Starting /dee2/code/volunteer_pipeline.sh SRR6958321 current disk space = 1549649645568 free memory = 1599660200 SRR6958321 SRAfilesize 87c0d2c6d2bfdbc6417d70a72991d164 SRR6958321.sra SRR6958321.sra file validated SRR6958321 is paired end SRR6958321 is conventional basespace SRR6958321 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958321_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.497 32.0 18.0 33.0 18.0 33.0 2 30.4415 31.0 29.0 33.0 27.0 34.0 3 30.80325 33.0 29.0 33.0 27.0 33.0 4 31.57725 33.0 31.0 33.0 29.0 34.0 5 32.1015 33.0 33.0 33.0 30.0 34.0 6 36.2455 38.0 36.0 38.0 33.0 38.0 7 36.716 38.0 37.0 38.0 35.0 38.0 8 36.5895 38.0 37.0 38.0 34.0 38.0 9 36.78875 38.0 38.0 38.0 35.0 38.0 10-14 37.08995 38.0 38.0 38.0 36.0 38.0 15-19 37.082 38.0 38.0 38.0 35.8 38.0 20-24 37.32430000000001 38.0 38.0 38.0 36.6 38.0 25-29 37.233050000000006 38.0 38.0 38.0 36.4 38.0 30-34 37.020300000000006 38.0 38.0 38.0 35.4 38.0 35-39 37.045100000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.85355 38.0 38.0 38.0 34.8 38.0 45-49 37.0942 38.0 38.0 38.0 36.0 38.0 50-54 37.01835 38.0 38.0 38.0 35.6 38.0 55-59 36.56075 38.0 37.8 38.0 34.2 38.0 60-64 36.0528 38.0 37.0 38.0 32.0 38.0 65-69 35.790949999999995 38.0 36.6 38.0 31.0 38.0 70-74 35.7346 38.0 36.4 38.0 30.0 38.0 75-79 36.18814999999999 38.0 37.0 38.0 32.8 38.0 80-84 36.20315 38.0 37.0 38.0 33.0 38.0 85-89 35.691449999999996 38.0 36.4 38.0 30.6 38.0 90-94 35.968399999999995 38.0 37.0 38.0 32.4 38.0 95-99 35.74905 38.0 36.6 38.0 30.8 38.0 100-104 35.2445 38.0 35.4 38.0 28.8 38.0 105-109 34.83855 38.0 35.0 38.0 27.6 38.0 110-114 34.03655 38.0 34.0 38.0 23.0 38.0 115-119 33.3174 37.2 33.2 38.0 16.2 38.0 120-124 33.23415000000001 37.2 32.8 38.0 16.6 38.0 125-129 33.7829 37.8 33.8 38.0 21.0 38.0 130-134 34.00279999999999 38.0 34.0 38.0 23.0 38.0 135-139 33.76555 38.0 34.0 38.0 22.6 38.0 140-144 32.866749999999996 37.2 33.2 38.0 15.8 38.0 145-149 31.059299999999997 36.0 30.6 38.0 11.2 38.0 150-151 26.275125000000003 34.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 1.0 17 3.0 18 2.0 19 2.0 20 4.0 21 5.0 22 4.0 23 12.0 24 9.0 25 12.0 26 35.0 27 38.0 28 45.0 29 72.0 30 104.0 31 104.0 32 152.0 33 254.0 34 346.0 35 587.0 36 1062.0 37 1143.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.056458275957034 8.675296061690995 6.6648306251721285 39.60341503717984 2 24.9 12.2 35.975 26.924999999999997 3 22.575 18.425 22.225 36.775000000000006 4 26.974999999999998 24.45 20.974999999999998 27.6 5 26.771850738792885 28.825444527923867 22.739794640621085 21.66291009266216 6 21.875 31.075000000000003 24.45 22.6 7 17.849999999999998 23.625 38.525 20.0 8 21.85 22.925 30.15 25.074999999999996 9 20.225 21.075 33.050000000000004 25.650000000000002 10-14 23.305 26.495 26.369999999999997 23.830000000000002 15-19 23.32 25.41 25.86 25.41 20-24 22.75 25.185000000000002 26.85 25.215 25-29 23.315 25.240000000000002 26.224999999999998 25.22 30-34 22.830000000000002 25.380000000000003 26.495 25.295 35-39 22.705000000000002 25.319999999999997 26.340000000000003 25.635 40-44 23.16 25.485000000000003 25.855 25.5 45-49 23.1 25.290000000000003 26.224999999999998 25.385 50-54 23.535 25.485000000000003 25.935000000000002 25.045 55-59 23.595 25.19 25.8 25.415 60-64 23.75 25.124999999999996 25.895000000000003 25.230000000000004 65-69 23.29 25.069999999999997 26.619999999999997 25.019999999999996 70-74 23.74 25.755 25.5 25.005 75-79 22.884999999999998 25.635 25.885 25.595000000000002 80-84 23.51 25.0 25.7 25.790000000000003 85-89 23.575 25.014999999999997 25.595000000000002 25.814999999999998 90-94 23.200000000000003 25.555 26.135 25.11 95-99 23.02 25.22 26.055 25.705 100-104 23.34 25.105 26.155 25.4 105-109 23.61 25.005 25.72 25.665 110-114 23.77 25.155 25.724999999999998 25.35 115-119 23.335 25.924999999999997 25.264999999999997 25.474999999999998 120-124 23.630000000000003 25.145 25.759999999999998 25.465 125-129 23.3 24.73 26.245 25.724999999999998 130-134 23.3 25.235000000000003 25.624999999999996 25.840000000000003 135-139 23.31 25.679999999999996 25.509999999999998 25.5 140-144 23.595 25.295 25.585 25.525 145-149 24.085 25.09 25.385 25.44 150-151 24.6 24.3875 25.75 25.2625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 3.0 28 3.0 29 5.5 30 8.5 31 5.5 32 6.0 33 13.5 34 21.5 35 36.0 36 51.5 37 64.0 38 76.0 39 98.0 40 117.0 41 142.5 42 190.0 43 207.5 44 217.5 45 220.5 46 215.5 47 212.0 48 201.0 49 193.5 50 165.0 51 139.5 52 138.0 53 135.5 54 114.5 55 94.0 56 86.0 57 92.5 58 87.5 59 85.5 60 84.5 61 64.0 62 48.5 63 48.0 64 48.5 65 45.0 66 41.5 67 35.5 68 30.0 69 22.0 70 20.5 71 17.0 72 10.0 73 11.0 74 10.5 75 5.0 76 4.0 77 2.5 78 1.0 79 1.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.225 2 0.0 3 0.0 4 0.0 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14206409285894 98.225 2 0.8074690890739339 1.6 3 0.025233409033560434 0.075 4 0.025233409033560434 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.2125 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.42500000000000004 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.8500000000000001 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.2125 0.0 0.0 0.0 0.0 122-123 1.4 0.0 0.0 0.0 0.0 124-125 1.6875 0.0 0.0 0.0 0.0 126-127 1.8625 0.0 0.0 0.0 0.0 128-129 1.9625 0.0 0.0 0.0 0.0 130-131 2.1500000000000004 0.0 0.0 0.0 0.0 132-133 2.45 0.0 0.0 0.0 0.0 134-135 2.7 0.0 0.0 0.0 0.0 136-137 2.925 0.0 0.0 0.0 0.0 138-139 3.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTACTCT 10 0.0068449317 144.90001 6 >>END_MODULE SRR6958321 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958321_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.81025 33.0 33.0 34.0 32.0 34.0 2 32.825 33.0 33.0 34.0 32.0 34.0 3 32.809 33.0 33.0 34.0 32.0 34.0 4 32.72925 33.0 33.0 34.0 32.0 34.0 5 32.79525 33.0 33.0 34.0 32.0 34.0 6 36.85425 38.0 38.0 38.0 35.0 38.0 7 36.57825 38.0 38.0 38.0 34.0 38.0 8 36.7115 38.0 38.0 38.0 35.0 38.0 9 36.68 38.0 38.0 38.0 35.0 38.0 10-14 36.7498 38.0 38.0 38.0 35.0 38.0 15-19 36.88655 38.0 38.0 38.0 35.6 38.0 20-24 36.89694999999999 38.0 38.0 38.0 35.6 38.0 25-29 36.815799999999996 38.0 38.0 38.0 35.2 38.0 30-34 36.63250000000001 38.0 38.0 38.0 34.6 38.0 35-39 36.57135000000001 38.0 38.0 38.0 34.0 38.0 40-44 36.47545 38.0 38.0 38.0 34.0 38.0 45-49 36.60865 38.0 38.0 38.0 34.4 38.0 50-54 36.364549999999994 38.0 38.0 38.0 33.8 38.0 55-59 36.4812 38.0 38.0 38.0 33.8 38.0 60-64 36.2842 38.0 37.8 38.0 33.6 38.0 65-69 36.37385 38.0 38.0 38.0 33.8 38.0 70-74 36.3962 38.0 38.0 38.0 34.0 38.0 75-79 36.13935 38.0 37.4 38.0 33.0 38.0 80-84 35.9076 38.0 37.0 38.0 31.8 38.0 85-89 35.909 38.0 37.0 38.0 31.8 38.0 90-94 35.984899999999996 38.0 37.0 38.0 32.8 38.0 95-99 35.734049999999996 38.0 37.0 38.0 31.4 38.0 100-104 35.12155 38.0 35.8 38.0 28.4 38.0 105-109 34.51065 38.0 34.8 38.0 24.6 38.0 110-114 34.02195 38.0 34.2 38.0 22.2 38.0 115-119 34.05 38.0 34.4 38.0 23.0 38.0 120-124 33.6723 38.0 34.0 38.0 20.6 38.0 125-129 32.69095 37.4 32.4 38.0 15.0 38.0 130-134 31.964199999999998 36.0 31.0 38.0 14.2 38.0 135-139 30.707349999999998 35.4 26.6 38.0 13.6 38.0 140-144 30.348000000000003 35.2 27.2 38.0 13.0 38.0 145-149 30.000799999999998 35.2 28.4 38.0 6.4 38.0 150-151 25.038125 33.5 15.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 1.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 2.0 11 1.0 12 2.0 13 4.0 14 7.0 15 1.0 16 6.0 17 10.0 18 5.0 19 5.0 20 10.0 21 13.0 22 21.0 23 17.0 24 25.0 25 24.0 26 23.0 27 38.0 28 50.0 29 61.0 30 109.0 31 123.0 32 155.0 33 184.0 34 310.0 35 524.0 36 924.0 37 1335.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.575 17.599999999999998 11.95 33.875 2 30.5 22.75 27.700000000000003 19.05 3 23.175 26.3 27.55 22.975 4 26.900000000000002 30.475 20.65 21.975 5 27.075 32.475 19.825 20.625 6 22.875 34.975 21.675 20.474999999999998 7 22.1 18.95 35.275 23.674999999999997 8 24.8 22.95 24.95 27.3 9 23.674999999999997 22.25 29.25 24.825 10-14 25.655 25.755 23.369999999999997 25.22 15-19 25.36 25.27 25.045 24.325 20-24 24.845 25.874999999999996 25.119999999999997 24.16 25-29 25.374999999999996 25.77 24.88 23.974999999999998 30-34 25.56 25.47 24.875 24.095 35-39 25.790000000000003 26.245 24.16 23.805 40-44 25.865 24.935 24.635 24.565 45-49 25.355 25.825 24.985 23.835 50-54 25.624999999999996 25.165 25.105 24.104999999999997 55-59 26.095000000000002 25.115 24.675 24.115000000000002 60-64 25.264999999999997 25.669999999999998 25.074999999999996 23.990000000000002 65-69 25.915 25.005 24.77 24.310000000000002 70-74 25.919999999999998 25.3 25.064999999999998 23.715 75-79 25.34 25.53 25.255 23.875 80-84 25.119999999999997 25.790000000000003 24.529999999999998 24.560000000000002 85-89 26.284999999999997 24.955 25.509999999999998 23.25 90-94 25.335 25.755 25.22 23.69 95-99 24.89 25.95 25.155 24.005000000000003 100-104 25.564999999999998 25.415 24.82 24.2 105-109 25.81 26.07 24.779999999999998 23.34 110-114 25.790000000000003 26.029999999999998 24.84 23.34 115-119 25.71 26.284999999999997 24.745 23.26 120-124 25.929999999999996 25.995 24.69 23.385 125-129 25.895000000000003 26.445 24.235 23.425 130-134 26.77 26.095000000000002 24.32 22.814999999999998 135-139 25.779999999999998 25.929999999999996 24.98 23.31 140-144 26.13 26.450000000000003 24.995 22.425 145-149 26.265 25.88 24.495 23.36 150-151 26.2125 25.85 25.174999999999997 22.7625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 1.0 27 2.5 28 5.0 29 5.5 30 5.5 31 9.0 32 11.5 33 14.5 34 19.5 35 29.0 36 35.5 37 47.5 38 76.5 39 107.5 40 129.0 41 151.0 42 166.5 43 181.0 44 200.0 45 223.5 46 212.5 47 174.5 48 179.5 49 175.0 50 162.5 51 160.5 52 141.0 53 112.5 54 91.5 55 93.0 56 88.5 57 92.0 58 97.5 59 86.5 60 82.5 61 75.0 62 60.5 63 53.0 64 63.0 65 63.0 66 49.5 67 41.5 68 42.5 69 38.5 70 33.0 71 26.5 72 15.5 73 15.0 74 15.5 75 9.5 76 5.0 77 7.0 78 6.0 79 3.0 80 1.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.18987341772151 97.95 2 0.5822784810126582 1.15 3 0.12658227848101267 0.375 4 0.05063291139240507 0.2 5 0.0 0.0 6 0.025316455696202535 0.15 7 0.025316455696202535 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 7 0.17500000000000002 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.23750000000000002 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.8875 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.2375 0.0 0.0 0.0 0.0 122-123 1.4125 0.0 0.0 0.0 0.0 124-125 1.6625 0.0 0.0 0.0 0.0 126-127 1.8375 0.0 0.0 0.0 0.0 128-129 1.9375 0.0 0.0 0.0 0.0 130-131 2.1125 0.0 0.0 0.0 0.0 132-133 2.4125 0.0 0.0 0.0 0.0 134-135 2.625 0.0 0.0 0.0 0.0 136-137 2.8 0.0 0.0 0.0 0.0 138-139 2.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 855908 spots for SRR6958321.sra Written 855908 spots for SRR6958321.sra Read 855908 spots for SRR6958321.sra Written 855908 spots for SRR6958321.sra Read 855908 spots for SRR6958321.sra Written 855908 spots for SRR6958321.sra Read 855908 spots for SRR6958321.sra Written 855908 spots for SRR6958321.sra Read 855908 spots for SRR6958321.sra Written 855908 spots for SRR6958321.sra Read 855908 spots for SRR6958321.sra Written 855908 spots for SRR6958321.sra Read 855908 spots for SRR6958321.sra Written 855908 spots for SRR6958321.sra Read 855908 spots for SRR6958321.sra Written 855908 spots for SRR6958321.sra Read 855923 spots for SRR6958321.sra Written 855923 spots for SRR6958321.sra Read 855908 spots for SRR6958321.sra Written 855908 spots for SRR6958321.sra Read 855908 spots for SRR6958321.sra Written 855908 spots for SRR6958321.sra Read 855908 spots for SRR6958321.sra Written 855908 spots for SRR6958321.sra Read 855908 spots for SRR6958321.sra Written 855908 spots for SRR6958321.sra Read 855908 spots for SRR6958321.sra Written 855908 spots for SRR6958321.sra Read 855908 spots for SRR6958321.sra Written 855908 spots for SRR6958321.sra Read 855908 spots for SRR6958321.sra Written 855908 spots for SRR6958321.sra Read 855908 spots for SRR6958321.sra Written 855908 spots for SRR6958321.sra Read 855908 spots for SRR6958321.sra Written 855908 spots for SRR6958321.sra Read 855908 spots for SRR6958321.sra Written 855908 spots for SRR6958321.sra Read 855908 spots for SRR6958321.sra Written 855908 spots for SRR6958321.sra SRR ids: ['SRR6958321.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kx_ap71g SRR6958321.sra spots: 17118175 blocks: [[1, 855908], [855909, 1711816], [1711817, 2567724], [2567725, 3423632], [3423633, 4279540], [4279541, 5135448], [5135449, 5991356], [5991357, 6847264], [6847265, 7703172], [7703173, 8559080], [8559081, 9414988], [9414989, 10270896], [10270897, 11126804], [11126805, 11982712], [11982713, 12838620], [12838621, 13694528], [13694529, 14550436], [14550437, 15406344], [15406345, 16262252], [16262253, 17118175]] SRR6958321 file size 5779087 SRR6958321 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958321 SRR6958321_1.fastq SRR6958321_2.fastq Input file: SRR6958321_1.fastq Paired file: SRR6958321_2.fastq trimmed: SRR6958321-trimmed-pair1.fastq, SRR6958321-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:49:25 2024 >> started Fri Dec 6 19:49:47 2024 >> done (21.471s) 17118175 read pairs processed; of these: 12121 ( 0.07%) short read pairs filtered out after trimming by size control 8608 ( 0.05%) empty read pairs filtered out after trimming by size control 17097446 (99.88%) read pairs available; of these: 7186429 (42.03%) trimmed read pairs available after processing 9911017 (57.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 2 0.00% 21 1 0.00% 22 3 0.00% 23 6 0.00% 24 6 0.00% 25 6 0.00% 26 5 0.00% 27 8 0.00% 28 6 0.00% 29 5 0.00% 30 3 0.00% 31 5 0.00% 32 8 0.00% 33 10 0.00% 34 16 0.00% 35 10 0.00% 36 8 0.00% 37 11 0.00% 38 14 0.00% 39 8 0.00% 40 10 0.00% 41 13 0.00% 42 19 0.00% 43 17 0.00% 44 14 0.00% 45 19 0.00% 46 22 0.00% 47 24 0.00% 48 27 0.00% 49 22 0.00% 50 25 0.00% 51 36 0.00% 52 25 0.00% 53 40 0.00% 54 36 0.00% 55 54 0.00% 56 42 0.00% 57 71 0.00% 58 62 0.00% 59 66 0.00% 60 100 0.00% 61 85 0.00% 62 110 0.00% 63 131 0.00% 64 136 0.00% 65 128 0.00% 66 151 0.00% 67 175 0.00% 68 188 0.00% 69 236 0.00% 70 237 0.00% 71 256 0.00% 72 305 0.00% 73 348 0.00% 74 370 0.00% 75 479 0.00% 76 491 0.00% 77 582 0.00% 78 632 0.00% 79 691 0.00% 80 842 0.00% 81 910 0.01% 82 1066 0.01% 83 1282 0.01% 84 1900 0.01% 85 2281 0.01% 86 2325 0.01% 87 2527 0.01% 88 2697 0.02% 89 2681 0.02% 90 3007 0.02% 91 3174 0.02% 92 3348 0.02% 93 3652 0.02% 94 4060 0.02% 95 4285 0.03% 96 4722 0.03% 97 5048 0.03% 98 5243 0.03% 99 5763 0.03% 100 6121 0.04% 101 6648 0.04% 102 7174 0.04% 103 7570 0.04% 104 8062 0.05% 105 8693 0.05% 106 9347 0.05% 107 9850 0.06% 108 10286 0.06% 109 11174 0.07% 110 11726 0.07% 111 12534 0.07% 112 13448 0.08% 113 14246 0.08% 114 15128 0.09% 115 16176 0.09% 116 17150 0.10% 117 18157 0.11% 118 18997 0.11% 119 19862 0.12% 120 20458 0.12% 121 21918 0.13% 122 23232 0.14% 123 24773 0.14% 124 26306 0.15% 125 27853 0.16% 126 29894 0.17% 127 31639 0.19% 128 32919 0.19% 129 34898 0.20% 130 36994 0.22% 131 39215 0.23% 132 42351 0.25% 133 45629 0.27% 134 49072 0.29% 135 53464 0.31% 136 58145 0.34% 137 63546 0.37% 138 69293 0.41% 139 76696 0.45% 140 84184 0.49% 141 92257 0.54% 142 102798 0.60% 143 112381 0.66% 144 122582 0.72% 145 139118 0.81% 146 166116 0.97% 147 229460 1.34% 148 373983 2.19% 149 791177 4.63% 150 3854294 22.54% 151 9911017 57.97% 17097446 reads passed initial QC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=21 prefix-density=0.85 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=38.41 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.9 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.68 fanout-score-rank=15 prefix-density=0.56 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=19.21 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=4.6 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958321 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:50:35 Started mapping on | Dec 06 19:50:35 Finished on | Dec 06 19:52:17 Mapping speed, Million of reads per hour | 603.44 Number of input reads | 17097446 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16598804 Uniquely mapped reads % | 97.08% Average mapped length | 296.62 Number of splices: Total | 19656599 Number of splices: Annotated (sjdb) | 18544341 Number of splices: GT/AG | 19396566 Number of splices: GC/AG | 228440 Number of splices: AT/AC | 7256 Number of splices: Non-canonical | 24337 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.43 Insertion rate per base | 0.01% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 151034 % of reads mapped to multiple loci | 0.88% Number of reads mapped to too many loci | 14691 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.43% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 355539 355539 355539 N_multimapping 151034 151034 151034 N_noFeature 562997 16136584 686567 N_ambiguous 403881 2237 66332 UnstrandedReadsAssigned:15631926 PositiveStrandReadsAssigned:459983 NegativeStrandReadsAssigned:15845905 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958321 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958321-trimmed-pair1.fastq SRR6958321-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,097,446 reads, 15,860,081 reads pseudoaligned [quant] estimated average fragment length: 271.302 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52973 SRR6958321.ke.tsv 35125 SRR6958321.se.tsv 88098 total ==> SRR6958321.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 666.252 0 0 PNS24247 1044 773.698 49.3803 6.05209 PNS24249 1928 1657.7 35.9684 2.0575 PNS24246 1044 773.698 49.3803 6.05209 PNS24248 1044 773.698 49.3803 6.05209 PNS24244 1471 1200.7 12.8908 1.01805 PNS24243 293 81.2892 0 0 KQK14069 1603 1332.7 2256.53 160.558 KQK14071 474 219.719 47.3909 20.4527 ==> SRR6958321.se.tsv <== BRADI_1g14170v3 2605 BRADI_1g53295v3 253 BRADI_1g59795v3 198 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 272 BRADI_1g74790v3 86 BRADI_1g09890v3 0 BRADI_1g77505v3 180 BRADI_1g48960v3 0 SRR6958321 completed mapping pipeline successfully