Starting /dee2/code/volunteer_pipeline.sh SRR6958326 current disk space = 1549593772032 free memory = 1591704052 SRR6958326 SRAfilesize 88a57732ba405af5a73b524029d2000a SRR6958326.sra SRR6958326.sra file validated SRR6958326 is paired end SRR6958326 is conventional basespace SRR6958326 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958326_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.525 18.0 18.0 18.0 18.0 32.0 2 27.4555 29.0 25.0 31.0 18.0 33.0 3 29.37925 31.0 29.0 33.0 25.0 33.0 4 29.74225 31.0 29.0 33.0 25.0 33.0 5 32.202 33.0 33.0 33.0 31.0 33.0 6 36.59875 38.0 37.0 38.0 34.0 38.0 7 37.3805 38.0 38.0 38.0 36.0 38.0 8 37.047 38.0 38.0 38.0 35.0 38.0 9 37.429 38.0 38.0 38.0 37.0 38.0 10-14 37.41460000000001 38.0 38.0 38.0 36.8 38.0 15-19 37.46655 38.0 38.0 38.0 37.2 38.0 20-24 37.556650000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.43315 38.0 38.0 38.0 37.8 38.0 30-34 37.2701 38.0 38.0 38.0 36.8 38.0 35-39 37.4029 38.0 38.0 38.0 37.4 38.0 40-44 37.50314999999999 38.0 38.0 38.0 37.6 38.0 45-49 37.5051 38.0 38.0 38.0 37.8 38.0 50-54 37.30865 38.0 38.0 38.0 37.0 38.0 55-59 37.316649999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.52925 38.0 38.0 38.0 37.8 38.0 65-69 37.503249999999994 38.0 38.0 38.0 37.4 38.0 70-74 37.1203 38.0 38.0 38.0 36.0 38.0 75-79 37.45835 38.0 38.0 38.0 37.2 38.0 80-84 37.3918 38.0 38.0 38.0 37.0 38.0 85-89 37.160450000000004 38.0 38.0 38.0 36.4 38.0 90-94 35.7599 38.0 36.8 38.0 30.0 38.0 95-99 36.062050000000006 38.0 37.4 38.0 32.0 38.0 100-104 36.0948 38.0 37.6 38.0 32.4 38.0 105-109 36.23825000000001 38.0 38.0 38.0 33.8 38.0 110-114 36.13715 38.0 37.6 38.0 33.2 38.0 115-119 36.693999999999996 38.0 38.0 38.0 34.8 38.0 120-124 36.7734 38.0 38.0 38.0 35.0 38.0 125-129 36.80845 38.0 38.0 38.0 35.0 38.0 130-134 36.730999999999995 38.0 38.0 38.0 34.8 38.0 135-139 36.669000000000004 38.0 38.0 38.0 34.8 38.0 140-144 36.171099999999996 38.0 38.0 38.0 33.6 38.0 145-149 35.6722 38.0 36.0 38.0 32.6 38.0 150-151 29.827375000000004 35.5 19.0 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 3.0 23 0.0 24 3.0 25 6.0 26 9.0 27 10.0 28 19.0 29 23.0 30 32.0 31 44.0 32 51.0 33 98.0 34 152.0 35 264.0 36 795.0 37 2485.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.132075471698116 10.970350404312669 9.784366576819407 38.113207547169814 2 25.224999999999998 14.35 32.125 28.299999999999997 3 23.5 18.125 25.974999999999998 32.4 4 25.224999999999998 26.724999999999998 22.400000000000002 25.650000000000002 5 25.900000000000002 27.500000000000004 24.075 22.525000000000002 6 22.15 31.924999999999997 24.5 21.425 7 16.675 24.675 40.6 18.05 8 21.5 21.975 28.999999999999996 27.525 9 19.525000000000002 20.599999999999998 33.525 26.35 10-14 22.775000000000002 26.729999999999997 25.665 24.83 15-19 22.13 25.759999999999998 26.445 25.665 20-24 22.857142857142858 25.589191893920436 26.38478859144358 25.168876657493122 25-29 23.005 25.814999999999998 26.224999999999998 24.955 30-34 22.805 25.590000000000003 26.450000000000003 25.155 35-39 22.915 25.2 26.590000000000003 25.295 40-44 22.470000000000002 25.69 26.77 25.069999999999997 45-49 22.905 25.545 25.665 25.885 50-54 22.225 25.679999999999996 26.855 25.240000000000002 55-59 23.015 25.485000000000003 26.43 25.069999999999997 60-64 22.720000000000002 25.25 26.93 25.1 65-69 22.59 25.145 26.484999999999996 25.779999999999998 70-74 23.09 25.740000000000002 25.82 25.35 75-79 23.305 25.580000000000002 25.95 25.165 80-84 22.865 25.445 26.174999999999997 25.515 85-89 22.86 25.195 26.400000000000002 25.545 90-94 22.775000000000002 25.455 26.400000000000002 25.369999999999997 95-99 23.119999999999997 24.9 26.455000000000002 25.525 100-104 23.105 25.585 26.115 25.195 105-109 23.380000000000003 25.435000000000002 25.814999999999998 25.369999999999997 110-114 23.395 25.83 25.455 25.319999999999997 115-119 22.720000000000002 26.229999999999997 25.52 25.53 120-124 23.27 25.045 26.075 25.61 125-129 23.32 25.430000000000003 25.915 25.335 130-134 23.669999999999998 25.785000000000004 25.365 25.180000000000003 135-139 23.175 25.82 25.319999999999997 25.685000000000002 140-144 23.41 24.75 26.325 25.515 145-149 23.515 25.724999999999998 25.169999999999998 25.590000000000003 150-151 24.775 24.5625 26.0625 24.6 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 2.0 24 1.0 25 0.5 26 2.5 27 3.5 28 3.5 29 3.5 30 5.0 31 10.0 32 19.0 33 22.5 34 24.5 35 36.0 36 50.0 37 59.5 38 76.0 39 113.5 40 143.5 41 160.0 42 180.5 43 209.0 44 212.5 45 211.5 46 228.5 47 225.5 48 213.5 49 170.5 50 146.0 51 149.5 52 141.5 53 128.0 54 103.0 55 104.5 56 105.5 57 91.0 58 71.5 59 61.5 60 59.5 61 58.5 62 55.5 63 46.0 64 44.5 65 42.5 66 37.0 67 31.5 68 29.5 69 24.0 70 20.5 71 16.5 72 11.5 73 10.0 74 7.0 75 3.0 76 1.5 77 3.0 78 2.5 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.249999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.075 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37106918238993 98.75 2 0.628930817610063 1.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.6625000000000001 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.0375 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.325 0.0 0.0 0.0 0.0 120-121 1.525 0.0 0.0 0.0 0.0 122-123 1.6875 0.0 0.0 0.0 0.0 124-125 1.8375 0.0 0.0 0.0 0.0 126-127 2.0125 0.0 0.0 0.0 0.0 128-129 2.425 0.0 0.0 0.0 0.0 130-131 2.7750000000000004 0.0 0.0 0.0 0.0 132-133 2.9375 0.0 0.0 0.0 0.0 134-135 3.1625 0.0 0.0 0.0 0.0 136-137 3.5 0.0 0.0 0.0 0.0 138-139 3.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGGTAA 10 0.0068378756 144.95 2 >>END_MODULE SRR6958326 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958326_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.039 33.0 33.0 34.0 32.0 34.0 2 33.13025 34.0 33.0 34.0 32.0 34.0 3 33.1675 34.0 33.0 34.0 33.0 34.0 4 33.216 34.0 33.0 34.0 33.0 34.0 5 33.114 34.0 33.0 34.0 33.0 34.0 6 37.2195 38.0 38.0 38.0 37.0 38.0 7 37.257 38.0 38.0 38.0 37.0 38.0 8 37.31575 38.0 38.0 38.0 37.0 38.0 9 37.1515 38.0 38.0 38.0 37.0 38.0 10-14 37.0951 38.0 38.0 38.0 36.4 38.0 15-19 37.11024999999999 38.0 38.0 38.0 36.6 38.0 20-24 37.15035 38.0 38.0 38.0 36.8 38.0 25-29 37.19845 38.0 38.0 38.0 37.0 38.0 30-34 37.30455 38.0 38.0 38.0 37.0 38.0 35-39 37.38125 38.0 38.0 38.0 37.6 38.0 40-44 37.42835 38.0 38.0 38.0 37.8 38.0 45-49 37.332100000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.22075 38.0 38.0 38.0 37.0 38.0 55-59 36.900999999999996 38.0 38.0 38.0 35.8 38.0 60-64 36.522949999999994 38.0 38.0 38.0 34.2 38.0 65-69 36.76205 38.0 38.0 38.0 35.4 38.0 70-74 36.94255 38.0 38.0 38.0 36.0 38.0 75-79 36.91395 38.0 38.0 38.0 35.8 38.0 80-84 36.70825000000001 38.0 38.0 38.0 35.0 38.0 85-89 36.5321 38.0 38.0 38.0 34.4 38.0 90-94 36.478750000000005 38.0 38.0 38.0 34.0 38.0 95-99 37.00750000000001 38.0 38.0 38.0 36.0 38.0 100-104 36.981700000000004 38.0 38.0 38.0 36.0 38.0 105-109 36.876 38.0 38.0 38.0 35.2 38.0 110-114 36.78015 38.0 38.0 38.0 35.4 38.0 115-119 36.516450000000006 38.0 38.0 38.0 34.4 38.0 120-124 36.24565 38.0 38.0 38.0 33.8 38.0 125-129 34.493249999999996 38.0 34.8 38.0 24.4 38.0 130-134 36.114 38.0 38.0 38.0 33.8 38.0 135-139 36.1975 38.0 38.0 38.0 34.0 38.0 140-144 36.03825 38.0 38.0 38.0 33.2 38.0 145-149 35.708800000000004 38.0 37.6 38.0 32.8 38.0 150-151 31.966625 35.5 33.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 2.0 5 1.0 6 0.0 7 1.0 8 1.0 9 1.0 10 1.0 11 2.0 12 0.0 13 1.0 14 1.0 15 0.0 16 2.0 17 4.0 18 2.0 19 3.0 20 3.0 21 3.0 22 4.0 23 3.0 24 8.0 25 12.0 26 11.0 27 12.0 28 27.0 29 21.0 30 36.0 31 45.0 32 62.0 33 79.0 34 124.0 35 214.0 36 457.0 37 2853.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.8 20.075000000000003 12.475 29.65 2 29.75 24.675 27.700000000000003 17.875 3 21.375 28.075 27.450000000000003 23.1 4 24.85 32.525 21.525 21.099999999999998 5 26.674999999999997 33.675 19.400000000000002 20.25 6 23.599999999999998 35.099999999999994 20.724999999999998 20.575 7 21.525 20.75 35.6 22.125 8 23.95 24.725 23.974999999999998 27.35 9 23.150000000000002 23.3 28.449999999999996 25.1 10-14 25.385 26.665 22.975 24.975 15-19 25.605 25.729999999999997 24.72 23.945 20-24 25.7 25.900000000000002 24.26 24.14 25-29 25.055 26.179999999999996 24.265 24.5 30-34 25.509999999999998 26.405 24.6 23.485 35-39 25.124999999999996 26.045 24.759999999999998 24.07 40-44 25.465 25.919999999999998 24.415 24.2 45-49 25.480000000000004 26.314999999999998 24.595 23.61 50-54 25.775 25.885 24.6 23.74 55-59 25.915 26.02 24.68 23.385 60-64 24.92 26.240000000000002 24.9 23.94 65-69 25.485000000000003 25.94 24.82 23.755000000000003 70-74 25.515 25.94 24.845 23.7 75-79 25.71 25.869999999999997 25.490000000000002 22.93 80-84 25.355 26.009999999999998 24.965 23.669999999999998 85-89 25.445 26.419999999999998 24.560000000000002 23.575 90-94 26.275 25.919999999999998 24.375 23.43 95-99 25.35 26.245 25.085 23.32 100-104 25.624999999999996 25.77 25.319999999999997 23.285 105-109 25.44 26.055 24.740000000000002 23.765 110-114 25.979999999999997 26.125 24.575 23.32 115-119 25.89 26.345000000000002 24.695 23.07 120-124 25.869999999999997 25.840000000000003 25.345000000000002 22.945 125-129 26.07 25.825 25.009999999999998 23.095 130-134 25.790000000000003 26.195 24.75 23.265 135-139 26.229999999999997 26.185000000000002 24.990000000000002 22.595000000000002 140-144 26.240000000000002 26.229999999999997 24.735 22.795 145-149 25.575 26.640000000000004 24.834999999999997 22.95 150-151 26.875 26.375 24.587500000000002 22.162499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 1.5 26 2.5 27 2.0 28 2.5 29 4.5 30 5.5 31 8.5 32 15.5 33 15.5 34 15.0 35 28.5 36 37.5 37 52.0 38 82.0 39 107.5 40 122.5 41 148.5 42 183.5 43 193.5 44 185.0 45 199.0 46 212.0 47 206.0 48 196.5 49 181.0 50 160.5 51 144.0 52 136.5 53 129.5 54 116.5 55 115.0 56 113.0 57 93.5 58 88.5 59 84.0 60 76.0 61 68.5 62 67.0 63 61.5 64 47.0 65 49.5 66 44.5 67 34.5 68 33.0 69 29.0 70 26.0 71 19.0 72 15.0 73 15.0 74 11.0 75 5.0 76 3.5 77 2.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11593836827481 98.1 2 0.7325082091437232 1.4500000000000002 3 0.15155342258145996 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.6625000000000001 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.0625 0.0 0.0 0.0 0.0 116-117 1.2 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.4875 0.0 0.0 0.0 0.0 122-123 1.6375 0.0 0.0 0.0 0.0 124-125 1.7625000000000002 0.0 0.0 0.0 0.0 126-127 1.95 0.0 0.0 0.0 0.0 128-129 2.35 0.0 0.0 0.0 0.0 130-131 2.6875 0.0 0.0 0.0 0.0 132-133 2.8375000000000004 0.0 0.0 0.0 0.0 134-135 3.075 0.0 0.0 0.0 0.0 136-137 3.425 0.0 0.0 0.0 0.0 138-139 3.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAGGC 10 0.006830828 145.0 6 CAAGGCC 10 0.006830828 145.0 7 >>END_MODULE Read 986834 spots for SRR6958326.sra Written 986834 spots for SRR6958326.sra Read 986834 spots for SRR6958326.sra Written 986834 spots for SRR6958326.sra Read 986834 spots for SRR6958326.sra Written 986834 spots for SRR6958326.sra Read 986834 spots for SRR6958326.sra Written 986834 spots for SRR6958326.sra Read 986834 spots for SRR6958326.sra Written 986834 spots for SRR6958326.sra Read 986834 spots for SRR6958326.sra Written 986834 spots for SRR6958326.sra Read 986834 spots for SRR6958326.sra Written 986834 spots for SRR6958326.sra Read 986834 spots for SRR6958326.sra Written 986834 spots for SRR6958326.sra Read 986834 spots for SRR6958326.sra Written 986834 spots for SRR6958326.sra Read 986834 spots for SRR6958326.sra Written 986834 spots for SRR6958326.sra Read 986834 spots for SRR6958326.sra Written 986834 spots for SRR6958326.sra Read 986834 spots for SRR6958326.sra Written 986834 spots for SRR6958326.sra Read 986834 spots for SRR6958326.sra Written 986834 spots for SRR6958326.sra Read 986834 spots for SRR6958326.sra Written 986834 spots for SRR6958326.sra Read 986838 spots for SRR6958326.sra Written 986838 spots for SRR6958326.sra Read 986834 spots for SRR6958326.sra Written 986834 spots for SRR6958326.sra Read 986834 spots for SRR6958326.sra Written 986834 spots for SRR6958326.sra Read 986834 spots for SRR6958326.sra Written 986834 spots for SRR6958326.sra Read 986834 spots for SRR6958326.sra Written 986834 spots for SRR6958326.sra Read 986834 spots for SRR6958326.sra Written 986834 spots for SRR6958326.sra SRR ids: ['SRR6958326.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p53tyh6g SRR6958326.sra spots: 19736684 blocks: [[1, 986834], [986835, 1973668], [1973669, 2960502], [2960503, 3947336], [3947337, 4934170], [4934171, 5921004], [5921005, 6907838], [6907839, 7894672], [7894673, 8881506], [8881507, 9868340], [9868341, 10855174], [10855175, 11842008], [11842009, 12828842], [12828843, 13815676], [13815677, 14802510], [14802511, 15789344], [15789345, 16776178], [16776179, 17763012], [17763013, 18749846], [18749847, 19736684]] SRR6958326 file size 6666414 SRR6958326 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958326 SRR6958326_1.fastq SRR6958326_2.fastq Input file: SRR6958326_1.fastq Paired file: SRR6958326_2.fastq trimmed: SRR6958326-trimmed-pair1.fastq, SRR6958326-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:56:59 2024 >> started Fri Dec 6 19:57:19 2024 >> done (19.699s) 19736684 read pairs processed; of these: 13810 ( 0.07%) short read pairs filtered out after trimming by size control 11595 ( 0.06%) empty read pairs filtered out after trimming by size control 19711279 (99.87%) read pairs available; of these: 5860081 (29.73%) trimmed read pairs available after processing 13851198 (70.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 5 0.00% 21 6 0.00% 22 2 0.00% 23 6 0.00% 24 7 0.00% 25 9 0.00% 26 8 0.00% 27 6 0.00% 28 8 0.00% 29 8 0.00% 30 3 0.00% 31 8 0.00% 32 3 0.00% 33 12 0.00% 34 8 0.00% 35 9 0.00% 36 14 0.00% 37 9 0.00% 38 13 0.00% 39 4 0.00% 40 11 0.00% 41 12 0.00% 42 20 0.00% 43 6 0.00% 44 16 0.00% 45 7 0.00% 46 21 0.00% 47 22 0.00% 48 27 0.00% 49 18 0.00% 50 22 0.00% 51 32 0.00% 52 39 0.00% 53 32 0.00% 54 41 0.00% 55 48 0.00% 56 39 0.00% 57 55 0.00% 58 90 0.00% 59 65 0.00% 60 88 0.00% 61 88 0.00% 62 128 0.00% 63 160 0.00% 64 158 0.00% 65 182 0.00% 66 184 0.00% 67 201 0.00% 68 252 0.00% 69 294 0.00% 70 305 0.00% 71 373 0.00% 72 474 0.00% 73 491 0.00% 74 588 0.00% 75 630 0.00% 76 729 0.00% 77 780 0.00% 78 845 0.00% 79 952 0.00% 80 1099 0.01% 81 1286 0.01% 82 1642 0.01% 83 1749 0.01% 84 2506 0.01% 85 3063 0.02% 86 3161 0.02% 87 3256 0.02% 88 3546 0.02% 89 3806 0.02% 90 3956 0.02% 91 4387 0.02% 92 4583 0.02% 93 5119 0.03% 94 5637 0.03% 95 5995 0.03% 96 6434 0.03% 97 6586 0.03% 98 6964 0.04% 99 7509 0.04% 100 7821 0.04% 101 8495 0.04% 102 9151 0.05% 103 9828 0.05% 104 10454 0.05% 105 11195 0.06% 106 11772 0.06% 107 12225 0.06% 108 12709 0.06% 109 13281 0.07% 110 13873 0.07% 111 14452 0.07% 112 15452 0.08% 113 16597 0.08% 114 17711 0.09% 115 18971 0.10% 116 19862 0.10% 117 20250 0.10% 118 20635 0.10% 119 21351 0.11% 120 22289 0.11% 121 22586 0.11% 122 24012 0.12% 123 25566 0.13% 124 26863 0.14% 125 28598 0.15% 126 29657 0.15% 127 30634 0.16% 128 31558 0.16% 129 32541 0.17% 130 33270 0.17% 131 35045 0.18% 132 36330 0.18% 133 38458 0.20% 134 40777 0.21% 135 43124 0.22% 136 45251 0.23% 137 47147 0.24% 138 49298 0.25% 139 52412 0.27% 140 54623 0.28% 141 58242 0.30% 142 64068 0.33% 143 70711 0.36% 144 79036 0.40% 145 92888 0.47% 146 111042 0.56% 147 143209 0.73% 148 211390 1.07% 149 419809 2.13% 150 3482597 17.67% 151 13851198 70.27% 19711279 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=23 prefix-density=0.67 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=240.34 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=11.6 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=21 prefix-density=0.48 prefix-fanout=2.6 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=26.66 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=3.6 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958326 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:58:03 Started mapping on | Dec 06 19:58:03 Finished on | Dec 06 20:00:21 Mapping speed, Million of reads per hour | 514.21 Number of input reads | 19711279 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 18597551 Uniquely mapped reads % | 94.35% Average mapped length | 297.24 Number of splices: Total | 21897251 Number of splices: Annotated (sjdb) | 20619628 Number of splices: GT/AG | 21588641 Number of splices: GC/AG | 259549 Number of splices: AT/AC | 8235 Number of splices: Non-canonical | 40826 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 332666 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 44425 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.32% % of reads unmapped: other | 1.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 790072 790072 790072 N_multimapping 332666 332666 332666 N_noFeature 752983 18065894 894467 N_ambiguous 461809 2250 72283 UnstrandedReadsAssigned:17382759 PositiveStrandReadsAssigned:529407 NegativeStrandReadsAssigned:17630801 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6958326 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958326-trimmed-pair1.fastq SRR6958326-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,711,279 reads, 17,667,326 reads pseudoaligned [quant] estimated average fragment length: 275.815 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52973 SRR6958326.ke.tsv 35125 SRR6958326.se.tsv 88098 total ==> SRR6958326.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 661.901 0 0 PNS24247 1044 769.185 60.6674 6.61084 PNS24249 1928 1653.19 40.2115 2.03874 PNS24246 1044 769.185 60.6674 6.61084 PNS24248 1044 769.185 60.6674 6.61084 PNS24244 1471 1196.19 29.7862 2.08712 PNS24243 293 84.5524 0 0 KQK14069 1603 1328.19 4470.29 282.104 KQK14071 474 222.371 70.0364 26.3984 ==> SRR6958326.se.tsv <== BRADI_1g14170v3 5201 BRADI_1g53295v3 1034 BRADI_1g59795v3 93 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 337 BRADI_1g74790v3 75 BRADI_1g09890v3 0 BRADI_1g77505v3 274 BRADI_1g48960v3 0 SRR6958326 completed mapping pipeline successfully