Starting /dee2/code/volunteer_pipeline.sh SRR6958325 current disk space = 1549593706496 free memory = 1602859108 SRR6958325 SRAfilesize 6ccedd163e5ca12d3b7aa1e8bc2f0e18 SRR6958325.sra SRR6958325.sra file validated SRR6958325 is paired end SRR6958325 is conventional basespace SRR6958325 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958325_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.20225 32.0 18.0 33.0 18.0 34.0 2 32.08 33.0 31.0 34.0 29.0 34.0 3 32.89125 33.0 33.0 34.0 31.0 34.0 4 32.13225 33.0 31.0 33.0 31.0 34.0 5 32.5605 33.0 33.0 33.0 32.0 34.0 6 36.98775 38.0 37.0 38.0 35.0 38.0 7 37.16975 38.0 38.0 38.0 35.0 38.0 8 37.4755 38.0 38.0 38.0 37.0 38.0 9 37.6635 38.0 38.0 38.0 38.0 38.0 10-14 37.627700000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.62335 38.0 38.0 38.0 38.0 38.0 20-24 37.5943 38.0 38.0 38.0 38.0 38.0 25-29 37.588750000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.5535 38.0 38.0 38.0 38.0 38.0 35-39 37.532500000000006 38.0 38.0 38.0 37.8 38.0 40-44 37.555949999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.5119 38.0 38.0 38.0 37.2 38.0 50-54 37.4851 38.0 38.0 38.0 37.0 38.0 55-59 37.14425 38.0 38.0 38.0 36.8 38.0 60-64 36.6175 38.0 38.0 38.0 36.0 38.0 65-69 37.2742 38.0 38.0 38.0 36.6 38.0 70-74 37.305350000000004 38.0 38.0 38.0 36.6 38.0 75-79 37.2744 38.0 38.0 38.0 36.4 38.0 80-84 37.19005 38.0 38.0 38.0 36.0 38.0 85-89 37.095749999999995 38.0 38.0 38.0 36.0 38.0 90-94 37.041999999999994 38.0 38.0 38.0 36.0 38.0 95-99 36.9368 38.0 38.0 38.0 35.0 38.0 100-104 36.750600000000006 38.0 38.0 38.0 35.0 38.0 105-109 36.5326 38.0 38.0 38.0 34.0 38.0 110-114 36.49345 38.0 38.0 38.0 34.2 38.0 115-119 36.35125 38.0 38.0 38.0 34.0 38.0 120-124 36.185050000000004 38.0 37.4 38.0 33.0 38.0 125-129 36.02435 38.0 37.2 38.0 32.4 38.0 130-134 35.746849999999995 38.0 36.4 38.0 31.4 38.0 135-139 35.096250000000005 38.0 36.0 38.0 30.0 38.0 140-144 34.48435 38.0 35.2 38.0 26.8 38.0 145-149 34.139300000000006 38.0 34.8 38.0 26.6 38.0 150-151 28.864624999999997 34.5 18.0 38.0 11.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 0.0 18 1.0 19 1.0 20 3.0 21 3.0 22 4.0 23 7.0 24 9.0 25 7.0 26 11.0 27 10.0 28 20.0 29 29.0 30 34.0 31 47.0 32 41.0 33 91.0 34 133.0 35 286.0 36 735.0 37 2525.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.325 11.425 9.700000000000001 35.55 2 24.224999999999998 11.475 32.550000000000004 31.75 3 21.224999999999998 14.45 27.175 37.15 4 26.174999999999997 22.925 23.3 27.6 5 27.150000000000002 26.8 23.05 23.0 6 24.525 31.574999999999996 22.875 21.025 7 19.475 22.75 38.525 19.25 8 21.175 22.925 28.95 26.950000000000003 9 21.625 21.5 34.150000000000006 22.725 10-14 22.324464892978597 25.7251450290058 26.825365073014602 25.125025005001 15-19 23.080000000000002 24.5 26.165 26.255 20-24 23.51 25.15 26.314999999999998 25.025 25-29 22.975 24.335 26.105 26.584999999999997 30-34 22.814999999999998 25.345000000000002 25.945 25.895000000000003 35-39 23.24 25.224999999999998 25.77 25.765 40-44 22.925 24.985 26.185000000000002 25.905 45-49 23.23 25.230000000000004 25.195 26.345000000000002 50-54 23.630000000000003 25.485000000000003 25.355 25.53 55-59 23.318069742867205 25.12957278719871 25.401298243848437 26.151059226085643 60-64 23.51982894669857 24.650002545436035 25.6783587028458 26.1518098050196 65-69 23.205000000000002 24.560000000000002 25.905 26.33 70-74 23.11 25.264999999999997 26.0 25.624999999999996 75-79 23.54 25.05 25.405 26.005 80-84 23.580000000000002 25.330000000000002 25.169999999999998 25.919999999999998 85-89 24.245 24.945 25.430000000000003 25.380000000000003 90-94 23.425 24.555 26.525 25.495 95-99 24.015 23.799999999999997 25.990000000000002 26.195 100-104 23.655 24.635 26.105 25.605 105-109 23.919999999999998 24.58 25.88 25.619999999999997 110-114 23.985 24.245 25.53 26.240000000000002 115-119 24.165 24.425 25.715 25.695 120-124 24.099999999999998 25.025 25.435000000000002 25.44 125-129 23.49 24.77 25.495 26.245 130-134 23.724999999999998 25.16 25.31 25.805 135-139 24.075 24.834999999999997 25.314999999999998 25.775 140-144 24.529999999999998 24.615000000000002 25.3 25.555 145-149 24.05 24.8 25.135 26.015 150-151 23.8375 24.5 25.3125 26.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.0 26 1.5 27 2.0 28 2.0 29 4.5 30 5.5 31 4.0 32 8.0 33 16.5 34 18.5 35 27.0 36 40.0 37 48.5 38 65.0 39 96.0 40 146.5 41 165.0 42 173.5 43 199.0 44 219.5 45 222.0 46 206.0 47 204.5 48 198.5 49 176.5 50 150.0 51 143.5 52 128.5 53 107.0 54 101.0 55 91.0 56 90.5 57 96.0 58 83.0 59 71.0 60 76.5 61 76.0 62 69.0 63 62.5 64 60.5 65 50.0 66 47.5 67 49.5 68 40.0 69 37.0 70 32.5 71 24.0 72 19.0 73 16.5 74 11.0 75 5.5 76 2.0 77 1.0 78 3.0 79 2.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.02 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.635 60-64 1.7850000000000001 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.85 0.0 0.0 0.0 0.0 124-125 0.95 0.0 0.0 0.0 0.0 126-127 1.125 0.0 0.0 0.0 0.0 128-129 1.2375 0.0 0.0 0.0 0.0 130-131 1.5375 0.0 0.0 0.0 0.0 132-133 1.825 0.0 0.0 0.0 0.0 134-135 2.1 0.0 0.0 0.0 0.0 136-137 2.2875 0.0 0.0 0.0 0.0 138-139 2.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958325 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958325_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98825 33.0 33.0 34.0 32.0 34.0 2 33.10925 34.0 33.0 34.0 32.0 34.0 3 33.15475 34.0 33.0 34.0 33.0 34.0 4 33.15475 34.0 33.0 34.0 33.0 34.0 5 32.99525 34.0 33.0 34.0 33.0 34.0 6 37.21075 38.0 38.0 38.0 37.0 38.0 7 37.27575 38.0 38.0 38.0 37.0 38.0 8 37.168 38.0 38.0 38.0 37.0 38.0 9 37.25 38.0 38.0 38.0 37.0 38.0 10-14 37.190549999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.118 38.0 38.0 38.0 37.0 38.0 20-24 37.122400000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.0529 38.0 38.0 38.0 37.0 38.0 30-34 37.08365 38.0 38.0 38.0 37.0 38.0 35-39 37.03305 38.0 38.0 38.0 36.8 38.0 40-44 37.0575 38.0 38.0 38.0 36.8 38.0 45-49 37.04315 38.0 38.0 38.0 36.8 38.0 50-54 36.9465 38.0 38.0 38.0 36.0 38.0 55-59 36.921099999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.8488 38.0 38.0 38.0 36.0 38.0 65-69 36.83705 38.0 38.0 38.0 36.0 38.0 70-74 36.763 38.0 38.0 38.0 35.6 38.0 75-79 36.810050000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.83865000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.640550000000005 38.0 38.0 38.0 35.2 38.0 90-94 36.57745 38.0 38.0 38.0 35.0 38.0 95-99 36.469550000000005 38.0 38.0 38.0 34.6 38.0 100-104 36.3285 38.0 38.0 38.0 34.0 38.0 105-109 36.22795 38.0 38.0 38.0 34.0 38.0 110-114 35.977000000000004 38.0 38.0 38.0 33.2 38.0 115-119 35.8026 38.0 37.8 38.0 32.8 38.0 120-124 35.89405 38.0 38.0 38.0 33.0 38.0 125-129 35.8455 38.0 37.8 38.0 33.0 38.0 130-134 35.64075 38.0 36.8 38.0 32.8 38.0 135-139 35.4116 38.0 36.0 38.0 31.2 38.0 140-144 35.0304 38.0 36.0 38.0 30.6 38.0 145-149 34.49135 38.0 35.4 38.0 29.2 38.0 150-151 30.472625 35.5 29.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 5.0 4 4.0 5 1.0 6 1.0 7 0.0 8 0.0 9 3.0 10 1.0 11 2.0 12 3.0 13 2.0 14 3.0 15 2.0 16 4.0 17 0.0 18 6.0 19 3.0 20 2.0 21 3.0 22 2.0 23 3.0 24 10.0 25 15.0 26 19.0 27 22.0 28 21.0 29 27.0 30 34.0 31 46.0 32 48.0 33 79.0 34 112.0 35 184.0 36 522.0 37 2796.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.224999999999994 19.15 11.975 30.65 2 28.507126781695426 24.756189047261813 26.6816704176044 20.05501375343836 3 22.811405702851424 27.263631815907953 26.313156578289142 23.611805902951478 4 25.831457864466117 31.13278319579895 19.979994998749685 23.055763940985248 5 27.881970492623154 32.70817704426106 18.404601150287572 21.005251312828207 6 23.43358395989975 34.3609022556391 19.649122807017545 22.55639097744361 7 23.84056154424668 20.53146151917774 32.765104036099274 22.86287290047631 8 23.909774436090224 22.907268170426065 23.784461152882205 29.398496240601503 9 23.458646616541355 24.135338345864664 26.842105263157894 25.563909774436087 10-14 25.532661553115755 25.868551661904043 23.42206848147591 25.176718303504288 15-19 25.847372643401524 25.17549137585239 24.538708383473725 24.438427597272362 20-24 25.389822010528956 26.001504136375033 23.93080972674856 24.67786412634746 25-29 25.749523714027877 25.764564323673923 23.88950165446706 24.596410307831142 30-34 26.170660784117118 25.68434773889502 24.095056652963002 24.04993482402487 35-39 25.189270493858114 25.86111807470544 23.99598896966658 24.953622461769868 40-44 26.201814627299612 25.209283673367082 23.92099854629305 24.667903153040253 45-49 25.735625845907062 25.429846107574317 23.835781242167528 24.998746804351097 50-54 25.98385722163734 25.076452599388375 24.369579385371235 24.570110793603046 55-59 26.271993583638277 25.57521680284726 23.60018046017344 24.55260915334102 60-64 26.421337611551188 25.403589692168854 24.069988970219594 24.105083726060364 65-69 25.941149932327434 25.27946262970575 24.116497067522182 24.662890370444636 70-74 26.282019148829516 25.344628803448792 24.34708506692065 24.026266980801044 75-79 25.53884711779449 25.13784461152882 24.962406015037594 24.360902255639097 80-84 25.886009323775628 25.414807759787454 24.317008371346933 24.38217454508998 85-89 25.99629054087924 25.264424281918895 24.03629254599228 24.702992631209582 90-94 26.057962294424385 24.939831528279182 24.272964300040112 24.729241877256317 95-99 26.088046530284796 25.94765342960289 24.042318491776975 23.92198154833534 100-104 25.882647943831493 25.641925777332 24.2728184553661 24.202607823470412 105-109 25.846076710955128 25.32464276761093 24.482326397593383 24.34695412384056 110-114 25.953968811111665 26.01915459058316 23.883066740209596 24.143809858095572 115-119 26.366188709515693 25.614158227213473 24.33570640729971 23.683946655971123 120-124 26.065376516594807 25.839767371904145 24.280557505264213 23.81429860623684 125-129 26.503910166432725 26.02265891317425 23.30058151193102 24.172849408462003 130-134 26.26460119316188 25.57276783476212 24.10387526946408 24.058755702611922 135-139 26.36988018248358 25.502581841880982 24.489898230310324 23.63763974532511 140-144 26.81239346234834 26.2558909054447 23.864433971723653 23.067281660483303 145-149 26.16433548904597 25.76828595778814 24.344512959342257 23.722865593823634 150-151 26.394284998120064 25.980699335756363 24.92793583155784 22.697079834565734 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.5 2 3.0 3 3.0 4 1.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 1.5 26 0.5 27 0.0 28 0.0 29 0.5 30 2.0 31 4.5 32 9.0 33 14.0 34 19.0 35 26.5 36 32.0 37 44.5 38 67.5 39 91.5 40 108.0 41 129.5 42 162.0 43 193.5 44 215.0 45 206.5 46 198.0 47 189.0 48 174.0 49 167.5 50 158.5 51 148.5 52 134.5 53 112.5 54 91.5 55 89.5 56 88.0 57 87.0 58 89.0 59 90.5 60 83.0 61 82.5 62 87.5 63 84.5 64 71.0 65 56.5 66 65.0 67 61.0 68 55.5 69 48.5 70 37.5 71 32.5 72 24.5 73 16.5 74 10.0 75 9.5 76 7.0 77 3.0 78 1.0 79 1.0 80 1.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.05 4 0.025 5 0.025 6 0.25 7 0.27499999999999997 8 0.25 9 0.25 10-14 0.265 15-19 0.27999999999999997 20-24 0.27499999999999997 25-29 0.27 30-34 0.27 35-39 0.27499999999999997 40-44 0.255 45-49 0.255 50-54 0.265 55-59 0.255 60-64 0.27 65-69 0.255 70-74 0.255 75-79 0.25 80-84 0.255 85-89 0.255 90-94 0.27999999999999997 95-99 0.27999999999999997 100-104 0.3 105-109 0.27499999999999997 110-114 0.28500000000000003 115-119 0.27 120-124 0.27 125-129 0.26 130-134 0.265 135-139 0.265 140-144 0.27 145-149 0.265 150-151 0.2625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34409687184662 98.45 2 0.479313824419778 0.95 3 0.12613521695257315 0.375 4 0.025227043390514632 0.1 5 0.025227043390514632 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.30000000000000004 0.0 0.0 0.0 0.0 116-117 0.425 0.0 0.0 0.0 0.0 118-119 0.5375 0.0 0.0 0.0 0.0 120-121 0.6499999999999999 0.0 0.0 0.0 0.0 122-123 0.85 0.0 0.0 0.0 0.0 124-125 0.95 0.0 0.0 0.0 0.0 126-127 1.1625 0.0 0.0 0.0 0.0 128-129 1.2875 0.0 0.0 0.0 0.0 130-131 1.5875 0.0 0.0 0.0 0.0 132-133 1.875 0.0 0.0 0.0 0.0 134-135 2.175 0.0 0.0 0.0 0.0 136-137 2.3625 0.0 0.0 0.0 0.0 138-139 2.5999999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1307164 spots for SRR6958325.sra Written 1307164 spots for SRR6958325.sra Read 1307164 spots for SRR6958325.sra Written 1307164 spots for SRR6958325.sra Read 1307164 spots for SRR6958325.sra Written 1307164 spots for SRR6958325.sra Read 1307164 spots for SRR6958325.sra Written 1307164 spots for SRR6958325.sra Read 1307183 spots for SRR6958325.sra Written 1307183 spots for SRR6958325.sra Read 1307164 spots for SRR6958325.sra Written 1307164 spots for SRR6958325.sra Read 1307164 spots for SRR6958325.sra Written 1307164 spots for SRR6958325.sra Read 1307164 spots for SRR6958325.sra Written 1307164 spots for SRR6958325.sra Read 1307164 spots for SRR6958325.sra Written 1307164 spots for SRR6958325.sra Read 1307164 spots for SRR6958325.sra Written 1307164 spots for SRR6958325.sra Read 1307164 spots for SRR6958325.sra Written 1307164 spots for SRR6958325.sra Read 1307164 spots for SRR6958325.sra Written 1307164 spots for SRR6958325.sra Read 1307164 spots for SRR6958325.sra Written 1307164 spots for SRR6958325.sra Read 1307164 spots for SRR6958325.sra Written 1307164 spots for SRR6958325.sra Read 1307164 spots for SRR6958325.sra Written 1307164 spots for SRR6958325.sra Read 1307164 spots for SRR6958325.sra Written 1307164 spots for SRR6958325.sra Read 1307164 spots for SRR6958325.sra Written 1307164 spots for SRR6958325.sra Read 1307164 spots for SRR6958325.sra Written 1307164 spots for SRR6958325.sra Read 1307164 spots for SRR6958325.sra Written 1307164 spots for SRR6958325.sra Read 1307164 spots for SRR6958325.sra Written 1307164 spots for SRR6958325.sra SRR ids: ['SRR6958325.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p2vpwk0s SRR6958325.sra spots: 26143299 blocks: [[1, 1307164], [1307165, 2614328], [2614329, 3921492], [3921493, 5228656], [5228657, 6535820], [6535821, 7842984], [7842985, 9150148], [9150149, 10457312], [10457313, 11764476], [11764477, 13071640], [13071641, 14378804], [14378805, 15685968], [15685969, 16993132], [16993133, 18300296], [18300297, 19607460], [19607461, 20914624], [20914625, 22221788], [22221789, 23528952], [23528953, 24836116], [24836117, 26143299]] SRR6958325 file size 8837405 SRR6958325 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958325 SRR6958325_1.fastq SRR6958325_2.fastq Input file: SRR6958325_1.fastq Paired file: SRR6958325_2.fastq trimmed: SRR6958325-trimmed-pair1.fastq, SRR6958325-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:00:26 2024 >> started Fri Dec 6 20:00:53 2024 >> done (26.674s) 26143299 read pairs processed; of these: 46975 ( 0.18%) short read pairs filtered out after trimming by size control 45825 ( 0.18%) empty read pairs filtered out after trimming by size control 26050499 (99.65%) read pairs available; of these: 9628528 (36.96%) trimmed read pairs available after processing 16421971 (63.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 2 0.00% 20 7 0.00% 21 2 0.00% 22 2 0.00% 23 5 0.00% 24 6 0.00% 25 9 0.00% 26 4 0.00% 27 5 0.00% 28 12 0.00% 29 7 0.00% 30 8 0.00% 31 7 0.00% 32 13 0.00% 33 3 0.00% 34 10 0.00% 35 9 0.00% 36 10 0.00% 37 10 0.00% 38 9 0.00% 39 6 0.00% 40 5 0.00% 41 11 0.00% 42 8 0.00% 43 15 0.00% 44 11 0.00% 45 22 0.00% 46 19 0.00% 47 13 0.00% 48 29 0.00% 49 31 0.00% 50 25 0.00% 51 30 0.00% 52 30 0.00% 53 36 0.00% 54 28 0.00% 55 47 0.00% 56 61 0.00% 57 49 0.00% 58 61 0.00% 59 52 0.00% 60 74 0.00% 61 87 0.00% 62 71 0.00% 63 97 0.00% 64 117 0.00% 65 139 0.00% 66 122 0.00% 67 148 0.00% 68 210 0.00% 69 187 0.00% 70 216 0.00% 71 245 0.00% 72 298 0.00% 73 328 0.00% 74 322 0.00% 75 413 0.00% 76 533 0.00% 77 505 0.00% 78 617 0.00% 79 650 0.00% 80 757 0.00% 81 906 0.00% 82 1002 0.00% 83 1184 0.00% 84 2402 0.01% 85 3151 0.01% 86 3064 0.01% 87 3301 0.01% 88 3436 0.01% 89 3495 0.01% 90 3682 0.01% 91 3836 0.01% 92 4296 0.02% 93 4290 0.02% 94 4602 0.02% 95 4968 0.02% 96 5283 0.02% 97 5538 0.02% 98 5979 0.02% 99 6517 0.03% 100 6877 0.03% 101 7345 0.03% 102 7900 0.03% 103 8528 0.03% 104 9131 0.04% 105 9618 0.04% 106 10684 0.04% 107 11263 0.04% 108 11715 0.04% 109 12851 0.05% 110 13366 0.05% 111 14465 0.06% 112 15345 0.06% 113 15992 0.06% 114 17537 0.07% 115 18863 0.07% 116 20040 0.08% 117 21194 0.08% 118 21808 0.08% 119 23085 0.09% 120 24073 0.09% 121 25235 0.10% 122 27010 0.10% 123 28114 0.11% 124 29461 0.11% 125 31351 0.12% 126 33169 0.13% 127 34783 0.13% 128 36073 0.14% 129 37838 0.15% 130 39492 0.15% 131 41887 0.16% 132 44539 0.17% 133 47476 0.18% 134 50034 0.19% 135 53145 0.20% 136 56577 0.22% 137 60908 0.23% 138 64142 0.25% 139 69193 0.27% 140 75036 0.29% 141 80822 0.31% 142 90289 0.35% 143 100944 0.39% 144 115925 0.45% 145 140801 0.54% 146 177317 0.68% 147 261123 1.00% 148 360342 1.38% 149 795832 3.05% 150 6240187 23.95% 151 16421971 63.04% 26050499 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=4.89 fanout-score-rank=14 prefix-density=0.64 prefix-fanout=3.5 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=153.84 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=9.1 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=4.78 fanout-score-rank=14 prefix-density=0.39 prefix-fanout=3.4 sequence=CTTCGACAACACCATGGGAGGCTTTTACATCGCCCCGGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGCGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACCGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAGAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.13 sequence-density-rank=21 fanout-score=67.66 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=12.5 sequence=GCCGCCGCCGCCA SRR6958325 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:01:42 Started mapping on | Dec 06 20:01:43 Finished on | Dec 06 20:03:51 Mapping speed, Million of reads per hour | 732.67 Number of input reads | 26050499 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 25238391 Uniquely mapped reads % | 96.88% Average mapped length | 297.95 Number of splices: Total | 29091187 Number of splices: Annotated (sjdb) | 27329050 Number of splices: GT/AG | 28702552 Number of splices: GC/AG | 338040 Number of splices: AT/AC | 12526 Number of splices: Non-canonical | 38069 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 2.60 Insertion rate per base | 0.01% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 224218 % of reads mapped to multiple loci | 0.86% Number of reads mapped to too many loci | 13018 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.88% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 605387 605387 605387 N_multimapping 224218 224218 224218 N_noFeature 786192 24610730 958135 N_ambiguous 551754 3453 97196 UnstrandedReadsAssigned:23900445 PositiveStrandReadsAssigned:624208 NegativeStrandReadsAssigned:24183060 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958325 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958325-trimmed-pair1.fastq SRR6958325-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,050,499 reads, 24,195,265 reads pseudoaligned [quant] estimated average fragment length: 273.285 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52973 SRR6958325.ke.tsv 35125 SRR6958325.se.tsv 88098 total ==> SRR6958325.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 664.318 3.90397e-07 3.67571e-08 PNS24247 1044 771.715 101.384 8.21719 PNS24249 1928 1655.72 99.0638 3.7423 PNS24246 1044 771.715 101.384 8.21719 PNS24248 1044 771.715 101.384 8.21719 PNS24244 1471 1198.72 43.7833 2.28456 PNS24243 293 79.2919 0 0 KQK14069 1603 1330.72 4132.88 194.257 KQK14071 474 218.147 59.9199 17.1803 ==> SRR6958325.se.tsv <== BRADI_1g14170v3 4496 BRADI_1g53295v3 363 BRADI_1g59795v3 416 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 439 BRADI_1g74790v3 217 BRADI_1g09890v3 0 BRADI_1g77505v3 328 BRADI_1g48960v3 0 SRR6958325 completed mapping pipeline successfully