Starting /dee2/code/volunteer_pipeline.sh SRR6958327 current disk space = 1549561696256 free memory = 1602801276 SRR6958327 SRAfilesize e88055c8cb08084ead36467da718803e SRR6958327.sra SRR6958327.sra file validated SRR6958327 is paired end SRR6958327 is conventional basespace SRR6958327 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958327_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.1145 18.0 18.0 18.0 18.0 32.0 2 20.9055 18.0 18.0 25.0 18.0 29.0 3 25.5565 27.0 25.0 29.0 18.0 31.0 4 29.933 32.0 27.0 32.0 27.0 33.0 5 30.6425 32.0 31.0 33.0 27.0 33.0 6 35.6285 37.0 35.0 38.0 31.0 38.0 7 36.56575 38.0 37.0 38.0 34.0 38.0 8 36.99625 38.0 38.0 38.0 35.0 38.0 9 37.12825 38.0 38.0 38.0 36.0 38.0 10-14 37.25575 38.0 38.0 38.0 36.4 38.0 15-19 37.33225 38.0 38.0 38.0 37.0 38.0 20-24 37.36879999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.2731 38.0 38.0 38.0 36.6 38.0 30-34 37.1571 38.0 38.0 38.0 36.4 38.0 35-39 36.9696 38.0 38.0 38.0 36.0 38.0 40-44 36.9964 38.0 38.0 38.0 35.8 38.0 45-49 37.0655 38.0 38.0 38.0 36.0 38.0 50-54 36.9756 38.0 38.0 38.0 35.4 38.0 55-59 36.8341 38.0 38.0 38.0 35.0 38.0 60-64 36.88335000000001 38.0 38.0 38.0 35.0 38.0 65-69 36.87035 38.0 38.0 38.0 35.2 38.0 70-74 36.87115 38.0 38.0 38.0 35.2 38.0 75-79 36.60815 38.0 38.0 38.0 34.0 38.0 80-84 36.346799999999995 38.0 37.6 38.0 33.8 38.0 85-89 36.3143 38.0 37.4 38.0 33.4 38.0 90-94 36.393899999999995 38.0 37.4 38.0 33.8 38.0 95-99 36.37695 38.0 37.6 38.0 33.8 38.0 100-104 36.0428 38.0 37.0 38.0 33.0 38.0 105-109 35.69285 38.0 36.2 38.0 30.6 38.0 110-114 35.58125 38.0 36.0 38.0 30.6 38.0 115-119 35.54835 38.0 36.0 38.0 30.6 38.0 120-124 35.3498 38.0 35.6 38.0 29.8 38.0 125-129 34.8327 38.0 35.0 38.0 27.2 38.0 130-134 34.6279 38.0 35.0 38.0 26.6 38.0 135-139 34.3266 38.0 34.2 38.0 25.0 38.0 140-144 34.02185 38.0 34.6 38.0 23.2 38.0 145-149 32.82985 38.0 33.4 38.0 15.6 38.0 150-151 27.816875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 3.0 20 3.0 21 3.0 22 3.0 23 7.0 24 22.0 25 12.0 26 21.0 27 26.0 28 31.0 29 38.0 30 63.0 31 99.0 32 99.0 33 173.0 34 284.0 35 460.0 36 1118.0 37 1532.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 17.316017316017316 25.00636618283677 6.0606060606060606 51.61701044053986 2 17.299999999999997 21.25 26.3 35.15 3 18.05 15.825 24.7 41.425 4 24.675 21.6 21.775 31.95 5 26.05 27.55 23.05 23.35 6 23.125 33.175 23.075000000000003 20.625 7 17.849999999999998 24.725 38.175 19.25 8 19.5 25.3 29.775000000000002 25.424999999999997 9 20.225 21.65 33.050000000000004 25.074999999999996 10-14 21.9 27.155 26.590000000000003 24.355 15-19 22.555 26.064999999999998 26.025 25.355 20-24 22.325 25.655 26.205000000000002 25.814999999999998 25-29 22.535 25.740000000000002 26.43 25.295 30-34 22.415 25.629999999999995 26.314999999999998 25.64 35-39 22.745 25.729999999999997 25.94 25.585 40-44 22.345000000000002 26.6 25.814999999999998 25.240000000000002 45-49 22.67 26.265 25.965 25.1 50-54 22.27 25.85 26.534999999999997 25.345000000000002 55-59 22.605 25.955000000000002 25.86 25.580000000000002 60-64 22.235 25.605 26.43 25.729999999999997 65-69 22.495 25.929999999999996 26.295 25.28 70-74 23.185 25.230000000000004 25.895000000000003 25.69 75-79 22.28 25.474999999999998 26.05 26.195 80-84 22.68 25.71 26.375 25.235000000000003 85-89 22.68 25.900000000000002 26.095000000000002 25.324999999999996 90-94 22.755 25.580000000000002 26.369999999999997 25.295 95-99 22.665 25.72 26.279999999999998 25.335 100-104 23.080000000000002 25.590000000000003 26.3 25.03 105-109 23.23 25.055 26.179999999999996 25.535000000000004 110-114 22.915 25.96 25.945 25.180000000000003 115-119 23.294999999999998 25.91 25.855 24.94 120-124 22.830000000000002 25.28 26.27 25.619999999999997 125-129 22.705000000000002 25.415 26.405 25.474999999999998 130-134 23.115 25.895000000000003 25.85 25.14 135-139 22.945 25.36 26.025 25.669999999999998 140-144 23.044999999999998 25.490000000000002 26.255 25.21 145-149 22.99 25.185000000000002 26.245 25.580000000000002 150-151 23.427928491061383 24.553069133641706 26.31578947368421 25.703212901612705 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 0.0 27 1.5 28 5.5 29 6.5 30 8.0 31 9.0 32 9.0 33 21.0 34 27.5 35 40.0 36 50.5 37 66.5 38 90.5 39 112.5 40 140.5 41 168.5 42 194.0 43 203.5 44 207.5 45 219.0 46 223.0 47 217.5 48 214.0 49 184.5 50 157.0 51 146.5 52 131.5 53 125.0 54 115.5 55 97.5 56 84.0 57 83.0 58 74.5 59 64.0 60 66.0 61 61.5 62 60.0 63 50.0 64 43.5 65 44.5 66 31.5 67 24.5 68 26.0 69 21.5 70 17.5 71 16.5 72 14.5 73 9.0 74 4.0 75 3.5 76 2.5 77 1.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32024169184291 98.625 2 0.6545820745216516 1.3 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.5375000000000001 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.8125 0.0 0.0 0.0 0.0 126-127 0.9125 0.0 0.0 0.0 0.0 128-129 1.0375 0.0 0.0 0.0 0.0 130-131 1.1 0.0 0.0 0.0 0.0 132-133 1.2999999999999998 0.0 0.0 0.0 0.0 134-135 1.4875 0.0 0.0 0.0 0.0 136-137 1.7 0.0 0.0 0.0 0.0 138-139 1.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958327 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958327_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77925 33.0 33.0 34.0 32.0 34.0 2 32.89075 33.0 33.0 34.0 32.0 34.0 3 32.8855 34.0 33.0 34.0 32.0 34.0 4 32.897 34.0 33.0 34.0 32.0 34.0 5 32.89375 34.0 33.0 34.0 32.0 34.0 6 37.04875 38.0 38.0 38.0 36.0 38.0 7 36.878 38.0 38.0 38.0 36.0 38.0 8 36.819 38.0 38.0 38.0 35.0 38.0 9 36.86725 38.0 38.0 38.0 35.0 38.0 10-14 36.841300000000004 38.0 38.0 38.0 35.2 38.0 15-19 36.853300000000004 38.0 38.0 38.0 35.2 38.0 20-24 36.826 38.0 38.0 38.0 35.4 38.0 25-29 36.880750000000006 38.0 38.0 38.0 35.8 38.0 30-34 36.8476 38.0 38.0 38.0 35.4 38.0 35-39 36.84625 38.0 38.0 38.0 35.6 38.0 40-44 36.7435 38.0 38.0 38.0 35.0 38.0 45-49 36.74625 38.0 38.0 38.0 35.0 38.0 50-54 36.694100000000006 38.0 38.0 38.0 34.8 38.0 55-59 36.68105 38.0 38.0 38.0 34.8 38.0 60-64 36.706250000000004 38.0 38.0 38.0 34.6 38.0 65-69 36.50695 38.0 38.0 38.0 34.2 38.0 70-74 36.44925 38.0 38.0 38.0 34.0 38.0 75-79 36.19065 38.0 37.6 38.0 33.0 38.0 80-84 36.024800000000006 38.0 37.6 38.0 32.4 38.0 85-89 35.9037 38.0 37.0 38.0 32.0 38.0 90-94 35.93235 38.0 37.0 38.0 32.2 38.0 95-99 35.724900000000005 38.0 37.0 38.0 31.2 38.0 100-104 35.6012 38.0 36.8 38.0 31.0 38.0 105-109 35.45525 38.0 36.2 38.0 30.4 38.0 110-114 35.190749999999994 38.0 36.0 38.0 28.8 38.0 115-119 34.79175 38.0 35.0 38.0 26.8 38.0 120-124 34.7265 38.0 35.0 38.0 27.2 38.0 125-129 34.4902 38.0 35.0 38.0 26.0 38.0 130-134 33.894349999999996 38.0 34.2 38.0 22.6 38.0 135-139 33.5098 38.0 34.0 38.0 19.0 38.0 140-144 33.2054 38.0 33.6 38.0 19.4 38.0 145-149 32.071299999999994 38.0 31.6 38.0 13.2 38.0 150-151 27.289250000000003 34.5 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 0.0 5 1.0 6 2.0 7 1.0 8 1.0 9 1.0 10 2.0 11 3.0 12 3.0 13 2.0 14 1.0 15 3.0 16 4.0 17 4.0 18 7.0 19 7.0 20 6.0 21 7.0 22 9.0 23 16.0 24 24.0 25 22.0 26 33.0 27 32.0 28 31.0 29 36.0 30 71.0 31 92.0 32 108.0 33 167.0 34 219.0 35 369.0 36 786.0 37 1927.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.65 18.099999999999998 13.950000000000001 37.3 2 29.582395598899723 22.655663915978995 28.132033008252062 19.629907476869217 3 21.930482620655166 25.331332833208304 29.582395598899723 23.15578894723681 4 25.131282820705174 28.582145536384097 21.230307576894223 25.056264066016503 5 26.988494247123562 32.96648324162081 20.735367683841922 19.30965482741371 6 22.45 36.875 21.0 19.675 7 21.95 20.275000000000002 35.3 22.475 8 24.375 23.425 25.900000000000002 26.3 9 23.925 23.375 27.750000000000004 24.95 10-14 25.665 26.540000000000003 23.65 24.145 15-19 25.22 26.05 25.195 23.535 20-24 24.82 26.1 24.834999999999997 24.245 25-29 25.86 25.215 25.285000000000004 23.64 30-34 25.4 26.02 24.740000000000002 23.84 35-39 25.25 26.665 24.415 23.669999999999998 40-44 25.224999999999998 26.169999999999998 24.605 24.0 45-49 25.03 25.915 24.834999999999997 24.22 50-54 25.814999999999998 26.455000000000002 24.755 22.975 55-59 25.27 25.840000000000003 25.095 23.794999999999998 60-64 25.395 26.63 24.7 23.275000000000002 65-69 25.35 26.36 24.69 23.599999999999998 70-74 25.555 25.014999999999997 25.34 24.09 75-79 25.035 26.085 25.05 23.830000000000002 80-84 25.56 26.115 24.825 23.5 85-89 25.355 25.319999999999997 25.240000000000002 24.085 90-94 25.71 26.040000000000003 25.28 22.97 95-99 25.335 26.19 25.019999999999996 23.455000000000002 100-104 25.924999999999997 25.869999999999997 24.81 23.395 105-109 25.259999999999998 26.205000000000002 25.15 23.385 110-114 25.785000000000004 25.615 25.095 23.505000000000003 115-119 25.53 25.785000000000004 25.235000000000003 23.45 120-124 25.61 25.755 25.15 23.485 125-129 25.66 26.72 24.54 23.080000000000002 130-134 26.279999999999998 26.08 24.895 22.745 135-139 25.624999999999996 26.21 25.345000000000002 22.82 140-144 25.974999999999998 26.36 25.245 22.42 145-149 26.19 25.874999999999996 25.509999999999998 22.425 150-151 25.4 26.125 25.7 22.775000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.5 27 2.5 28 5.5 29 7.5 30 7.0 31 13.0 32 17.0 33 20.0 34 25.5 35 31.0 36 47.5 37 59.0 38 81.0 39 105.0 40 117.5 41 150.0 42 178.0 43 188.0 44 208.5 45 221.5 46 213.0 47 201.5 48 195.5 49 175.5 50 157.0 51 140.5 52 118.5 53 114.0 54 104.5 55 94.0 56 86.0 57 81.5 58 87.0 59 92.0 60 87.0 61 69.5 62 61.0 63 65.5 64 65.0 65 50.5 66 42.0 67 45.0 68 39.5 69 33.5 70 25.5 71 22.0 72 18.0 73 8.0 74 7.0 75 5.5 76 2.0 77 2.5 78 3.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.025 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34541792547836 98.65 2 0.6042296072507553 1.2 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.3125 0.0 0.0 0.0 0.0 118-119 0.4375 0.0 0.0 0.0 0.0 120-121 0.5125 0.0 0.0 0.0 0.0 122-123 0.6625 0.0 0.0 0.0 0.0 124-125 0.8 0.0 0.0 0.0 0.0 126-127 0.9125 0.0 0.0 0.0 0.0 128-129 1.0375 0.0 0.0 0.0 0.0 130-131 1.0875 0.0 0.0 0.0 0.0 132-133 1.275 0.0 0.0 0.0 0.0 134-135 1.45 0.0 0.0 0.0 0.0 136-137 1.65 0.0 0.0 0.0 0.0 138-139 1.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACAAGC 10 0.006830828 145.0 6 ACACAAG 10 0.006830828 145.0 5 >>END_MODULE Read 1137211 spots for SRR6958327.sra Written 1137211 spots for SRR6958327.sra Read 1137211 spots for SRR6958327.sra Written 1137211 spots for SRR6958327.sra Read 1137211 spots for SRR6958327.sra Written 1137211 spots for SRR6958327.sra Read 1137211 spots for SRR6958327.sra Written 1137211 spots for SRR6958327.sra Read 1137211 spots for SRR6958327.sra Written 1137211 spots for SRR6958327.sra Read 1137211 spots for SRR6958327.sra Written 1137211 spots for SRR6958327.sra Read 1137211 spots for SRR6958327.sra Written 1137211 spots for SRR6958327.sra Read 1137211 spots for SRR6958327.sra Written 1137211 spots for SRR6958327.sra Read 1137211 spots for SRR6958327.sra Written 1137211 spots for SRR6958327.sra Read 1137219 spots for SRR6958327.sra Written 1137219 spots for SRR6958327.sra Read 1137211 spots for SRR6958327.sra Written 1137211 spots for SRR6958327.sra Read 1137211 spots for SRR6958327.sra Written 1137211 spots for SRR6958327.sra Read 1137211 spots for SRR6958327.sra Written 1137211 spots for SRR6958327.sra Read 1137211 spots for SRR6958327.sra Written 1137211 spots for SRR6958327.sra Read 1137211 spots for SRR6958327.sra Written 1137211 spots for SRR6958327.sra Read 1137211 spots for SRR6958327.sra Written 1137211 spots for SRR6958327.sra Read 1137211 spots for SRR6958327.sra Written 1137211 spots for SRR6958327.sra Read 1137211 spots for SRR6958327.sra Written 1137211 spots for SRR6958327.sra Read 1137211 spots for SRR6958327.sra Written 1137211 spots for SRR6958327.sra Read 1137211 spots for SRR6958327.sra Written 1137211 spots for SRR6958327.sra SRR ids: ['SRR6958327.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6mx9xzji SRR6958327.sra spots: 22744228 blocks: [[1, 1137211], [1137212, 2274422], [2274423, 3411633], [3411634, 4548844], [4548845, 5686055], [5686056, 6823266], [6823267, 7960477], [7960478, 9097688], [9097689, 10234899], [10234900, 11372110], [11372111, 12509321], [12509322, 13646532], [13646533, 14783743], [14783744, 15920954], [15920955, 17058165], [17058166, 18195376], [18195377, 19332587], [19332588, 20469798], [20469799, 21607009], [21607010, 22744228]] SRR6958327 file size 7685572 SRR6958327 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958327 SRR6958327_1.fastq SRR6958327_2.fastq Input file: SRR6958327_1.fastq Paired file: SRR6958327_2.fastq trimmed: SRR6958327-trimmed-pair1.fastq, SRR6958327-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:58:51 2024 >> started Fri Dec 6 19:59:20 2024 >> done (29.339s) 22744228 read pairs processed; of these: 13561 ( 0.06%) short read pairs filtered out after trimming by size control 9782 ( 0.04%) empty read pairs filtered out after trimming by size control 22720885 (99.90%) read pairs available; of these: 8183377 (36.02%) trimmed read pairs available after processing 14537508 (63.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 8 0.00% 20 7 0.00% 21 6 0.00% 22 9 0.00% 23 4 0.00% 24 11 0.00% 25 8 0.00% 26 5 0.00% 27 8 0.00% 28 8 0.00% 29 5 0.00% 30 3 0.00% 31 7 0.00% 32 11 0.00% 33 10 0.00% 34 11 0.00% 35 15 0.00% 36 6 0.00% 37 10 0.00% 38 14 0.00% 39 14 0.00% 40 14 0.00% 41 14 0.00% 42 17 0.00% 43 14 0.00% 44 21 0.00% 45 21 0.00% 46 23 0.00% 47 17 0.00% 48 33 0.00% 49 29 0.00% 50 29 0.00% 51 25 0.00% 52 38 0.00% 53 40 0.00% 54 43 0.00% 55 59 0.00% 56 58 0.00% 57 64 0.00% 58 80 0.00% 59 88 0.00% 60 83 0.00% 61 107 0.00% 62 118 0.00% 63 125 0.00% 64 146 0.00% 65 165 0.00% 66 189 0.00% 67 202 0.00% 68 218 0.00% 69 252 0.00% 70 274 0.00% 71 318 0.00% 72 324 0.00% 73 370 0.00% 74 468 0.00% 75 483 0.00% 76 526 0.00% 77 589 0.00% 78 666 0.00% 79 731 0.00% 80 863 0.00% 81 921 0.00% 82 1085 0.00% 83 1243 0.01% 84 1907 0.01% 85 2296 0.01% 86 2331 0.01% 87 2531 0.01% 88 2741 0.01% 89 2874 0.01% 90 3004 0.01% 91 3188 0.01% 92 3474 0.02% 93 3687 0.02% 94 3921 0.02% 95 4204 0.02% 96 4459 0.02% 97 4880 0.02% 98 5164 0.02% 99 5648 0.02% 100 5916 0.03% 101 6288 0.03% 102 6674 0.03% 103 7196 0.03% 104 7501 0.03% 105 8117 0.04% 106 8617 0.04% 107 9396 0.04% 108 9950 0.04% 109 10766 0.05% 110 11220 0.05% 111 11821 0.05% 112 12477 0.05% 113 13520 0.06% 114 14251 0.06% 115 15201 0.07% 116 16306 0.07% 117 17245 0.08% 118 18639 0.08% 119 19531 0.09% 120 20204 0.09% 121 21490 0.09% 122 22522 0.10% 123 23637 0.10% 124 25290 0.11% 125 26726 0.12% 126 28297 0.12% 127 29918 0.13% 128 31666 0.14% 129 33514 0.15% 130 35778 0.16% 131 38145 0.17% 132 40800 0.18% 133 43466 0.19% 134 46056 0.20% 135 49619 0.22% 136 53360 0.23% 137 57703 0.25% 138 62250 0.27% 139 67261 0.30% 140 73770 0.32% 141 81259 0.36% 142 91120 0.40% 143 104359 0.46% 144 122891 0.54% 145 148387 0.65% 146 189133 0.83% 147 259251 1.14% 148 407033 1.79% 149 834293 3.67% 150 4815861 21.20% 151 14537508 63.98% 22720885 reads passed initial QC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=17 prefix-density=0.86 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=132.16 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=7.8 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=16 prefix-density=0.61 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=63.56 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.1 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958327 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:00:10 Started mapping on | Dec 06 20:00:10 Finished on | Dec 06 20:02:36 Mapping speed, Million of reads per hour | 560.24 Number of input reads | 22720885 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 22187044 Uniquely mapped reads % | 97.65% Average mapped length | 297.84 Number of splices: Total | 26324513 Number of splices: Annotated (sjdb) | 24818794 Number of splices: GT/AG | 25979244 Number of splices: GC/AG | 305145 Number of splices: AT/AC | 10042 Number of splices: Non-canonical | 30082 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.41 Insertion rate per base | 0.01% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 197016 % of reads mapped to multiple loci | 0.87% Number of reads mapped to too many loci | 15017 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.97% % of reads unmapped: other | 0.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 344231 344231 344231 N_multimapping 197016 197016 197016 N_noFeature 769652 21530660 970616 N_ambiguous 549472 3101 96124 UnstrandedReadsAssigned:20867920 PositiveStrandReadsAssigned:653283 NegativeStrandReadsAssigned:21120304 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958327 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958327-trimmed-pair1.fastq SRR6958327-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,720,885 reads, 21,123,491 reads pseudoaligned [quant] estimated average fragment length: 278.897 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,197 rounds 52973 SRR6958327.ke.tsv 35125 SRR6958327.se.tsv 88098 total ==> SRR6958327.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 658.644 0 0 PNS24247 1044 766.103 76.0544 7.0642 PNS24249 1928 1650.1 35.4811 1.53007 PNS24246 1044 766.103 76.0544 7.0642 PNS24248 1044 766.103 76.0544 7.0642 PNS24244 1471 1193.1 36.3559 2.16832 PNS24243 293 76.2902 0 0 KQK14069 1603 1325.1 7384.52 396.551 KQK14071 474 213.489 70.94 23.6451 ==> SRR6958327.se.tsv <== BRADI_1g14170v3 8158 BRADI_1g53295v3 242 BRADI_1g59795v3 249 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 224 BRADI_1g74790v3 102 BRADI_1g09890v3 0 BRADI_1g77505v3 273 BRADI_1g48960v3 0 SRR6958327 completed mapping pipeline successfully