0 38.0 38.0 35.4 38.0 85-89 36.532799999999995 38.0 38.0 38.0 34.6 38.0 90-94 36.57115 38.0 38.0 38.0 34.8 38.0 95-99 36.982000000000006 38.0 38.0 38.0 36.0 38.0 100-104 36.97875 38.0 38.0 38.0 36.0 38.0 105-109 36.896550000000005 38.0 38.0 38.0 35.6 38.0 110-114 36.795899999999996 38.0 38.0 38.0 35.4 38.0 115-119 36.5801 38.0 38.0 38.0 34.8 38.0 120-124 36.3268 38.0 38.0 38.0 34.0 38.0 125-129 34.51255 38.0 35.0 38.0 25.2 38.0 130-134 36.1263 38.0 38.0 38.0 34.0 38.0 135-139 36.14185 38.0 38.0 38.0 33.6 38.0 140-144 36.061899999999994 38.0 38.0 38.0 33.4 38.0 145-149 35.75295 38.0 36.8 38.0 32.8 38.0 150-151 31.997375 35.5 33.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 1.0 5 1.0 6 1.0 7 2.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 0.0 18 1.0 19 1.0 20 2.0 21 5.0 22 8.0 23 5.0 24 8.0 25 3.0 26 9.0 27 15.0 28 17.0 29 33.0 30 28.0 31 55.0 32 51.0 33 76.0 34 105.0 35 211.0 36 474.0 37 2871.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.35 18.325 11.575000000000001 32.75 2 27.725 25.5 28.425 18.35 3 21.9 26.75 28.625 22.725 4 24.7 33.650000000000006 20.45 21.2 5 26.55 32.775 20.599999999999998 20.075000000000003 6 23.825 35.9 20.025000000000002 20.25 7 21.95 19.725 37.325 21.0 8 22.875 24.125 24.9 28.1 9 23.525 23.3 26.875 26.3 10-14 25.8 26.495 24.08 23.625 15-19 25.490000000000002 26.375 24.7 23.435 20-24 25.495 26.224999999999998 25.285000000000004 22.994999999999997 25-29 25.34 25.979999999999997 24.87 23.810000000000002 30-34 25.230000000000004 26.455000000000002 24.815 23.5 35-39 25.374999999999996 26.025 25.130000000000003 23.47 40-44 25.405 26.38 24.855 23.36 45-49 25.8 25.805 25.44 22.955000000000002 50-54 25.47 26.38 24.605 23.544999999999998 55-59 25.85 25.8 25.35 23.0 60-64 25.845000000000002 26.040000000000003 25.35 22.765 65-69 25.735000000000003 25.674999999999997 25.855 22.735 70-74 26.174999999999997 26.095000000000002 25.430000000000003 22.3 75-79 25.96 25.645 25.669999999999998 22.725 80-84 25.785000000000004 26.395000000000003 25.145 22.675 85-89 25.525 26.165 25.435000000000002 22.875 90-94 25.16 26.235000000000003 25.685000000000002 22.919999999999998 95-99 24.815 26.275 26.025 22.884999999999998 100-104 25.430000000000003 26.165 26.195 22.21 105-109 25.480000000000004 25.83 26.41 22.28 110-114 26.245 26.055 25.465 22.235 115-119 25.415 25.990000000000002 26.085 22.509999999999998 120-124 25.72 26.55 25.045 22.685 125-129 25.91 26.39 25.465 22.235 130-134 25.285000000000004 26.005 25.755 22.955000000000002 135-139 26.040000000000003 26.590000000000003 25.615 21.755 140-144 26.295 26.685 25.52 21.5 145-149 26.255 26.534999999999997 25.624999999999996 21.584999999999997 150-151 26.0 26.200000000000003 25.624999999999996 22.175 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.5 28 2.5 29 2.5 30 4.0 31 11.0 32 16.5 33 19.0 34 28.5 35 47.0 36 52.5 37 62.5 38 91.0 39 112.5 40 131.0 41 147.0 42 184.0 43 218.5 44 223.0 45 224.0 46 212.5 47 198.0 48 180.0 49 180.5 50 179.5 51 143.5 52 124.5 53 120.0 54 112.0 55 98.0 56 78.5 57 71.5 58 77.0 59 69.5 60 56.0 61 51.5 62 54.0 63 58.0 64 55.5 65 45.5 66 42.0 67 40.0 68 29.0 69 27.5 70 29.0 71 23.5 72 16.5 73 12.5 74 13.0 75 10.0 76 3.5 77 1.5 78 3.0 79 2.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 0.9 0.0 0.0 0.0 0.0 116-117 1.0750000000000002 0.0 0.0 0.0 0.0 118-119 1.2 0.0 0.0 0.0 0.0 120-121 1.375 0.0 0.0 0.0 0.0 122-123 1.625 0.0 0.0 0.0 0.0 124-125 1.7374999999999998 0.0 0.0 0.0 0.0 126-127 2.0 0.0 0.0 0.0 0.0 128-129 2.1875 0.0 0.0 0.0 0.0 130-131 2.3125 0.0 0.0 0.0 0.0 132-133 2.5625 0.0 0.0 0.0 0.0 134-135 2.9000000000000004 0.0 0.0 0.0 0.0 136-137 3.075 0.0 0.0 0.0 0.0 138-139 3.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTACCAA 10 0.006830828 145.0 4 TAGATGT 10 0.006830828 145.0 9 >>END_MODULE Read 976783 spots for SRR6958319.sra Written 976783 spots for SRR6958319.sra Read 976783 spots for SRR6958319.sra Written 976783 spots for SRR6958319.sra Read 976783 spots for SRR6958319.sra Written 976783 spots for SRR6958319.sra Read 976783 spots for SRR6958319.sra Written 976783 spots for SRR6958319.sra Read 976783 spots for SRR6958319.sra Written 976783 spots for SRR6958319.sra Read 976783 spots for SRR6958319.sra Written 976783 spots for SRR6958319.sra Read 976783 spots for SRR6958319.sra Written 976783 spots for SRR6958319.sra Read 976783 spots for SRR6958319.sra Written 976783 spots for SRR6958319.sra Read 976783 spots for SRR6958319.sra Written 976783 spots for SRR6958319.sra Read 976783 spots for SRR6958319.sra Written 976783 spots for SRR6958319.sra Read 976783 spots for SRR6958319.sra Written 976783 spots for SRR6958319.sra Read 976783 spots for SRR6958319.sra Written 976783 spots for SRR6958319.sra Read 976783 spots for SRR6958319.sra Written 976783 spots for SRR6958319.sra Read 976783 spots for SRR6958319.sra Written 976783 spots for SRR6958319.sra Read 976783 spots for SRR6958319.sra Written 976783 spots for SRR6958319.sra Read 976783 spots for SRR6958319.sra Written 976783 spots for SRR6958319.sra Read 976783 spots for SRR6958319.sra Written 976783 spots for SRR6958319.sra Read 976783 spots for SRR6958319.sra Written 976783 spots for SRR6958319.sra Read 976783 spots for SRR6958319.sra Written 976783 spots for SRR6958319.sra Read 976797 spots for SRR6958319.sra Written 976797 spots for SRR6958319.sra SRR ids: ['SRR6958319.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_biemo5j7 SRR6958319.sra spots: 19535674 blocks: [[1, 976783], [976784, 1953566], [1953567, 2930349], [2930350, 3907132], [3907133, 4883915], [4883916, 5860698], [5860699, 6837481], [6837482, 7814264], [7814265, 8791047], [8791048, 9767830], [9767831, 10744613], [10744614, 11721396], [11721397, 12698179], [12698180, 13674962], [13674963, 14651745], [14651746, 15628528], [15628529, 16605311], [16605312, 17582094], [17582095, 18558877], [18558878, 19535674]] SRR6958319 file size 6598298 SRR6958319 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958319 SRR6958319_1.fastq SRR6958319_2.fastq Input file: SRR6958319_1.fastq Paired file: SRR6958319_2.fastq trimmed: SRR6958319-trimmed-pair1.fastq, SRR6958319-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:43:37 2024 >> started Fri Dec 6 19:43:58 2024 >> done (21.837s) 19535674 read pairs processed; of these: 11788 ( 0.06%) short read pairs filtered out after trimming by size control 9859 ( 0.05%) empty read pairs filtered out after trimming by size control 19514027 (99.89%) read pairs available; of these: 5522489 (28.30%) trimmed read pairs available after processing 13991538 (71.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 2 0.00% 21 3 0.00% 22 4 0.00% 23 5 0.00% 24 5 0.00% 25 2 0.00% 26 4 0.00% 27 3 0.00% 28 7 0.00% 29 4 0.00% 30 6 0.00% 31 5 0.00% 32 4 0.00% 33 9 0.00% 34 6 0.00% 35 7 0.00% 36 7 0.00% 37 8 0.00% 38 6 0.00% 39 3 0.00% 40 6 0.00% 41 9 0.00% 42 6 0.00% 43 14 0.00% 44 8 0.00% 45 9 0.00% 46 11 0.00% 47 17 0.00% 48 12 0.00% 49 18 0.00% 50 19 0.00% 51 26 0.00% 52 25 0.00% 53 27 0.00% 54 32 0.00% 55 32 0.00% 56 26 0.00% 57 40 0.00% 58 29 0.00% 59 57 0.00% 60 56 0.00% 61 58 0.00% 62 84 0.00% 63 100 0.00% 64 76 0.00% 65 118 0.00% 66 98 0.00% 67 109 0.00% 68 136 0.00% 69 142 0.00% 70 178 0.00% 71 227 0.00% 72 294 0.00% 73 289 0.00% 74 329 0.00% 75 386 0.00% 76 414 0.00% 77 425 0.00% 78 527 0.00% 79 590 0.00% 80 694 0.00% 81 828 0.00% 82 920 0.00% 83 1087 0.01% 84 1688 0.01% 85 2133 0.01% 86 2271 0.01% 87 2396 0.01% 88 2638 0.01% 89 2580 0.01% 90 2870 0.01% 91 3017 0.02% 92 3450 0.02% 93 3660 0.02% 94 4080 0.02% 95 4202 0.02% 96 4436 0.02% 97 4811 0.02% 98 4973 0.03% 99 5379 0.03% 100 5843 0.03% 101 6273 0.03% 102 6824 0.03% 103 7399 0.04% 104 7967 0.04% 105 8601 0.04% 106 9080 0.05% 107 9309 0.05% 108 9929 0.05% 109 10514 0.05% 110 10950 0.06% 111 11697 0.06% 112 12469 0.06% 113 13387 0.07% 114 14665 0.08% 115 15615 0.08% 116 16195 0.08% 117 16360 0.08% 118 17203 0.09% 119 17568 0.09% 120 18657 0.10% 121 19584 0.10% 122 21096 0.11% 123 22177 0.11% 124 23269 0.12% 125 24843 0.13% 126 25429 0.13% 127 26689 0.14% 128 27347 0.14% 129 28440 0.15% 130 29203 0.15% 131 30866 0.16% 132 32368 0.17% 133 34173 0.18% 134 36445 0.19% 135 38573 0.20% 136 40708 0.21% 137 42538 0.22% 138 44741 0.23% 139 46662 0.24% 140 49540 0.25% 141 53225 0.27% 142 57852 0.30% 143 64316 0.33% 144 72798 0.37% 145 85248 0.44% 146 101683 0.52% 147 130082 0.67% 148 192566 0.99% 149 385847 1.98% 150 3424399 17.55% 151 13991538 71.70% 19514027 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=5.26 fanout-score-rank=19 prefix-density=0.48 prefix-fanout=3.7 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=24 fanout-score=187.89 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=22.4 sequence=TTCTTCTTGTCCAGCCCAGTCATGCACATCTCCAGTGTGACCATAGGTTTCTCAGGTTGCTCAGTGGCATAATAGATGTGCCACTTCTGGCCTGGCTTGGCTGGATCTCCAATCACATAAGCATTGCCACCAGATTTCAGGCCACCAAAGTAGCGGTTAAGGACATCAACCTCCTCAGAGAAGCTCCTGTGGGGAGCTGGCTGTGCGCCAGGGAAGATGAACATCCCTCGAGAGTACTTCACAGCAGCAAGCGGCATGCACAGCTCTTCAGCAAGCTCAAGAATCCTTGGAATGGTGAGCAGGAGCATGGTAGTCCCACAGGTCTTGATCACAATCTTCTGAGAGTAGATAAACAGGCTCGACTCAGATAGAACATAGGAGTCAAAGTCCTTGTTGGAGAGCTCGGACACAATGGTGCACCGTGCAAGATCCAGAACAGAGTCAATCTGGGCCCTGGAGAGAGCGCGCAAGCCACGACCATGCGGGTCAGCAAAGACAGAAGCCTCGGAGA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=7.36 fanout-score-rank=11 prefix-density=0.37 prefix-fanout=4.4 sequence=TGCAAGTGCGGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=16 fanout-score=64.08 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=11.8 sequence=CCGCCGCCGCCG SRR6958319 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:45:05 Started mapping on | Dec 06 19:45:05 Finished on | Dec 06 19:47:18 Mapping speed, Million of reads per hour | 528.20 Number of input reads | 19514027 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 18776732 Uniquely mapped reads % | 96.22% Average mapped length | 297.80 Number of splices: Total | 22265004 Number of splices: Annotated (sjdb) | 21055920 Number of splices: GT/AG | 21970320 Number of splices: GC/AG | 243237 Number of splices: AT/AC | 8616 Number of splices: Non-canonical | 42831 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 215973 % of reads mapped to multiple loci | 1.11% Number of reads mapped to too many loci | 13452 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.14% % of reads unmapped: other | 0.46% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 529661 529661 529661 N_multimapping 215973 215973 215973 N_noFeature 753141 18306810 881396 N_ambiguous 400774 2543 59943 UnstrandedReadsAssigned:17622817 PositiveStrandReadsAssigned:467379 NegativeStrandReadsAssigned:17835393 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6958319 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958319-trimmed-pair1.fastq SRR6958319-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,514,027 reads, 17,773,643 reads pseudoaligned [quant] estimated average fragment length: 272.595 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52973 SRR6958319.ke.tsv 35125 SRR6958319.se.tsv 88098 total ==> SRR6958319.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 664.92 102.78 13.2305 PNS24247 1044 772.405 39.6201 4.39041 PNS24249 1928 1656.4 72.8358 3.76368 PNS24246 1044 772.405 39.6201 4.39041 PNS24248 1044 772.405 39.6201 4.39041 PNS24244 1471 1199.4 62.5236 4.46182 PNS24243 293 81.4946 0 0 KQK14069 1603 1331.4 1524.63 98.0141 KQK14071 474 220.321 15.3138 5.94925 ==> SRR6958319.se.tsv <== BRADI_1g14170v3 1663 BRADI_1g53295v3 1390 BRADI_1g59795v3 91 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 1066 BRADI_1g74790v3 427 BRADI_1g09890v3 0 BRADI_1g77505v3 255 BRADI_1g48960v3 0 SRR6958319 completed mapping pipeline successfully