Starting /dee2/code/volunteer_pipeline.sh SRR6958323 current disk space = 1549595271168 free memory = 1599076240 SRR6958323 SRAfilesize 425e4cb3ceeaa7b3e804a8cca8022072 SRR6958323.sra SRR6958323.sra file validated SRR6958323 is paired end SRR6958323 is conventional basespace SRR6958323 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958323_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.7675 18.0 18.0 32.0 18.0 33.0 2 26.143 27.0 18.0 31.0 18.0 33.0 3 28.10075 29.0 27.0 31.0 18.0 33.0 4 28.3385 30.0 27.0 33.0 15.0 33.0 5 31.548 33.0 32.0 33.0 30.0 33.0 6 35.818 37.0 36.0 38.0 31.0 38.0 7 36.50275 38.0 37.0 38.0 34.0 38.0 8 37.07175 38.0 38.0 38.0 36.0 38.0 9 37.14575 38.0 38.0 38.0 36.0 38.0 10-14 37.3516 38.0 38.0 38.0 37.0 38.0 15-19 37.339000000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.4093 38.0 38.0 38.0 36.8 38.0 25-29 37.41785 38.0 38.0 38.0 36.8 38.0 30-34 37.31025 38.0 38.0 38.0 37.0 38.0 35-39 37.2731 38.0 38.0 38.0 36.8 38.0 40-44 37.221199999999996 38.0 38.0 38.0 36.2 38.0 45-49 37.270300000000006 38.0 38.0 38.0 36.6 38.0 50-54 37.08364999999999 38.0 38.0 38.0 35.8 38.0 55-59 36.6444 38.0 37.8 38.0 34.2 38.0 60-64 36.227050000000006 38.0 37.0 38.0 33.2 38.0 65-69 35.921800000000005 38.0 36.8 38.0 31.0 38.0 70-74 36.03385 38.0 36.6 38.0 31.6 38.0 75-79 36.4307 38.0 37.2 38.0 33.8 38.0 80-84 36.45455 38.0 37.2 38.0 33.4 38.0 85-89 36.26925 38.0 37.0 38.0 33.4 38.0 90-94 36.246249999999996 38.0 37.0 38.0 33.0 38.0 95-99 35.9464 38.0 36.6 38.0 31.8 38.0 100-104 35.610699999999994 38.0 36.0 38.0 30.4 38.0 105-109 35.036699999999996 38.0 35.0 38.0 27.8 38.0 110-114 34.47645 38.0 34.6 38.0 25.4 38.0 115-119 33.8405 38.0 34.0 38.0 22.6 38.0 120-124 33.6322 38.0 33.6 38.0 20.8 38.0 125-129 34.4331 38.0 34.4 38.0 25.2 38.0 130-134 34.346999999999994 38.0 34.0 38.0 25.4 38.0 135-139 34.07745 38.0 34.0 38.0 23.6 38.0 140-144 33.306599999999996 38.0 33.4 38.0 19.4 38.0 145-149 32.0517 36.8 32.6 38.0 11.4 38.0 150-151 27.07625 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 6.0 20 4.0 21 3.0 22 1.0 23 8.0 24 15.0 25 9.0 26 12.0 27 28.0 28 32.0 29 54.0 30 80.0 31 106.0 32 177.0 33 223.0 34 363.0 35 581.0 36 1145.0 37 1151.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.06887052341598 17.272727272727273 6.115702479338843 41.54269972451791 2 22.45 15.65 30.15 31.75 3 20.25 21.099999999999998 23.599999999999998 35.05 4 24.525 27.275 20.825 27.375 5 25.531382845711427 30.332583145786447 23.380845211302827 20.7551887971993 6 21.55 32.6 24.6 21.25 7 16.375 23.075000000000003 41.275 19.275000000000002 8 20.95 22.3 29.299999999999997 27.450000000000003 9 18.4 21.95 33.6 26.05 10-14 22.36 26.455000000000002 25.855 25.330000000000002 15-19 22.105 26.27 26.61 25.014999999999997 20-24 22.765 25.86 26.82 24.555 25-29 22.335 25.945 26.640000000000004 25.080000000000002 30-34 22.59 26.314999999999998 26.515 24.58 35-39 22.439999999999998 26.045 26.365 25.15 40-44 22.439999999999998 25.89 26.76 24.91 45-49 22.38 25.790000000000003 26.700000000000003 25.130000000000003 50-54 22.105 26.435 26.195 25.264999999999997 55-59 22.59 26.145000000000003 26.590000000000003 24.675 60-64 22.37 25.83 26.35 25.45 65-69 22.395 26.07 26.240000000000002 25.295 70-74 22.605 25.56 26.195 25.64 75-79 22.869999999999997 25.685000000000002 26.064999999999998 25.380000000000003 80-84 22.3 25.905 26.16 25.635 85-89 22.84 25.95 25.85 25.36 90-94 23.005 25.195 26.384999999999998 25.415 95-99 22.91 25.535000000000004 25.874999999999996 25.679999999999996 100-104 22.919999999999998 25.735000000000003 26.224999999999998 25.119999999999997 105-109 22.605 25.580000000000002 25.974999999999998 25.840000000000003 110-114 22.689999999999998 25.46 26.345000000000002 25.505 115-119 23.335 25.61 26.195 24.86 120-124 22.830000000000002 25.94 26.119999999999997 25.11 125-129 23.025000000000002 25.259999999999998 26.395000000000003 25.319999999999997 130-134 22.46 25.715 26.26 25.564999999999998 135-139 22.905 25.230000000000004 26.174999999999997 25.69 140-144 23.44 25.374999999999996 25.765 25.419999999999998 145-149 23.064999999999998 25.795 25.795 25.345000000000002 150-151 23.150000000000002 25.8625 25.35 25.637500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 1.0 25 0.0 26 0.5 27 0.5 28 3.0 29 5.0 30 8.0 31 11.5 32 13.5 33 21.5 34 31.5 35 44.5 36 55.0 37 68.5 38 92.0 39 121.5 40 136.5 41 156.0 42 178.0 43 208.0 44 237.0 45 228.5 46 207.5 47 197.0 48 188.5 49 192.5 50 187.0 51 168.5 52 151.5 53 126.0 54 117.0 55 103.0 56 91.0 57 87.0 58 75.0 59 59.0 60 52.0 61 51.0 62 44.0 63 40.0 64 41.0 65 39.5 66 32.5 67 22.0 68 21.0 69 24.0 70 17.5 71 11.0 72 8.0 73 6.5 74 7.0 75 4.0 76 1.5 77 1.0 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.25 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.4777470455116922 0.95 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.7124999999999999 0.0 0.0 0.0 0.0 110-111 0.7875 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.4 0.0 0.0 0.0 0.0 120-121 1.625 0.0 0.0 0.0 0.0 122-123 1.7125 0.0 0.0 0.0 0.0 124-125 1.875 0.0 0.0 0.0 0.0 126-127 2.05 0.0 0.0 0.0 0.0 128-129 2.25 0.0 0.0 0.0 0.0 130-131 2.4875 0.0 0.0 0.0 0.0 132-133 2.6500000000000004 0.0 0.0 0.0 0.0 134-135 2.9125 0.0 0.0 0.0 0.0 136-137 3.1375 0.0 0.0 0.0 0.0 138-139 3.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958323 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958323_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.847 33.0 33.0 34.0 32.0 34.0 2 32.85775 33.0 33.0 34.0 32.0 34.0 3 32.825 33.0 33.0 34.0 32.0 34.0 4 32.813 34.0 33.0 34.0 32.0 34.0 5 32.7615 33.0 33.0 34.0 32.0 34.0 6 36.8125 38.0 38.0 38.0 35.0 38.0 7 36.67175 38.0 38.0 38.0 35.0 38.0 8 36.58825 38.0 38.0 38.0 34.0 38.0 9 36.7415 38.0 38.0 38.0 35.0 38.0 10-14 36.59375 38.0 38.0 38.0 34.2 38.0 15-19 36.82135 38.0 38.0 38.0 35.4 38.0 20-24 36.8652 38.0 38.0 38.0 36.0 38.0 25-29 36.7861 38.0 38.0 38.0 35.4 38.0 30-34 36.7418 38.0 38.0 38.0 34.8 38.0 35-39 36.51 38.0 38.0 38.0 34.0 38.0 40-44 36.53124999999999 38.0 38.0 38.0 34.2 38.0 45-49 36.54855 38.0 38.0 38.0 34.2 38.0 50-54 36.51950000000001 38.0 38.0 38.0 34.2 38.0 55-59 36.4682 38.0 38.0 38.0 34.0 38.0 60-64 36.4883 38.0 38.0 38.0 34.0 38.0 65-69 36.4367 38.0 38.0 38.0 34.0 38.0 70-74 36.29995 38.0 38.0 38.0 33.8 38.0 75-79 36.1346 38.0 37.8 38.0 33.2 38.0 80-84 35.956 38.0 37.2 38.0 32.6 38.0 85-89 35.8347 38.0 37.0 38.0 31.4 38.0 90-94 35.853899999999996 38.0 37.0 38.0 32.4 38.0 95-99 35.706950000000006 38.0 37.0 38.0 31.8 38.0 100-104 35.3899 38.0 36.0 38.0 29.8 38.0 105-109 34.83025 38.0 35.6 38.0 26.8 38.0 110-114 34.4574 38.0 35.0 38.0 24.4 38.0 115-119 34.299400000000006 38.0 35.0 38.0 23.6 38.0 120-124 33.93085 38.0 34.2 38.0 23.0 38.0 125-129 33.3667 38.0 34.0 38.0 17.4 38.0 130-134 32.483850000000004 37.2 32.6 38.0 14.4 38.0 135-139 31.126549999999998 35.6 28.6 38.0 14.0 38.0 140-144 30.932100000000002 36.0 29.2 38.0 13.2 38.0 145-149 30.6598 36.0 31.0 38.0 8.6 38.0 150-151 26.165125 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 3.0 5 1.0 6 0.0 7 1.0 8 3.0 9 0.0 10 1.0 11 3.0 12 5.0 13 3.0 14 1.0 15 3.0 16 5.0 17 10.0 18 3.0 19 6.0 20 11.0 21 16.0 22 12.0 23 6.0 24 21.0 25 32.0 26 28.0 27 44.0 28 52.0 29 62.0 30 82.0 31 102.0 32 119.0 33 194.0 34 265.0 35 465.0 36 888.0 37 1542.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.6 18.975 10.674999999999999 29.75 2 28.249999999999996 24.325 28.325 19.1 3 23.325000000000003 25.525 29.225 21.925 4 25.974999999999998 33.775 19.900000000000002 20.349999999999998 5 26.700000000000003 33.650000000000006 19.775000000000002 19.875 6 23.724999999999998 37.25 20.025000000000002 19.0 7 22.85 20.375 35.6 21.175 8 24.0 22.95 25.2 27.85 9 24.349999999999998 21.975 27.975 25.7 10-14 26.015 26.44 23.985 23.56 15-19 25.085 25.955000000000002 25.195 23.765 20-24 25.895000000000003 26.405 24.77 22.93 25-29 25.515 26.505000000000003 24.9 23.080000000000002 30-34 25.314999999999998 26.36 25.395 22.93 35-39 25.69 25.86 25.34 23.11 40-44 26.279999999999998 25.82 24.375 23.525 45-49 25.34 26.105 25.335 23.22 50-54 25.069999999999997 26.02 25.885 23.025000000000002 55-59 24.98 26.82 24.9 23.3 60-64 25.569999999999997 25.965 25.105 23.36 65-69 25.814999999999998 26.445 24.8 22.939999999999998 70-74 25.705 25.5 25.86 22.935 75-79 25.264999999999997 26.33 24.834999999999997 23.57 80-84 25.41 26.279999999999998 25.105 23.205000000000002 85-89 25.929999999999996 25.724999999999998 25.305 23.04 90-94 25.165 26.015 26.015 22.805 95-99 25.56 25.735000000000003 25.885 22.82 100-104 25.095 26.229999999999997 25.665 23.01 105-109 25.1 26.265 25.46 23.175 110-114 25.180000000000003 26.279999999999998 25.814999999999998 22.725 115-119 25.615 26.16 25.724999999999998 22.5 120-124 26.119999999999997 26.334999999999997 25.330000000000002 22.215 125-129 25.715 26.445 25.275 22.564999999999998 130-134 25.52 26.35 25.665 22.465 135-139 25.73257325732573 26.4976497649765 25.442544254425442 22.327232723272328 140-144 26.43396509476422 26.65399809971496 24.868730309546432 22.043306495974395 145-149 26.265 26.685 24.82 22.23 150-151 25.674999999999997 25.9625 25.85 22.5125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 0.5 24 0.5 25 1.0 26 2.0 27 1.5 28 1.5 29 4.5 30 6.5 31 8.0 32 14.0 33 19.5 34 23.5 35 30.0 36 43.5 37 68.0 38 82.0 39 97.0 40 130.5 41 165.0 42 188.5 43 193.5 44 211.0 45 211.5 46 202.5 47 203.0 48 195.5 49 192.5 50 178.0 51 154.5 52 132.0 53 118.5 54 116.5 55 109.5 56 98.0 57 93.5 58 81.0 59 61.0 60 61.0 61 68.0 62 62.5 63 59.0 64 50.0 65 37.5 66 31.0 67 31.0 68 35.0 69 36.0 70 27.0 71 17.5 72 15.5 73 10.0 74 5.5 75 4.5 76 3.0 77 1.5 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.015 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44584382871537 98.7 2 0.42821158690176325 0.8500000000000001 3 0.05037783375314861 0.15 4 0.07556675062972291 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.6625000000000001 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.8125 0.0 0.0 0.0 0.0 114-115 0.9 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.375 0.0 0.0 0.0 0.0 120-121 1.6 0.0 0.0 0.0 0.0 122-123 1.6749999999999998 0.0 0.0 0.0 0.0 124-125 1.8125 0.0 0.0 0.0 0.0 126-127 1.9625 0.0 0.0 0.0 0.0 128-129 2.175 0.0 0.0 0.0 0.0 130-131 2.4125 0.0 0.0 0.0 0.0 132-133 2.575 0.0 0.0 0.0 0.0 134-135 2.8 0.0 0.0 0.0 0.0 136-137 3.0375 0.0 0.0 0.0 0.0 138-139 3.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAAAT 10 0.006830828 145.0 1 >>END_MODULE Read 956191 spots for SRR6958323.sra Written 956191 spots for SRR6958323.sra Read 956191 spots for SRR6958323.sra Written 956191 spots for SRR6958323.sra Read 956195 spots for SRR6958323.sra Written 956195 spots for SRR6958323.sra Read 956191 spots for SRR6958323.sra Written 956191 spots for SRR6958323.sra Read 956191 spots for SRR6958323.sra Written 956191 spots for SRR6958323.sra Read 956191 spots for SRR6958323.sra Written 956191 spots for SRR6958323.sra Read 956191 spots for SRR6958323.sra Written 956191 spots for SRR6958323.sra Read 956191 spots for SRR6958323.sra Written 956191 spots for SRR6958323.sra Read 956191 spots for SRR6958323.sra Written 956191 spots for SRR6958323.sra Read 956191 spots for SRR6958323.sra Written 956191 spots for SRR6958323.sra Read 956191 spots for SRR6958323.sra Written 956191 spots for SRR6958323.sra Read 956191 spots for SRR6958323.sra Written 956191 spots for SRR6958323.sra Read 956191 spots for SRR6958323.sra Written 956191 spots for SRR6958323.sra Read 956191 spots for SRR6958323.sra Written 956191 spots for SRR6958323.sra Read 956191 spots for SRR6958323.sra Written 956191 spots for SRR6958323.sra Read 956191 spots for SRR6958323.sra Written 956191 spots for SRR6958323.sra Read 956191 spots for SRR6958323.sra Written 956191 spots for SRR6958323.sra Read 956191 spots for SRR6958323.sra Written 956191 spots for SRR6958323.sra Read 956191 spots for SRR6958323.sra Written 956191 spots for SRR6958323.sra Read 956191 spots for SRR6958323.sra Written 956191 spots for SRR6958323.sra SRR ids: ['SRR6958323.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kfxvwzju SRR6958323.sra spots: 19123824 blocks: [[1, 956191], [956192, 1912382], [1912383, 2868573], [2868574, 3824764], [3824765, 4780955], [4780956, 5737146], [5737147, 6693337], [6693338, 7649528], [7649529, 8605719], [8605720, 9561910], [9561911, 10518101], [10518102, 11474292], [11474293, 12430483], [12430484, 13386674], [13386675, 14342865], [14342866, 15299056], [15299057, 16255247], [16255248, 17211438], [17211439, 18167629], [18167630, 19123824]] SRR6958323 file size 6458736 SRR6958323 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958323 SRR6958323_1.fastq SRR6958323_2.fastq Input file: SRR6958323_1.fastq Paired file: SRR6958323_2.fastq trimmed: SRR6958323-trimmed-pair1.fastq, SRR6958323-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:54:31 2024 >> started Fri Dec 6 19:54:50 2024 >> done (19.373s) 19123824 read pairs processed; of these: 17389 ( 0.09%) short read pairs filtered out after trimming by size control 12684 ( 0.07%) empty read pairs filtered out after trimming by size control 19093751 (99.84%) read pairs available; of these: 7925421 (41.51%) trimmed read pairs available after processing 11168330 (58.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 5 0.00% 21 3 0.00% 22 1 0.00% 23 10 0.00% 24 5 0.00% 25 3 0.00% 26 6 0.00% 27 11 0.00% 28 4 0.00% 29 8 0.00% 30 6 0.00% 31 10 0.00% 32 13 0.00% 33 5 0.00% 34 11 0.00% 35 7 0.00% 36 11 0.00% 37 10 0.00% 38 14 0.00% 39 15 0.00% 40 14 0.00% 41 13 0.00% 42 15 0.00% 43 21 0.00% 44 17 0.00% 45 18 0.00% 46 18 0.00% 47 26 0.00% 48 32 0.00% 49 24 0.00% 50 29 0.00% 51 28 0.00% 52 41 0.00% 53 59 0.00% 54 54 0.00% 55 63 0.00% 56 61 0.00% 57 69 0.00% 58 95 0.00% 59 99 0.00% 60 111 0.00% 61 127 0.00% 62 145 0.00% 63 162 0.00% 64 198 0.00% 65 206 0.00% 66 224 0.00% 67 253 0.00% 68 253 0.00% 69 322 0.00% 70 371 0.00% 71 435 0.00% 72 511 0.00% 73 519 0.00% 74 626 0.00% 75 641 0.00% 76 792 0.00% 77 883 0.00% 78 978 0.01% 79 1005 0.01% 80 1232 0.01% 81 1338 0.01% 82 1700 0.01% 83 1943 0.01% 84 2839 0.01% 85 3242 0.02% 86 3307 0.02% 87 3545 0.02% 88 3675 0.02% 89 3849 0.02% 90 4189 0.02% 91 4460 0.02% 92 4768 0.02% 93 5324 0.03% 94 5713 0.03% 95 6105 0.03% 96 6474 0.03% 97 6883 0.04% 98 7190 0.04% 99 7594 0.04% 100 8129 0.04% 101 8701 0.05% 102 9200 0.05% 103 10334 0.05% 104 10899 0.06% 105 11563 0.06% 106 11973 0.06% 107 12643 0.07% 108 13079 0.07% 109 13771 0.07% 110 14543 0.08% 111 15318 0.08% 112 16625 0.09% 113 17796 0.09% 114 18891 0.10% 115 20101 0.11% 116 21039 0.11% 117 21864 0.11% 118 22847 0.12% 119 23518 0.12% 120 24720 0.13% 121 26252 0.14% 122 27475 0.14% 123 29386 0.15% 124 31590 0.17% 125 33599 0.18% 126 34914 0.18% 127 36743 0.19% 128 38140 0.20% 129 40221 0.21% 130 42290 0.22% 131 44869 0.23% 132 48932 0.26% 133 53123 0.28% 134 57421 0.30% 135 61970 0.32% 136 66731 0.35% 137 73274 0.38% 138 78541 0.41% 139 87276 0.46% 140 94789 0.50% 141 105192 0.55% 142 114571 0.60% 143 123201 0.65% 144 134121 0.70% 145 148811 0.78% 146 178245 0.93% 147 244262 1.28% 148 393894 2.06% 149 825288 4.32% 150 4227653 22.14% 151 11168330 58.49% 19093751 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.09 fanout-score-rank=19 prefix-density=0.54 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=136.13 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=15.6 sequence=GCTTCTTCTGTCACTTGGGACGCCTGCTGCAGAGTGCAGATAAGGTTGCGGTCCCCGTACACGTTGTCCACACGACATGTTGTTGGCCAGAACTTGGCACCCCGAAGCCAAGCCGCAGGGAACGCGGCGTACTCCCTAGAGTACGGCTTAGTCCATGCATCGCTCATCAGGAGTTGGGGTGGGTGAGGAGCGCCCTTCAGGACATTGTTGTGCGCATCTGCTTTGCCATTTTCTACCTCTGCAATTTCTTCCCTGATTGAGACAAGGGCATCACAGAACCTGTCTAGTTCAGCCTTGCTTTCGCTTTCAGTGGGTTCAATCATAAGTGTGCCTGGAACAGGCCATGACATGGTTGGTCCGTGGAATCCATAGTCCATCAAGCGCTTTGCCACATCCTCAGGCTCTATACCAGCAGTTGCCTTAAACCCTCTTAAGTCAATAATGAATTCATGGGCAACAGTTCCATTGACTCCACGGAAAAGAACCGGGTAGTGCTTCTCCAGACGCTTTG criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.53 fanout-score-rank=20 prefix-density=0.44 prefix-fanout=2.9 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=76.02 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.6 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958323 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:55:35 Started mapping on | Dec 06 19:55:36 Finished on | Dec 06 19:57:31 Mapping speed, Million of reads per hour | 597.72 Number of input reads | 19093751 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 18475785 Uniquely mapped reads % | 96.76% Average mapped length | 296.20 Number of splices: Total | 22191084 Number of splices: Annotated (sjdb) | 20975497 Number of splices: GT/AG | 21899567 Number of splices: GC/AG | 256718 Number of splices: AT/AC | 9086 Number of splices: Non-canonical | 25713 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.42 Insertion rate per base | 0.01% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 173718 % of reads mapped to multiple loci | 0.91% Number of reads mapped to too many loci | 7152 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.05% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 455880 455880 455880 N_multimapping 173718 173718 173718 N_noFeature 587323 17985326 715482 N_ambiguous 430307 2247 69460 UnstrandedReadsAssigned:17458155 PositiveStrandReadsAssigned:488212 NegativeStrandReadsAssigned:17690843 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958323 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958323-trimmed-pair1.fastq SRR6958323-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,093,751 reads, 17,710,683 reads pseudoaligned [quant] estimated average fragment length: 269.888 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52973 SRR6958323.ke.tsv 35125 SRR6958323.se.tsv 88098 total ==> SRR6958323.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 667.603 0 0 PNS24247 1044 775.112 62.67 7.05303 PNS24249 1928 1659.11 59.2809 3.11688 PNS24246 1044 775.112 62.67 7.05303 PNS24248 1044 775.112 62.67 7.05303 PNS24244 1471 1202.11 15.709 1.13995 PNS24243 293 82.0594 0 0 KQK14069 1603 1334.11 1843.03 120.51 KQK14071 474 220.723 14.6065 5.77268 ==> SRR6958323.se.tsv <== BRADI_1g14170v3 2009 BRADI_1g53295v3 318 BRADI_1g59795v3 262 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 344 BRADI_1g74790v3 110 BRADI_1g09890v3 0 BRADI_1g77505v3 236 BRADI_1g48960v3 0 SRR6958323 completed mapping pipeline successfully