Starting /dee2/code/volunteer_pipeline.sh SRR6958320 current disk space = 1549612654592 free memory = 1599336216 SRR6958320 SRAfilesize 0f119de88a539df8ff08676cfab658e9 SRR6958320.sra SRR6958320.sra file validated SRR6958320 is paired end SRR6958320 is conventional basespace SRR6958320 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958320_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.11675 18.0 18.0 25.0 18.0 32.0 2 24.6735 27.0 18.0 29.0 18.0 31.0 3 28.9395 29.0 27.0 31.0 25.0 33.0 4 30.3805 31.0 29.0 33.0 27.0 33.0 5 31.07925 33.0 31.0 33.0 29.0 33.0 6 34.69825 37.0 34.0 38.0 29.0 38.0 7 36.70775 38.0 37.0 38.0 34.0 38.0 8 36.89325 38.0 38.0 38.0 35.0 38.0 9 37.12975 38.0 38.0 38.0 36.0 38.0 10-14 37.2212 38.0 38.0 38.0 36.2 38.0 15-19 37.2635 38.0 38.0 38.0 36.4 38.0 20-24 37.3741 38.0 38.0 38.0 37.0 38.0 25-29 37.30765 38.0 38.0 38.0 36.8 38.0 30-34 37.12245 38.0 38.0 38.0 36.2 38.0 35-39 37.133449999999996 38.0 38.0 38.0 36.0 38.0 40-44 36.96355 38.0 38.0 38.0 35.8 38.0 45-49 37.197050000000004 38.0 38.0 38.0 36.2 38.0 50-54 37.1326 38.0 38.0 38.0 35.8 38.0 55-59 36.689049999999995 38.0 38.0 38.0 34.4 38.0 60-64 36.22335 38.0 37.2 38.0 33.0 38.0 65-69 35.9597 38.0 37.0 38.0 31.0 38.0 70-74 35.968650000000004 38.0 36.6 38.0 31.4 38.0 75-79 36.330799999999996 38.0 37.0 38.0 33.6 38.0 80-84 36.37715 38.0 37.4 38.0 33.4 38.0 85-89 35.9442 38.0 36.8 38.0 31.8 38.0 90-94 36.14855 38.0 37.0 38.0 33.0 38.0 95-99 35.93305 38.0 36.6 38.0 32.2 38.0 100-104 35.50615 38.0 36.0 38.0 29.8 38.0 105-109 35.07855 38.0 35.4 38.0 28.0 38.0 110-114 34.438300000000005 38.0 34.4 38.0 25.2 38.0 115-119 33.7112 37.8 33.8 38.0 20.6 38.0 120-124 33.68320000000001 37.6 33.4 38.0 21.0 38.0 125-129 34.249700000000004 38.0 34.0 38.0 24.2 38.0 130-134 34.1885 38.0 34.0 38.0 23.2 38.0 135-139 34.16095 38.0 34.2 38.0 24.2 38.0 140-144 33.21085000000001 37.8 33.4 38.0 19.0 38.0 145-149 31.697300000000002 36.4 31.8 38.0 11.4 38.0 150-151 26.880375 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 3.0 18 1.0 19 0.0 20 1.0 21 7.0 22 7.0 23 7.0 24 8.0 25 11.0 26 23.0 27 28.0 28 58.0 29 60.0 30 73.0 31 115.0 32 160.0 33 229.0 34 323.0 35 651.0 36 1216.0 37 1018.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.25 17.13362068965517 7.543103448275862 44.07327586206897 2 20.724999999999998 13.700000000000001 30.925000000000004 34.65 3 21.825 17.299999999999997 25.45 35.425000000000004 4 25.8 24.474999999999998 23.225 26.5 5 24.83741870935468 28.264132066033014 23.21160580290145 23.686843421710854 6 21.15 33.4 24.025 21.425 7 16.575 24.075 40.0 19.35 8 20.599999999999998 23.724999999999998 29.2 26.474999999999998 9 20.1 22.175 33.15 24.575 10-14 21.825 27.04 26.235000000000003 24.9 15-19 22.705000000000002 25.564999999999998 26.87 24.86 20-24 22.54 26.474999999999998 25.924999999999997 25.06 25-29 22.8 25.845000000000002 26.495 24.86 30-34 22.99 25.485000000000003 26.169999999999998 25.355 35-39 22.43 26.295 26.369999999999997 24.905 40-44 21.905 26.025 26.224999999999998 25.845000000000002 45-49 22.615 26.07 26.005 25.31 50-54 23.044999999999998 26.11 25.83 25.014999999999997 55-59 22.35 25.695 26.625 25.330000000000002 60-64 22.415 26.450000000000003 25.83 25.305 65-69 22.25 25.395 26.435 25.919999999999998 70-74 22.535 26.705000000000002 25.619999999999997 25.14 75-79 22.689999999999998 25.695 26.1 25.515 80-84 22.45 25.97 26.295 25.285000000000004 85-89 22.25 26.119999999999997 26.534999999999997 25.095 90-94 23.294999999999998 25.495 26.02 25.19 95-99 22.28 25.77 26.229999999999997 25.72 100-104 22.275 26.025 26.490000000000002 25.21 105-109 22.814999999999998 25.515 26.545 25.124999999999996 110-114 22.7 25.6 26.52 25.180000000000003 115-119 22.634999999999998 25.2 26.69 25.474999999999998 120-124 22.97 25.655 25.91 25.465 125-129 23.03 25.564999999999998 26.36 25.045 130-134 23.205000000000002 24.955 26.240000000000002 25.6 135-139 23.27 26.240000000000002 25.25 25.240000000000002 140-144 23.169999999999998 25.6 25.61 25.619999999999997 145-149 22.865 25.585 26.314999999999998 25.235000000000003 150-151 22.912499999999998 25.650000000000002 26.5375 24.9 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 0.5 26 0.0 27 1.0 28 2.0 29 3.5 30 7.0 31 10.5 32 15.0 33 18.5 34 24.5 35 37.5 36 54.0 37 73.0 38 85.0 39 106.0 40 138.5 41 163.5 42 186.0 43 212.0 44 220.5 45 227.0 46 237.5 47 218.5 48 196.0 49 199.0 50 196.0 51 164.0 52 141.0 53 123.5 54 108.0 55 99.0 56 93.5 57 83.0 58 60.5 59 51.5 60 52.0 61 49.5 62 45.5 63 43.5 64 38.5 65 38.5 66 37.5 67 29.5 68 24.5 69 18.5 70 13.5 71 12.0 72 11.5 73 10.5 74 8.0 75 3.5 76 1.0 77 2.0 78 2.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.199999999999999 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32041278630757 98.65 2 0.6795872136924239 1.35 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 1.0 0.0 0.0 0.0 0.0 118-119 1.1375000000000002 0.0 0.0 0.0 0.0 120-121 1.35 0.0 0.0 0.0 0.0 122-123 1.575 0.0 0.0 0.0 0.0 124-125 1.8250000000000002 0.0 0.0 0.0 0.0 126-127 2.0625 0.0 0.0 0.0 0.0 128-129 2.2249999999999996 0.0 0.0 0.0 0.0 130-131 2.4375 0.0 0.0 0.0 0.0 132-133 2.675 0.0 0.0 0.0 0.0 134-135 2.95 0.0 0.0 0.0 0.0 136-137 3.2125000000000004 0.0 0.0 0.0 0.0 138-139 3.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958320 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958320_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.895 33.0 33.0 34.0 32.0 34.0 2 32.91825 33.0 33.0 34.0 32.0 34.0 3 32.89525 34.0 33.0 34.0 32.0 34.0 4 32.86575 34.0 33.0 34.0 32.0 34.0 5 32.8985 34.0 33.0 34.0 32.0 34.0 6 36.91575 38.0 38.0 38.0 36.0 38.0 7 36.69825 38.0 38.0 38.0 35.0 38.0 8 36.77 38.0 38.0 38.0 35.0 38.0 9 36.85425 38.0 38.0 38.0 35.0 38.0 10-14 36.794549999999994 38.0 38.0 38.0 35.4 38.0 15-19 36.8987 38.0 38.0 38.0 35.8 38.0 20-24 36.963150000000006 38.0 38.0 38.0 36.0 38.0 25-29 36.9475 38.0 38.0 38.0 36.0 38.0 30-34 36.6951 38.0 38.0 38.0 35.2 38.0 35-39 36.67105 38.0 38.0 38.0 34.8 38.0 40-44 36.6391 38.0 38.0 38.0 34.6 38.0 45-49 36.70215 38.0 38.0 38.0 34.8 38.0 50-54 36.551249999999996 38.0 38.0 38.0 34.2 38.0 55-59 36.64755 38.0 38.0 38.0 34.8 38.0 60-64 36.498400000000004 38.0 38.0 38.0 33.8 38.0 65-69 36.5125 38.0 38.0 38.0 34.2 38.0 70-74 36.45225 38.0 38.0 38.0 34.0 38.0 75-79 36.25855 38.0 38.0 38.0 33.4 38.0 80-84 36.0869 38.0 37.4 38.0 33.2 38.0 85-89 36.03075 38.0 37.2 38.0 33.2 38.0 90-94 36.1335 38.0 37.6 38.0 33.2 38.0 95-99 36.04185 38.0 37.0 38.0 33.0 38.0 100-104 35.511 38.0 36.4 38.0 30.0 38.0 105-109 34.9743 38.0 36.0 38.0 27.0 38.0 110-114 34.55015 38.0 35.0 38.0 25.0 38.0 115-119 34.40965 38.0 34.8 38.0 24.4 38.0 120-124 34.1502 38.0 34.2 38.0 23.2 38.0 125-129 33.391549999999995 38.0 33.6 38.0 18.2 38.0 130-134 32.41415 36.8 32.2 38.0 14.6 38.0 135-139 31.28185 35.8 29.6 38.0 13.8 38.0 140-144 31.116200000000003 35.6 29.8 38.0 13.6 38.0 145-149 30.74035 36.0 30.8 38.0 8.8 38.0 150-151 25.90825 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 2.0 4 2.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 2.0 12 3.0 13 0.0 14 2.0 15 4.0 16 4.0 17 5.0 18 5.0 19 8.0 20 12.0 21 7.0 22 10.0 23 14.0 24 23.0 25 23.0 26 28.0 27 40.0 28 41.0 29 60.0 30 85.0 31 112.0 32 121.0 33 168.0 34 279.0 35 478.0 36 982.0 37 1470.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.025 17.849999999999998 11.700000000000001 32.425 2 29.425 24.6 27.950000000000003 18.025 3 22.975 26.950000000000003 27.275 22.8 4 26.55 31.674999999999997 20.599999999999998 21.175 5 26.825 32.75 21.2 19.225 6 22.625 35.575 21.075 20.724999999999998 7 22.125 19.775000000000002 36.0 22.1 8 24.575 23.65 24.975 26.8 9 22.975 23.325000000000003 28.599999999999998 25.1 10-14 25.395 26.82 23.810000000000002 23.974999999999998 15-19 25.115 26.150000000000002 25.040000000000003 23.695 20-24 24.905 26.77 25.005 23.32 25-29 25.31 25.979999999999997 24.84 23.87 30-34 25.105 26.07 25.585 23.24 35-39 25.419999999999998 27.034999999999997 24.545 23.0 40-44 25.465 26.105 25.124999999999996 23.305 45-49 25.580000000000002 26.029999999999998 24.79 23.599999999999998 50-54 25.074999999999996 26.52 24.79 23.615 55-59 26.075 25.905 24.645 23.375 60-64 25.814999999999998 25.695 25.775 22.715 65-69 25.679999999999996 25.95 25.025 23.345 70-74 25.655 26.215 25.28 22.85 75-79 25.39 26.045 24.905 23.66 80-84 25.39 26.3 25.069999999999997 23.24 85-89 25.71 25.679999999999996 25.39 23.22 90-94 25.305 26.71 25.005 22.98 95-99 25.405 25.97 25.669999999999998 22.955000000000002 100-104 25.674999999999997 26.13 25.35 22.845 105-109 25.25 26.07 25.6 23.080000000000002 110-114 25.275 26.76 25.39 22.575 115-119 25.72 26.1 25.174999999999997 23.005 120-124 25.52 26.529999999999998 25.535000000000004 22.415 125-129 25.679999999999996 25.785000000000004 25.5 23.035 130-134 26.655 26.39 24.915000000000003 22.040000000000003 135-139 26.245 25.869999999999997 25.415 22.470000000000002 140-144 26.085 25.965 25.535000000000004 22.415 145-149 26.33 26.47 25.295 21.905 150-151 25.974999999999998 26.787499999999998 25.2 22.037499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.5 26 2.0 27 2.0 28 4.5 29 6.5 30 6.5 31 5.0 32 8.0 33 16.0 34 18.5 35 30.0 36 48.5 37 58.5 38 72.5 39 96.5 40 125.5 41 157.0 42 176.0 43 190.0 44 206.5 45 229.0 46 244.0 47 225.0 48 202.5 49 186.0 50 164.5 51 159.5 52 141.0 53 118.5 54 106.5 55 97.5 56 100.0 57 98.5 58 87.0 59 69.0 60 56.0 61 53.5 62 61.0 63 59.5 64 52.0 65 42.0 66 35.0 67 33.5 68 32.0 69 29.5 70 24.0 71 14.5 72 10.5 73 12.0 74 5.5 75 3.5 76 5.0 77 2.5 78 3.0 79 2.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08998988877654 98.0 2 0.8341759352881698 1.6500000000000001 3 0.02527805864509606 0.075 4 0.02527805864509606 0.1 5 0.0 0.0 6 0.0 0.0 7 0.02527805864509606 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.5875 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 1.0 0.0 0.0 0.0 0.0 118-119 1.1375000000000002 0.0 0.0 0.0 0.0 120-121 1.35 0.0 0.0 0.0 0.0 122-123 1.575 0.0 0.0 0.0 0.0 124-125 1.8250000000000002 0.0 0.0 0.0 0.0 126-127 2.0625 0.0 0.0 0.0 0.0 128-129 2.2249999999999996 0.0 0.0 0.0 0.0 130-131 2.45 0.0 0.0 0.0 0.0 132-133 2.7 0.0 0.0 0.0 0.0 134-135 2.9625 0.0 0.0 0.0 0.0 136-137 3.2 0.0 0.0 0.0 0.0 138-139 3.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 842659 spots for SRR6958320.sra Written 842659 spots for SRR6958320.sra Read 842659 spots for SRR6958320.sra Written 842659 spots for SRR6958320.sra Read 842659 spots for SRR6958320.sra Written 842659 spots for SRR6958320.sra Read 842659 spots for SRR6958320.sra Written 842659 spots for SRR6958320.sra Read 842659 spots for SRR6958320.sra Written 842659 spots for SRR6958320.sra Read 842659 spots for SRR6958320.sra Written 842659 spots for SRR6958320.sra Read 842659 spots for SRR6958320.sra Written 842659 spots for SRR6958320.sra Read 842659 spots for SRR6958320.sra Written 842659 spots for SRR6958320.sra Read 842659 spots for SRR6958320.sra Written 842659 spots for SRR6958320.sra Read 842659 spots for SRR6958320.sra Written 842659 spots for SRR6958320.sra Read 842659 spots for SRR6958320.sra Written 842659 spots for SRR6958320.sra Read 842663 spots for SRR6958320.sra Written 842663 spots for SRR6958320.sra Read 842659 spots for SRR6958320.sra Written 842659 spots for SRR6958320.sra Read 842659 spots for SRR6958320.sra Written 842659 spots for SRR6958320.sra Read 842659 spots for SRR6958320.sra Written 842659 spots for SRR6958320.sra Read 842659 spots for SRR6958320.sra Written 842659 spots for SRR6958320.sra Read 842659 spots for SRR6958320.sra Written 842659 spots for SRR6958320.sra Read 842659 spots for SRR6958320.sra Written 842659 spots for SRR6958320.sra Read 842659 spots for SRR6958320.sra Written 842659 spots for SRR6958320.sra Read 842659 spots for SRR6958320.sra Written 842659 spots for SRR6958320.sra SRR ids: ['SRR6958320.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ibg4jm32 SRR6958320.sra spots: 16853184 blocks: [[1, 842659], [842660, 1685318], [1685319, 2527977], [2527978, 3370636], [3370637, 4213295], [4213296, 5055954], [5055955, 5898613], [5898614, 6741272], [6741273, 7583931], [7583932, 8426590], [8426591, 9269249], [9269250, 10111908], [10111909, 10954567], [10954568, 11797226], [11797227, 12639885], [12639886, 13482544], [13482545, 14325203], [14325204, 15167862], [15167863, 16010521], [16010522, 16853184]] SRR6958320 file size 5689290 SRR6958320 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958320 SRR6958320_1.fastq SRR6958320_2.fastq Input file: SRR6958320_1.fastq Paired file: SRR6958320_2.fastq trimmed: SRR6958320-trimmed-pair1.fastq, SRR6958320-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:43:48 2024 >> started Fri Dec 6 19:44:11 2024 >> done (23.162s) 16853184 read pairs processed; of these: 11118 ( 0.07%) short read pairs filtered out after trimming by size control 7463 ( 0.04%) empty read pairs filtered out after trimming by size control 16834603 (99.89%) read pairs available; of these: 6935157 (41.20%) trimmed read pairs available after processing 9899446 (58.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 4 0.00% 21 3 0.00% 22 4 0.00% 23 1 0.00% 24 4 0.00% 25 2 0.00% 26 9 0.00% 27 4 0.00% 28 2 0.00% 29 4 0.00% 30 1 0.00% 31 6 0.00% 32 5 0.00% 33 9 0.00% 34 10 0.00% 35 6 0.00% 36 3 0.00% 37 8 0.00% 38 6 0.00% 39 11 0.00% 40 12 0.00% 41 11 0.00% 42 8 0.00% 43 7 0.00% 44 20 0.00% 45 20 0.00% 46 12 0.00% 47 21 0.00% 48 22 0.00% 49 22 0.00% 50 26 0.00% 51 20 0.00% 52 26 0.00% 53 42 0.00% 54 34 0.00% 55 31 0.00% 56 33 0.00% 57 53 0.00% 58 50 0.00% 59 71 0.00% 60 85 0.00% 61 86 0.00% 62 88 0.00% 63 110 0.00% 64 116 0.00% 65 119 0.00% 66 124 0.00% 67 157 0.00% 68 170 0.00% 69 191 0.00% 70 229 0.00% 71 255 0.00% 72 341 0.00% 73 298 0.00% 74 388 0.00% 75 419 0.00% 76 448 0.00% 77 516 0.00% 78 569 0.00% 79 656 0.00% 80 744 0.00% 81 860 0.01% 82 956 0.01% 83 1172 0.01% 84 1762 0.01% 85 2197 0.01% 86 2271 0.01% 87 2324 0.01% 88 2429 0.01% 89 2636 0.02% 90 2716 0.02% 91 2971 0.02% 92 3292 0.02% 93 3452 0.02% 94 3824 0.02% 95 4154 0.02% 96 4284 0.03% 97 4691 0.03% 98 5087 0.03% 99 5211 0.03% 100 5767 0.03% 101 6120 0.04% 102 6709 0.04% 103 7547 0.04% 104 7796 0.05% 105 8497 0.05% 106 8955 0.05% 107 9445 0.06% 108 10074 0.06% 109 10730 0.06% 110 11144 0.07% 111 11924 0.07% 112 12901 0.08% 113 13635 0.08% 114 14584 0.09% 115 15809 0.09% 116 16574 0.10% 117 17388 0.10% 118 18019 0.11% 119 19189 0.11% 120 20093 0.12% 121 21159 0.13% 122 22161 0.13% 123 23807 0.14% 124 25654 0.15% 125 26708 0.16% 126 28540 0.17% 127 30214 0.18% 128 31410 0.19% 129 33528 0.20% 130 35324 0.21% 131 37568 0.22% 132 40339 0.24% 133 43603 0.26% 134 47209 0.28% 135 50596 0.30% 136 55092 0.33% 137 60285 0.36% 138 65099 0.39% 139 72387 0.43% 140 79387 0.47% 141 86848 0.52% 142 96853 0.58% 143 105947 0.63% 144 114061 0.68% 145 130948 0.78% 146 154664 0.92% 147 214307 1.27% 148 349702 2.08% 149 747164 4.44% 150 3788647 22.51% 151 9899446 58.80% 16834603 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=22 prefix-density=0.83 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=37.37 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.9 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCAATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.74 fanout-score-rank=14 prefix-density=0.56 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=57.98 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.9 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958320 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:45:11 Started mapping on | Dec 06 19:45:11 Finished on | Dec 06 19:46:32 Mapping speed, Million of reads per hour | 748.20 Number of input reads | 16834603 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16402564 Uniquely mapped reads % | 97.43% Average mapped length | 296.74 Number of splices: Total | 19380028 Number of splices: Annotated (sjdb) | 18267569 Number of splices: GT/AG | 19122878 Number of splices: GC/AG | 226751 Number of splices: AT/AC | 6852 Number of splices: Non-canonical | 23547 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.42 Insertion rate per base | 0.01% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 153610 % of reads mapped to multiple loci | 0.91% Number of reads mapped to too many loci | 16731 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.97% % of reads unmapped: other | 0.58% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 285858 285858 285858 N_multimapping 153610 153610 153610 N_noFeature 582594 15950683 711028 N_ambiguous 390056 2342 67700 UnstrandedReadsAssigned:15429914 PositiveStrandReadsAssigned:449539 NegativeStrandReadsAssigned:15623836 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958320 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958320-trimmed-pair1.fastq SRR6958320-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,834,603 reads, 15,637,727 reads pseudoaligned [quant] estimated average fragment length: 269.647 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52973 SRR6958320.ke.tsv 35125 SRR6958320.se.tsv 88098 total ==> SRR6958320.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 667.809 0 0 PNS24247 1044 775.353 44.1821 5.51195 PNS24249 1928 1659.35 32.3072 1.8833 PNS24246 1044 775.353 44.1821 5.51195 PNS24248 1044 775.353 44.1821 5.51195 PNS24244 1471 1202.35 23.1464 1.86213 PNS24243 293 81.5122 0 0 KQK14069 1603 1334.35 3572.6 258.984 KQK14071 474 220.489 91.2265 40.0213 ==> SRR6958320.se.tsv <== BRADI_1g14170v3 4170 BRADI_1g53295v3 228 BRADI_1g59795v3 193 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 166 BRADI_1g74790v3 58 BRADI_1g09890v3 0 BRADI_1g77505v3 189 BRADI_1g48960v3 0 SRR6958320 completed mapping pipeline successfully