Starting /dee2/code/volunteer_pipeline.sh SRR6958322 current disk space = 1549627461632 free memory = 1596890276 SRR6958322 SRAfilesize c832ed512fd2706ca7b5dce185c0c83e SRR6958322.sra SRR6958322.sra file validated SRR6958322 is paired end SRR6958322 is conventional basespace SRR6958322 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958322_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.24 18.0 18.0 32.0 18.0 33.0 2 25.6325 27.0 18.0 31.0 18.0 33.0 3 28.6565 29.0 27.0 31.0 25.0 33.0 4 29.385 31.0 29.0 33.0 25.0 33.0 5 31.87425 33.0 32.0 33.0 31.0 33.0 6 36.429 38.0 36.0 38.0 34.0 38.0 7 36.697 38.0 37.0 38.0 34.0 38.0 8 36.95625 38.0 38.0 38.0 35.0 38.0 9 37.15775 38.0 38.0 38.0 36.0 38.0 10-14 37.293 38.0 38.0 38.0 37.0 38.0 15-19 37.2356 38.0 38.0 38.0 36.4 38.0 20-24 37.290049999999994 38.0 38.0 38.0 36.6 38.0 25-29 37.3566 38.0 38.0 38.0 37.0 38.0 30-34 37.193599999999996 38.0 38.0 38.0 36.2 38.0 35-39 37.16275 38.0 38.0 38.0 36.0 38.0 40-44 37.1201 38.0 38.0 38.0 36.0 38.0 45-49 37.16545000000001 38.0 38.0 38.0 36.2 38.0 50-54 37.02235 38.0 38.0 38.0 35.4 38.0 55-59 36.4901 38.0 37.8 38.0 34.0 38.0 60-64 36.02865 38.0 37.0 38.0 31.8 38.0 65-69 35.678700000000006 38.0 36.4 38.0 29.8 38.0 70-74 35.75385 38.0 36.6 38.0 29.8 38.0 75-79 36.29495000000001 38.0 37.0 38.0 33.2 38.0 80-84 36.2873 38.0 37.0 38.0 33.2 38.0 85-89 36.16265 38.0 37.0 38.0 33.0 38.0 90-94 36.00405 38.0 37.0 38.0 32.6 38.0 95-99 35.76795 38.0 36.6 38.0 31.0 38.0 100-104 35.337 38.0 35.8 38.0 29.4 38.0 105-109 34.822649999999996 38.0 34.8 38.0 26.6 38.0 110-114 34.11655 38.0 34.0 38.0 23.8 38.0 115-119 33.615300000000005 38.0 33.8 38.0 21.8 38.0 120-124 33.35345 37.2 33.2 38.0 17.8 38.0 125-129 34.0584 38.0 34.0 38.0 23.6 38.0 130-134 34.090050000000005 38.0 34.0 38.0 23.4 38.0 135-139 33.80525 38.0 33.8 38.0 22.6 38.0 140-144 33.24375 38.0 33.4 38.0 17.8 38.0 145-149 31.843649999999997 36.8 32.2 38.0 11.4 38.0 150-151 26.701999999999998 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 1.0 19 4.0 20 4.0 21 5.0 22 2.0 23 8.0 24 11.0 25 14.0 26 23.0 27 34.0 28 42.0 29 71.0 30 80.0 31 129.0 32 178.0 33 212.0 34 358.0 35 618.0 36 1121.0 37 1081.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.853093485963477 21.12292177705097 5.778141182883619 42.24584355410194 2 22.3 13.925 31.424999999999997 32.35 3 19.875 17.4 25.575 37.15 4 25.775 24.5 21.425 28.299999999999997 5 24.456114028507127 29.382345586396596 23.78094523630908 22.380595148787197 6 22.3 32.875 24.7 20.125 7 17.375 22.85 40.2 19.575 8 19.75 23.150000000000002 29.825000000000003 27.275 9 19.5 21.875 34.675 23.95 10-14 22.86 26.889999999999997 26.185000000000002 24.065 15-19 22.505 25.81 26.57 25.115 20-24 22.34 26.255 26.505000000000003 24.9 25-29 22.400000000000002 25.679999999999996 26.650000000000002 25.27 30-34 22.62 25.840000000000003 26.419999999999998 25.119999999999997 35-39 22.45 26.27 26.515 24.765 40-44 22.415 25.985000000000003 26.534999999999997 25.064999999999998 45-49 22.555 25.419999999999998 26.479999999999997 25.545 50-54 22.689999999999998 25.290000000000003 26.685 25.335 55-59 22.53 25.874999999999996 26.384999999999998 25.21 60-64 22.645 25.515 26.619999999999997 25.22 65-69 22.61 26.31 25.990000000000002 25.09 70-74 23.305 25.52 26.1 25.074999999999996 75-79 22.695 25.900000000000002 26.009999999999998 25.395 80-84 22.79 25.94 26.240000000000002 25.03 85-89 23.03 25.435000000000002 25.905 25.629999999999995 90-94 22.68 25.745 26.165 25.41 95-99 23.05 25.71 25.715 25.525 100-104 23.165 25.840000000000003 25.795 25.2 105-109 23.244999999999997 25.535000000000004 26.174999999999997 25.045 110-114 23.11 25.905 25.355 25.629999999999995 115-119 22.96 25.755 26.490000000000002 24.795 120-124 23.395 24.740000000000002 26.174999999999997 25.69 125-129 23.13 25.290000000000003 26.135 25.445 130-134 22.88 25.41 26.224999999999998 25.485000000000003 135-139 23.325000000000003 25.335 25.7 25.64 140-144 23.51 25.240000000000002 25.945 25.305 145-149 23.400000000000002 25.915 25.545 25.14 150-151 24.25 24.675 26.424999999999997 24.65 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 1.0 26 1.0 27 3.5 28 5.0 29 6.0 30 8.5 31 9.0 32 14.0 33 26.0 34 38.0 35 41.0 36 52.5 37 70.0 38 84.0 39 116.0 40 149.5 41 167.0 42 190.0 43 200.0 44 202.5 45 227.5 46 225.5 47 200.0 48 191.5 49 188.0 50 181.0 51 157.0 52 135.5 53 127.5 54 113.0 55 95.0 56 84.5 57 78.0 58 63.5 59 58.5 60 67.5 61 60.5 62 47.5 63 44.5 64 43.0 65 38.5 66 34.0 67 32.0 68 25.0 69 22.0 70 18.0 71 12.0 72 11.5 73 9.0 74 6.0 75 6.0 76 5.0 77 3.0 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.275 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.0750000000000002 0.0 0.0 0.0 0.0 124-125 1.1875 0.0 0.0 0.0 0.0 126-127 1.3125 0.0 0.0 0.0 0.0 128-129 1.4500000000000002 0.0 0.0 0.0 0.0 130-131 1.7 0.0 0.0 0.0 0.0 132-133 1.9375 0.0 0.0 0.0 0.0 134-135 2.2874999999999996 0.0 0.0 0.0 0.0 136-137 2.6125 0.0 0.0 0.0 0.0 138-139 2.8499999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTATTGT 10 0.006841402 144.925 6 TATTGTG 10 0.006841402 144.925 7 ATTGTGG 10 0.006841402 144.925 8 >>END_MODULE SRR6958322 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958322_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9395 33.0 33.0 34.0 32.0 34.0 2 32.9215 34.0 33.0 34.0 32.0 34.0 3 32.87275 34.0 33.0 34.0 32.0 34.0 4 32.88475 34.0 33.0 34.0 32.0 34.0 5 32.81275 34.0 33.0 34.0 32.0 34.0 6 36.85725 38.0 38.0 38.0 35.0 38.0 7 36.724 38.0 38.0 38.0 35.0 38.0 8 36.61875 38.0 38.0 38.0 34.0 38.0 9 36.816 38.0 38.0 38.0 35.0 38.0 10-14 36.729499999999994 38.0 38.0 38.0 35.0 38.0 15-19 36.92145000000001 38.0 38.0 38.0 36.0 38.0 20-24 37.02595 38.0 38.0 38.0 36.0 38.0 25-29 36.92999999999999 38.0 38.0 38.0 36.0 38.0 30-34 36.77025 38.0 38.0 38.0 35.2 38.0 35-39 36.660199999999996 38.0 38.0 38.0 34.8 38.0 40-44 36.646100000000004 38.0 38.0 38.0 34.6 38.0 45-49 36.62015 38.0 38.0 38.0 34.8 38.0 50-54 36.62955 38.0 38.0 38.0 34.6 38.0 55-59 36.5797 38.0 38.0 38.0 34.6 38.0 60-64 36.5971 38.0 38.0 38.0 34.4 38.0 65-69 36.5012 38.0 38.0 38.0 34.0 38.0 70-74 36.42295 38.0 38.0 38.0 34.0 38.0 75-79 36.2885 38.0 38.0 38.0 33.8 38.0 80-84 36.023900000000005 38.0 37.0 38.0 32.6 38.0 85-89 36.028850000000006 38.0 37.2 38.0 33.0 38.0 90-94 36.010749999999994 38.0 37.2 38.0 33.0 38.0 95-99 35.872499999999995 38.0 37.2 38.0 32.6 38.0 100-104 35.58705 38.0 36.6 38.0 31.0 38.0 105-109 34.989850000000004 38.0 35.6 38.0 28.0 38.0 110-114 34.718849999999996 38.0 35.2 38.0 26.6 38.0 115-119 34.575 38.0 35.0 38.0 25.8 38.0 120-124 34.191 38.0 34.8 38.0 23.2 38.0 125-129 33.633599999999994 38.0 34.0 38.0 20.2 38.0 130-134 32.794 37.6 33.0 38.0 14.8 38.0 135-139 31.428000000000004 36.2 29.0 38.0 14.0 38.0 140-144 31.299950000000003 36.0 30.2 38.0 13.8 38.0 145-149 31.1159 36.0 31.0 38.0 8.6 38.0 150-151 26.474875 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 5.0 4 4.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 2.0 12 2.0 13 3.0 14 5.0 15 4.0 16 2.0 17 4.0 18 8.0 19 7.0 20 14.0 21 10.0 22 8.0 23 20.0 24 9.0 25 28.0 26 23.0 27 38.0 28 48.0 29 57.0 30 74.0 31 81.0 32 142.0 33 175.0 34 227.0 35 446.0 36 912.0 37 1633.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.8 18.55 10.174999999999999 33.475 2 28.749999999999996 23.65 30.075000000000003 17.525 3 21.7 25.900000000000002 28.249999999999996 24.15 4 24.85 32.275 20.599999999999998 22.275 5 25.724999999999998 34.625 20.8 18.85 6 23.674999999999997 36.125 20.4 19.8 7 21.925 20.25 35.15 22.675 8 22.175 25.124999999999996 25.2 27.500000000000004 9 23.674999999999997 23.45 27.525 25.35 10-14 25.30753075307531 27.127712771277128 23.607360736073606 23.957395739573958 15-19 26.055 25.650000000000002 24.595 23.7 20-24 25.064999999999998 26.040000000000003 25.174999999999997 23.72 25-29 25.07750775077508 26.232623262326232 24.987498749874987 23.7023702370237 30-34 24.925 25.740000000000002 25.47 23.865 35-39 25.03 25.88 25.105 23.985 40-44 25.25 25.7 25.365 23.685000000000002 45-49 25.71 25.290000000000003 25.505 23.494999999999997 50-54 26.35 24.785 25.455 23.41 55-59 25.424999999999997 25.650000000000002 25.09 23.835 60-64 25.385 25.465 25.025 24.125 65-69 25.77 25.365 24.925 23.94 70-74 25.69 25.645 24.965 23.7 75-79 25.385 25.28 25.905 23.43 80-84 25.03 25.795 25.515 23.66 85-89 25.180000000000003 25.52 25.275 24.025 90-94 25.474999999999998 26.275 24.654999999999998 23.595 95-99 25.715 26.179999999999996 25.16 22.945 100-104 25.314999999999998 25.629999999999995 25.66 23.395 105-109 25.7 25.840000000000003 25.27 23.189999999999998 110-114 24.875 26.215 25.41 23.5 115-119 25.480000000000004 26.26 25.064999999999998 23.195 120-124 25.66 25.525 25.575 23.24 125-129 25.445 26.265 25.285000000000004 23.005 130-134 25.588838325748863 26.38895834375156 25.438815822373357 22.58338750812622 135-139 25.925370148059223 25.965386154461783 25.325130052020807 22.784113645458184 140-144 26.689341269444306 26.144150452658433 24.908718051317962 22.257790226579303 145-149 26.064999999999998 26.22 24.64 23.075000000000003 150-151 26.75 26.1 25.087500000000002 22.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 2.0 25 1.5 26 1.5 27 2.0 28 2.5 29 5.5 30 8.0 31 9.5 32 14.0 33 22.5 34 24.5 35 25.0 36 41.5 37 61.5 38 80.0 39 98.5 40 125.5 41 154.0 42 180.0 43 195.5 44 198.5 45 192.0 46 193.5 47 200.5 48 196.0 49 191.0 50 171.0 51 153.0 52 143.0 53 119.0 54 105.0 55 103.0 56 101.0 57 102.0 58 87.5 59 82.5 60 70.5 61 58.5 62 60.5 63 55.5 64 48.5 65 55.0 66 54.0 67 35.5 68 29.0 69 31.5 70 30.5 71 23.0 72 14.5 73 7.0 74 8.5 75 9.0 76 6.0 77 3.5 78 1.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.015 135-139 0.04 140-144 0.034999999999999996 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29435483870968 98.5 2 0.655241935483871 1.3 3 0.025201612903225805 0.075 4 0.0 0.0 5 0.025201612903225805 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.65 0.0 0.0 0.0 0.0 116-117 0.7250000000000001 0.0 0.0 0.0 0.0 118-119 0.8375 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.1749999999999998 0.0 0.0 0.0 0.0 126-127 1.2875 0.0 0.0 0.0 0.0 128-129 1.4249999999999998 0.0 0.0 0.0 0.0 130-131 1.6875 0.0 0.0 0.0 0.0 132-133 1.95 0.0 0.0 0.0 0.0 134-135 2.2625 0.0 0.0 0.0 0.0 136-137 2.5875 0.0 0.0 0.0 0.0 138-139 2.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 895970 spots for SRR6958322.sra Written 895970 spots for SRR6958322.sra Read 895970 spots for SRR6958322.sra Written 895970 spots for SRR6958322.sra Read 895970 spots for SRR6958322.sra Written 895970 spots for SRR6958322.sra Read 895970 spots for SRR6958322.sra Written 895970 spots for SRR6958322.sra Read 895970 spots for SRR6958322.sra Written 895970 spots for SRR6958322.sra Read 895970 spots for SRR6958322.sra Written 895970 spots for SRR6958322.sra Read 895986 spots for SRR6958322.sra Written 895986 spots for SRR6958322.sra Read 895970 spots for SRR6958322.sra Written 895970 spots for SRR6958322.sra Read 895970 spots for SRR6958322.sra Written 895970 spots for SRR6958322.sra Read 895970 spots for SRR6958322.sra Written 895970 spots for SRR6958322.sra Read 895970 spots for SRR6958322.sra Written 895970 spots for SRR6958322.sra Read 895970 spots for SRR6958322.sra Written 895970 spots for SRR6958322.sra Read 895970 spots for SRR6958322.sra Written 895970 spots for SRR6958322.sra Read 895970 spots for SRR6958322.sra Written 895970 spots for SRR6958322.sra Read 895970 spots for SRR6958322.sra Written 895970 spots for SRR6958322.sra Read 895970 spots for SRR6958322.sra Written 895970 spots for SRR6958322.sra Read 895970 spots for SRR6958322.sra Written 895970 spots for SRR6958322.sra Read 895970 spots for SRR6958322.sra Written 895970 spots for SRR6958322.sra Read 895970 spots for SRR6958322.sra Written 895970 spots for SRR6958322.sra Read 895970 spots for SRR6958322.sra Written 895970 spots for SRR6958322.sra SRR ids: ['SRR6958322.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ylhnsgxb SRR6958322.sra spots: 17919416 blocks: [[1, 895970], [895971, 1791940], [1791941, 2687910], [2687911, 3583880], [3583881, 4479850], [4479851, 5375820], [5375821, 6271790], [6271791, 7167760], [7167761, 8063730], [8063731, 8959700], [8959701, 9855670], [9855671, 10751640], [10751641, 11647610], [11647611, 12543580], [12543581, 13439550], [13439551, 14335520], [14335521, 15231490], [15231491, 16127460], [16127461, 17023430], [17023431, 17919416]] SRR6958322 file size 6050601 SRR6958322 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958322 SRR6958322_1.fastq SRR6958322_2.fastq Input file: SRR6958322_1.fastq Paired file: SRR6958322_2.fastq trimmed: SRR6958322-trimmed-pair1.fastq, SRR6958322-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:53:10 2024 >> started Fri Dec 6 19:53:30 2024 >> done (20.084s) 17919416 read pairs processed; of these: 11721 ( 0.07%) short read pairs filtered out after trimming by size control 8331 ( 0.05%) empty read pairs filtered out after trimming by size control 17899364 (99.89%) read pairs available; of these: 7333114 (40.97%) trimmed read pairs available after processing 10566250 (59.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 3 0.00% 21 4 0.00% 22 5 0.00% 23 4 0.00% 24 9 0.00% 25 3 0.00% 26 2 0.00% 27 5 0.00% 28 7 0.00% 29 3 0.00% 30 5 0.00% 31 4 0.00% 32 9 0.00% 33 9 0.00% 34 6 0.00% 35 4 0.00% 36 6 0.00% 37 13 0.00% 38 11 0.00% 39 11 0.00% 40 8 0.00% 41 13 0.00% 42 12 0.00% 43 14 0.00% 44 18 0.00% 45 18 0.00% 46 10 0.00% 47 27 0.00% 48 20 0.00% 49 22 0.00% 50 31 0.00% 51 18 0.00% 52 23 0.00% 53 27 0.00% 54 39 0.00% 55 37 0.00% 56 56 0.00% 57 41 0.00% 58 59 0.00% 59 66 0.00% 60 75 0.00% 61 89 0.00% 62 74 0.00% 63 96 0.00% 64 110 0.00% 65 123 0.00% 66 153 0.00% 67 148 0.00% 68 165 0.00% 69 168 0.00% 70 224 0.00% 71 230 0.00% 72 291 0.00% 73 312 0.00% 74 351 0.00% 75 402 0.00% 76 423 0.00% 77 502 0.00% 78 561 0.00% 79 652 0.00% 80 694 0.00% 81 831 0.00% 82 1011 0.01% 83 1109 0.01% 84 1706 0.01% 85 2071 0.01% 86 2213 0.01% 87 2363 0.01% 88 2504 0.01% 89 2560 0.01% 90 2695 0.02% 91 2928 0.02% 92 3173 0.02% 93 3556 0.02% 94 3808 0.02% 95 3973 0.02% 96 4216 0.02% 97 4585 0.03% 98 4882 0.03% 99 5496 0.03% 100 5674 0.03% 101 6202 0.03% 102 6574 0.04% 103 7380 0.04% 104 7863 0.04% 105 8349 0.05% 106 8985 0.05% 107 9534 0.05% 108 9960 0.06% 109 10413 0.06% 110 11260 0.06% 111 11858 0.07% 112 12869 0.07% 113 13584 0.08% 114 14628 0.08% 115 15893 0.09% 116 16829 0.09% 117 17784 0.10% 118 18426 0.10% 119 19453 0.11% 120 20466 0.11% 121 21526 0.12% 122 22862 0.13% 123 24349 0.14% 124 25902 0.14% 125 27733 0.15% 126 29240 0.16% 127 30881 0.17% 128 32868 0.18% 129 34657 0.19% 130 36677 0.20% 131 38826 0.22% 132 42268 0.24% 133 45702 0.26% 134 49170 0.27% 135 53568 0.30% 136 58292 0.33% 137 63236 0.35% 138 69112 0.39% 139 76788 0.43% 140 84233 0.47% 141 92918 0.52% 142 102681 0.57% 143 110988 0.62% 144 121497 0.68% 145 135656 0.76% 146 164900 0.92% 147 228209 1.27% 148 369600 2.06% 149 784374 4.38% 150 4038203 22.56% 151 10566250 59.03% 17899364 reads passed initial QC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=19 prefix-density=0.85 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=59.20 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.6 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=3.67 fanout-score-rank=16 prefix-density=0.61 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=22.45 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=4.3 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958322 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:54:13 Started mapping on | Dec 06 19:54:13 Finished on | Dec 06 19:55:51 Mapping speed, Million of reads per hour | 657.53 Number of input reads | 17899364 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17484026 Uniquely mapped reads % | 97.68% Average mapped length | 296.86 Number of splices: Total | 20518886 Number of splices: Annotated (sjdb) | 19344775 Number of splices: GT/AG | 20247738 Number of splices: GC/AG | 237916 Number of splices: AT/AC | 7454 Number of splices: Non-canonical | 25778 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.44 Insertion rate per base | 0.01% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 150486 % of reads mapped to multiple loci | 0.84% Number of reads mapped to too many loci | 11446 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.03% % of reads unmapped: other | 0.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 272898 272898 272898 N_multimapping 150486 150486 150486 N_noFeature 669415 16982246 805132 N_ambiguous 438368 2405 73545 UnstrandedReadsAssigned:16376243 PositiveStrandReadsAssigned:499375 NegativeStrandReadsAssigned:16605349 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958322 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958322-trimmed-pair1.fastq SRR6958322-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,899,364 reads, 16,618,323 reads pseudoaligned [quant] estimated average fragment length: 270.251 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52973 SRR6958322.ke.tsv 35125 SRR6958322.se.tsv 88098 total ==> SRR6958322.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 667.126 0 0 PNS24247 1044 774.749 61.4047 7.23478 PNS24249 1928 1658.75 40.8579 2.24843 PNS24246 1044 774.749 61.4047 7.23478 PNS24248 1044 774.749 61.4047 7.23478 PNS24244 1471 1201.75 16.928 1.28581 PNS24243 293 81.0934 0 0 KQK14069 1603 1333.75 1862.61 127.477 KQK14071 474 219.954 61.4023 25.4822 ==> SRR6958322.se.tsv <== BRADI_1g14170v3 2222 BRADI_1g53295v3 320 BRADI_1g59795v3 284 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 249 BRADI_1g74790v3 67 BRADI_1g09890v3 0 BRADI_1g77505v3 229 BRADI_1g48960v3 1 SRR6958322 completed mapping pipeline successfully