Starting /dee2/code/volunteer_pipeline.sh SRR6958324 current disk space = 1549599191040 free memory = 1596830800 SRR6958324 SRAfilesize 00b7859b3f6a406211ac28688a102f19 SRR6958324.sra SRR6958324.sra file validated SRR6958324 is paired end SRR6958324 is conventional basespace SRR6958324 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958324_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.612 18.0 18.0 28.0 18.0 32.0 2 22.5005 18.0 18.0 27.0 18.0 31.0 3 27.45125 27.0 27.0 30.0 18.0 33.0 4 30.1705 32.0 30.0 33.0 25.0 33.0 5 32.14225 33.0 32.0 33.0 32.0 33.0 6 36.799 38.0 37.0 38.0 35.0 38.0 7 37.44575 38.0 38.0 38.0 37.0 38.0 8 37.44575 38.0 38.0 38.0 37.0 38.0 9 37.51775 38.0 38.0 38.0 37.0 38.0 10-14 37.495400000000004 38.0 38.0 38.0 37.6 38.0 15-19 37.5032 38.0 38.0 38.0 37.6 38.0 20-24 37.47255 38.0 38.0 38.0 37.4 38.0 25-29 37.04639999999999 38.0 38.0 38.0 36.0 38.0 30-34 37.43465 38.0 38.0 38.0 37.4 38.0 35-39 37.4527 38.0 38.0 38.0 37.6 38.0 40-44 37.363550000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.33335 38.0 38.0 38.0 37.0 38.0 50-54 37.287150000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.39575 38.0 38.0 38.0 37.0 38.0 60-64 37.3383 38.0 38.0 38.0 37.0 38.0 65-69 37.348 38.0 38.0 38.0 37.0 38.0 70-74 37.2458 38.0 38.0 38.0 36.6 38.0 75-79 37.30615 38.0 38.0 38.0 37.0 38.0 80-84 37.18065 38.0 38.0 38.0 36.4 38.0 85-89 36.84875 38.0 38.0 38.0 35.2 38.0 90-94 35.689800000000005 38.0 36.8 38.0 29.2 38.0 95-99 35.9702 38.0 37.0 38.0 31.8 38.0 100-104 35.97175 38.0 37.4 38.0 32.0 38.0 105-109 35.95275 38.0 37.2 38.0 31.8 38.0 110-114 35.844849999999994 38.0 36.8 38.0 31.8 38.0 115-119 36.23405 38.0 37.6 38.0 33.6 38.0 120-124 36.49175 38.0 38.0 38.0 34.0 38.0 125-129 36.5487 38.0 38.0 38.0 34.0 38.0 130-134 36.1777 38.0 37.6 38.0 33.6 38.0 135-139 36.158049999999996 38.0 37.4 38.0 33.4 38.0 140-144 34.9666 37.8 35.4 38.0 28.8 38.0 145-149 34.284000000000006 38.0 34.4 38.0 27.2 38.0 150-151 31.417375 36.5 31.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 0.0 17 3.0 18 1.0 19 0.0 20 1.0 21 0.0 22 4.0 23 2.0 24 6.0 25 7.0 26 10.0 27 20.0 28 22.0 29 34.0 30 35.0 31 58.0 32 80.0 33 110.0 34 196.0 35 309.0 36 856.0 37 2244.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.05382742764403 18.58263456856911 7.979442791452529 40.38409521233432 2 22.325 17.575 28.325 31.775 3 22.305576394098527 18.904726181545385 23.85596399099775 34.93373343335834 4 24.55 27.224999999999998 21.175 27.05 5 24.5 30.075000000000003 22.975 22.45 6 22.325 31.95 24.175 21.55 7 15.950000000000001 22.875 39.525 21.65 8 21.85 24.875 27.3 25.974999999999998 9 19.275000000000002 22.400000000000002 33.425 24.9 10-14 22.905 26.965 25.740000000000002 24.39 15-19 22.770000000000003 25.03 26.645000000000003 25.555 20-24 23.321166058302914 25.506275313765688 26.09630481524076 25.076253812690634 25-29 23.044999999999998 25.88 25.585 25.490000000000002 30-34 22.545 25.490000000000002 25.855 26.11 35-39 23.145 25.224999999999998 26.169999999999998 25.46 40-44 22.96 25.31 26.25 25.480000000000004 45-49 22.564999999999998 25.624999999999996 25.595000000000002 26.215 50-54 22.84 25.2 26.55 25.41 55-59 23.402340234023402 24.41744174417442 26.3976397639764 25.782578257825783 60-64 22.945 25.21 25.805 26.040000000000003 65-69 22.93 25.259999999999998 26.595000000000002 25.215 70-74 23.474999999999998 24.745 26.185000000000002 25.595000000000002 75-79 23.565 25.39 25.905 25.14 80-84 23.369999999999997 24.845 25.795 25.990000000000002 85-89 23.400000000000002 25.16 25.374999999999996 26.064999999999998 90-94 23.175 25.055 26.32 25.45 95-99 23.425 24.555 25.995 26.025 100-104 23.294999999999998 24.755 26.02 25.929999999999996 105-109 23.69 24.165 25.905 26.240000000000002 110-114 23.165 25.314999999999998 25.369999999999997 26.150000000000002 115-119 23.26 25.195 25.430000000000003 26.115 120-124 23.35 25.224999999999998 25.130000000000003 26.295 125-129 23.89 25.385 25.305 25.419999999999998 130-134 23.77 25.215 25.53 25.485000000000003 135-139 23.425 24.855 25.53 26.19 140-144 23.575 24.685000000000002 25.485000000000003 26.255 145-149 23.87 25.41 25.365 25.355 150-151 23.825 24.762500000000003 25.0 26.4125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.5 26 3.0 27 3.5 28 4.0 29 5.5 30 11.0 31 13.0 32 12.5 33 21.5 34 27.0 35 29.0 36 40.5 37 64.5 38 81.0 39 95.0 40 131.0 41 160.0 42 185.0 43 197.5 44 207.5 45 211.0 46 204.0 47 199.0 48 185.5 49 183.0 50 169.5 51 153.0 52 140.5 53 126.0 54 111.0 55 99.0 56 98.5 57 88.5 58 77.0 59 76.5 60 67.0 61 72.5 62 67.5 63 52.5 64 52.5 65 47.0 66 43.0 67 38.0 68 31.5 69 26.5 70 24.0 71 18.5 72 14.5 73 10.0 74 5.5 75 2.5 76 3.0 77 2.5 78 1.0 79 0.5 80 0.0 81 1.0 82 1.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.575 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.01 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52237305178483 98.97500000000001 2 0.4273504273504274 0.8500000000000001 3 0.025138260432378077 0.075 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0125 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0125 0.0 0.0 0.0 0.025 78-79 0.025 0.0 0.0 0.0 0.025 80-81 0.025 0.0 0.0 0.0 0.025 82-83 0.025 0.0 0.0 0.0 0.025 84-85 0.037500000000000006 0.0 0.0 0.0 0.025 86-87 0.075 0.0 0.0 0.0 0.025 88-89 0.075 0.0 0.0 0.0 0.025 90-91 0.1125 0.0 0.0 0.0 0.025 92-93 0.175 0.0 0.0 0.0 0.025 94-95 0.225 0.0 0.0 0.0 0.025 96-97 0.225 0.0 0.0 0.0 0.025 98-99 0.25 0.0 0.0 0.0 0.025 100-101 0.25 0.0 0.0 0.0 0.025 102-103 0.32499999999999996 0.0 0.0 0.0 0.025 104-105 0.4 0.0 0.0 0.0 0.025 106-107 0.5625 0.0 0.0 0.0 0.025 108-109 0.65 0.0 0.0 0.0 0.025 110-111 0.8 0.0 0.0 0.0 0.025 112-113 0.975 0.0 0.0 0.0 0.025 114-115 1.075 0.0 0.0 0.0 0.025 116-117 1.275 0.0 0.0 0.0 0.025 118-119 1.475 0.0 0.0 0.0 0.025 120-121 1.65 0.0 0.0 0.0 0.025 122-123 1.775 0.0 0.0 0.0 0.025 124-125 1.9500000000000002 0.0 0.0 0.0 0.025 126-127 2.1375 0.0 0.0 0.0 0.025 128-129 2.35 0.0 0.0 0.0 0.025 130-131 2.4875 0.0 0.0 0.0 0.025 132-133 2.7625 0.0 0.0 0.0 0.025 134-135 3.1 0.0 0.0 0.0 0.025 136-137 3.5125 0.0 0.0 0.0 0.025 138-139 3.825 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGGGAC 10 0.005853838 152.57895 1 >>END_MODULE SRR6958324 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958324_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1145 33.0 33.0 34.0 32.0 34.0 2 33.195 34.0 33.0 34.0 33.0 34.0 3 33.2335 34.0 33.0 34.0 33.0 34.0 4 33.2115 34.0 33.0 34.0 33.0 34.0 5 33.10125 34.0 33.0 34.0 32.0 34.0 6 37.2325 38.0 38.0 38.0 37.0 38.0 7 37.30425 38.0 38.0 38.0 37.0 38.0 8 37.282 38.0 38.0 38.0 37.0 38.0 9 37.28875 38.0 38.0 38.0 37.0 38.0 10-14 36.8744 38.0 38.0 38.0 35.4 38.0 15-19 36.94835 38.0 38.0 38.0 35.8 38.0 20-24 36.9214 38.0 38.0 38.0 36.0 38.0 25-29 37.03635 38.0 38.0 38.0 36.4 38.0 30-34 36.85905 38.0 38.0 38.0 35.2 38.0 35-39 37.27705 38.0 38.0 38.0 37.0 38.0 40-44 37.03205 38.0 38.0 38.0 35.8 38.0 45-49 36.6211 38.0 38.0 38.0 34.4 38.0 50-54 36.18745 38.0 36.2 38.0 32.6 38.0 55-59 36.46085 38.0 37.4 38.0 33.8 38.0 60-64 34.03 37.2 32.0 38.0 24.8 38.0 65-69 36.76105 38.0 37.8 38.0 35.0 38.0 70-74 35.80649999999999 38.0 37.2 38.0 30.0 38.0 75-79 36.2719 38.0 37.8 38.0 33.0 38.0 80-84 34.699749999999995 37.8 34.0 38.0 27.0 38.0 85-89 35.907 38.0 37.2 38.0 31.6 38.0 90-94 36.457950000000004 38.0 38.0 38.0 34.0 38.0 95-99 34.809400000000004 37.6 32.0 38.0 28.8 38.0 100-104 36.37055 38.0 37.4 38.0 33.6 38.0 105-109 36.5577 38.0 38.0 38.0 34.4 38.0 110-114 36.17985 38.0 38.0 38.0 34.0 38.0 115-119 36.043049999999994 38.0 38.0 38.0 33.4 38.0 120-124 35.4172 38.0 37.0 38.0 30.2 38.0 125-129 34.50845 38.0 34.8 38.0 24.6 38.0 130-134 34.7841 38.0 35.2 38.0 25.6 38.0 135-139 35.434799999999996 38.0 36.2 38.0 31.6 38.0 140-144 34.736450000000005 38.0 35.4 38.0 27.4 38.0 145-149 34.81245 38.0 36.0 38.0 30.6 38.0 150-151 30.35575 35.5 28.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 1.0 5 1.0 6 1.0 7 3.0 8 1.0 9 0.0 10 2.0 11 1.0 12 0.0 13 1.0 14 2.0 15 1.0 16 2.0 17 1.0 18 6.0 19 2.0 20 8.0 21 6.0 22 8.0 23 4.0 24 9.0 25 8.0 26 23.0 27 26.0 28 24.0 29 43.0 30 60.0 31 79.0 32 100.0 33 118.0 34 202.0 35 325.0 36 914.0 37 2011.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.3 16.625 12.049999999999999 33.025 2 30.175 23.275000000000002 27.125 19.425 3 22.85 26.6 27.35 23.200000000000003 4 25.825 31.724999999999998 20.474999999999998 21.975 5 27.775 32.65 18.925 20.65 6 23.724999999999998 36.1 19.925 20.25 7 22.900000000000002 19.475 34.775 22.85 8 24.675 23.474999999999998 23.175 28.675 9 22.875 23.0 27.975 26.150000000000002 10-14 26.125 25.865 23.44 24.57 15-19 25.924999999999997 25.119999999999997 24.755 24.2 20-24 25.669999999999998 25.865 24.335 24.13 25-29 26.369999999999997 25.025 24.03 24.575 30-34 25.865 25.165 24.455 24.515 35-39 26.05 25.245 23.955000000000002 24.75 40-44 26.290000000000003 25.555 24.154999999999998 24.0 45-49 26.029999999999998 25.47 24.555 23.945 50-54 26.14 25.64 24.65 23.57 55-59 26.0 25.064999999999998 24.26 24.675 60-64 25.615 25.72 24.72 23.945 65-69 25.869999999999997 25.69 24.585 23.855 70-74 26.115 25.81 24.315 23.76 75-79 26.32 24.615000000000002 24.795 24.27 80-84 25.77 25.95 24.555 23.724999999999998 85-89 26.56 24.995 24.27 24.175 90-94 25.595000000000002 25.415 24.855 24.135 95-99 25.83 25.52 24.84 23.810000000000002 100-104 26.810000000000002 25.814999999999998 24.415 22.96 105-109 26.115 25.330000000000002 25.245 23.31 110-114 25.995 26.075 24.23 23.7 115-119 26.095000000000002 26.125 24.315 23.465 120-124 26.5 26.169999999999998 24.435000000000002 22.895 125-129 26.179999999999996 26.02 24.610000000000003 23.189999999999998 130-134 26.22 25.705 24.45 23.625 135-139 26.400000000000002 25.590000000000003 24.654999999999998 23.355 140-144 26.375 26.369999999999997 24.465 22.79 145-149 26.6 25.805 24.935 22.66 150-151 26.674999999999997 25.275 25.387500000000003 22.662499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.5 24 1.0 25 2.0 26 3.0 27 2.5 28 2.5 29 3.5 30 7.0 31 8.0 32 7.0 33 14.0 34 21.5 35 27.0 36 39.5 37 50.5 38 62.0 39 76.0 40 105.5 41 138.5 42 168.5 43 193.0 44 178.0 45 178.5 46 200.5 47 198.5 48 182.5 49 176.5 50 174.5 51 152.5 52 139.5 53 130.5 54 119.0 55 115.0 56 94.5 57 90.0 58 87.0 59 84.5 60 79.5 61 71.0 62 78.5 63 73.5 64 68.0 65 61.0 66 52.5 67 48.5 68 48.5 69 48.0 70 42.0 71 33.0 72 21.0 73 10.5 74 7.5 75 5.5 76 5.0 77 4.5 78 2.5 79 2.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14076320444781 98.075 2 0.7328784432650998 1.4500000000000002 3 0.0758150113722517 0.22499999999999998 4 0.0 0.0 5 0.050543340914834464 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.32499999999999996 0.0 0.0 0.0 0.0 106-107 0.48750000000000004 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.725 0.0 0.0 0.0 0.0 112-113 0.8999999999999999 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.3625 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.6375 0.0 0.0 0.0 0.0 124-125 1.8250000000000002 0.0 0.0 0.0 0.0 126-127 2.0 0.0 0.0 0.0 0.0 128-129 2.2 0.0 0.0 0.0 0.0 130-131 2.3375 0.0 0.0 0.0 0.0 132-133 2.6125 0.0 0.0 0.0 0.0 134-135 2.9625000000000004 0.0 0.0 0.0 0.0 136-137 3.4000000000000004 0.0 0.0 0.0 0.0 138-139 3.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 956023 spots for SRR6958324.sra Written 956023 spots for SRR6958324.sra Read 956023 spots for SRR6958324.sra Written 956023 spots for SRR6958324.sra Read 956023 spots for SRR6958324.sra Written 956023 spots for SRR6958324.sra Read 956023 spots for SRR6958324.sra Written 956023 spots for SRR6958324.sra Read 956023 spots for SRR6958324.sra Written 956023 spots for SRR6958324.sra Read 956023 spots for SRR6958324.sra Written 956023 spots for SRR6958324.sra Read 956023 spots for SRR6958324.sra Written 956023 spots for SRR6958324.sra Read 956023 spots for SRR6958324.sra Written 956023 spots for SRR6958324.sra Read 956023 spots for SRR6958324.sra Written 956023 spots for SRR6958324.sra Read 956023 spots for SRR6958324.sra Written 956023 spots for SRR6958324.sra Read 956023 spots for SRR6958324.sra Written 956023 spots for SRR6958324.sra Read 956023 spots for SRR6958324.sra Written 956023 spots for SRR6958324.sra Read 956023 spots for SRR6958324.sra Written 956023 spots for SRR6958324.sra Read 956023 spots for SRR6958324.sra Written 956023 spots for SRR6958324.sra Read 956023 spots for SRR6958324.sra Written 956023 spots for SRR6958324.sra Read 956023 spots for SRR6958324.sra Written 956023 spots for SRR6958324.sra Read 956023 spots for SRR6958324.sra Written 956023 spots for SRR6958324.sra Read 956023 spots for SRR6958324.sra Written 956023 spots for SRR6958324.sra Read 956023 spots for SRR6958324.sra Written 956023 spots for SRR6958324.sra Read 956023 spots for SRR6958324.sra Written 956023 spots for SRR6958324.sra SRR ids: ['SRR6958324.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__tlxtdlw SRR6958324.sra spots: 19120460 blocks: [[1, 956023], [956024, 1912046], [1912047, 2868069], [2868070, 3824092], [3824093, 4780115], [4780116, 5736138], [5736139, 6692161], [6692162, 7648184], [7648185, 8604207], [8604208, 9560230], [9560231, 10516253], [10516254, 11472276], [11472277, 12428299], [12428300, 13384322], [13384323, 14340345], [14340346, 15296368], [15296369, 16252391], [16252392, 17208414], [17208415, 18164437], [18164438, 19120460]] SRR6958324 file size 6457596 SRR6958324 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958324 SRR6958324_1.fastq SRR6958324_2.fastq Input file: SRR6958324_1.fastq Paired file: SRR6958324_2.fastq trimmed: SRR6958324-trimmed-pair1.fastq, SRR6958324-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:55:49 2024 >> started Fri Dec 6 19:56:09 2024 >> done (20.023s) 19120460 read pairs processed; of these: 14737 ( 0.08%) short read pairs filtered out after trimming by size control 11718 ( 0.06%) empty read pairs filtered out after trimming by size control 19094005 (99.86%) read pairs available; of these: 6027225 (31.57%) trimmed read pairs available after processing 13066780 (68.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 5 0.00% 21 5 0.00% 22 3 0.00% 23 5 0.00% 24 2 0.00% 25 7 0.00% 26 4 0.00% 27 6 0.00% 28 8 0.00% 29 4 0.00% 30 5 0.00% 31 2 0.00% 32 6 0.00% 33 4 0.00% 34 6 0.00% 35 8 0.00% 36 12 0.00% 37 7 0.00% 38 9 0.00% 39 5 0.00% 40 12 0.00% 41 12 0.00% 42 5 0.00% 43 19 0.00% 44 8 0.00% 45 10 0.00% 46 7 0.00% 47 16 0.00% 48 19 0.00% 49 24 0.00% 50 17 0.00% 51 26 0.00% 52 35 0.00% 53 28 0.00% 54 29 0.00% 55 37 0.00% 56 47 0.00% 57 40 0.00% 58 46 0.00% 59 78 0.00% 60 81 0.00% 61 96 0.00% 62 102 0.00% 63 94 0.00% 64 123 0.00% 65 151 0.00% 66 159 0.00% 67 184 0.00% 68 225 0.00% 69 268 0.00% 70 295 0.00% 71 320 0.00% 72 342 0.00% 73 417 0.00% 74 501 0.00% 75 533 0.00% 76 602 0.00% 77 697 0.00% 78 749 0.00% 79 836 0.00% 80 976 0.01% 81 1104 0.01% 82 1279 0.01% 83 1585 0.01% 84 2314 0.01% 85 2846 0.01% 86 2869 0.02% 87 2886 0.02% 88 3184 0.02% 89 3399 0.02% 90 3610 0.02% 91 3948 0.02% 92 4199 0.02% 93 4593 0.02% 94 4997 0.03% 95 5327 0.03% 96 5697 0.03% 97 6085 0.03% 98 6369 0.03% 99 6707 0.04% 100 7342 0.04% 101 7807 0.04% 102 8626 0.05% 103 9318 0.05% 104 9878 0.05% 105 10329 0.05% 106 10952 0.06% 107 11394 0.06% 108 12105 0.06% 109 12491 0.07% 110 13345 0.07% 111 13862 0.07% 112 15051 0.08% 113 15922 0.08% 114 16960 0.09% 115 18142 0.10% 116 18660 0.10% 117 19456 0.10% 118 20098 0.11% 119 20576 0.11% 120 21526 0.11% 121 22641 0.12% 122 23167 0.12% 123 24979 0.13% 124 26591 0.14% 125 27841 0.15% 126 28778 0.15% 127 30090 0.16% 128 30491 0.16% 129 31681 0.17% 130 32620 0.17% 131 34520 0.18% 132 35995 0.19% 133 38303 0.20% 134 40107 0.21% 135 42639 0.22% 136 44622 0.23% 137 46713 0.24% 138 49166 0.26% 139 51314 0.27% 140 54461 0.29% 141 58127 0.30% 142 64059 0.34% 143 71300 0.37% 144 80574 0.42% 145 94252 0.49% 146 113800 0.60% 147 150163 0.79% 148 224717 1.18% 149 448440 2.35% 150 3629853 19.01% 151 13066780 68.43% 19094005 reads passed initial QC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=27 prefix-density=0.96 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=46.67 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.0 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=3.45 fanout-score-rank=14 prefix-density=0.65 prefix-fanout=3.1 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=25.24 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=4.4 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958324 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:57:10 Started mapping on | Dec 06 19:57:10 Finished on | Dec 06 19:58:37 Mapping speed, Million of reads per hour | 790.10 Number of input reads | 19094005 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 18644668 Uniquely mapped reads % | 97.65% Average mapped length | 297.47 Number of splices: Total | 22211852 Number of splices: Annotated (sjdb) | 20963151 Number of splices: GT/AG | 21918741 Number of splices: GC/AG | 258075 Number of splices: AT/AC | 8349 Number of splices: Non-canonical | 26687 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.43 Insertion rate per base | 0.01% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 156446 % of reads mapped to multiple loci | 0.82% Number of reads mapped to too many loci | 13029 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.06% % of reads unmapped: other | 0.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 301795 301795 301795 N_multimapping 156446 156446 156446 N_noFeature 552253 18120579 688918 N_ambiguous 458418 2510 72580 UnstrandedReadsAssigned:17633997 PositiveStrandReadsAssigned:521579 NegativeStrandReadsAssigned:17883170 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958324 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958324-trimmed-pair1.fastq SRR6958324-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,094,005 reads, 17,875,968 reads pseudoaligned [quant] estimated average fragment length: 272.614 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52973 SRR6958324.ke.tsv 35125 SRR6958324.se.tsv 88098 total ==> SRR6958324.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 665.022 0 0 PNS24247 1044 772.386 55.3974 5.94971 PNS24249 1928 1656.39 39.7205 1.98927 PNS24246 1044 772.386 55.3974 5.94971 PNS24248 1044 772.386 55.3974 5.94971 PNS24244 1471 1199.39 19.0873 1.32016 PNS24243 293 83.7948 0 0 KQK14069 1603 1331.39 3489.87 217.443 KQK14071 474 221.508 37.0858 13.8886 ==> SRR6958324.se.tsv <== BRADI_1g14170v3 3797 BRADI_1g53295v3 265 BRADI_1g59795v3 199 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 264 BRADI_1g74790v3 94 BRADI_1g09890v3 0 BRADI_1g77505v3 198 BRADI_1g48960v3 0 SRR6958324 completed mapping pipeline successfully