Starting /dee2/code/volunteer_pipeline.sh SRR6958328 current disk space = 1549549006848 free memory = 1427792888 SRR6958328 SRAfilesize 851b4a4c67083a0ad70129b82c06f7df SRR6958328.sra SRR6958328.sra file validated SRR6958328 is paired end SRR6958328 is conventional basespace SRR6958328 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958328_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.65375 18.0 18.0 25.0 18.0 32.0 2 20.72675 18.0 18.0 25.0 18.0 29.0 3 27.14575 27.0 27.0 29.0 25.0 31.0 4 28.7055 32.0 27.0 32.0 15.0 33.0 5 31.221 32.0 32.0 33.0 27.0 33.0 6 35.81375 37.0 36.0 38.0 33.0 38.0 7 36.59475 38.0 37.0 38.0 34.0 38.0 8 37.14825 38.0 38.0 38.0 36.0 38.0 9 37.3495 38.0 38.0 38.0 37.0 38.0 10-14 37.39595 38.0 38.0 38.0 37.0 38.0 15-19 37.38975000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.50680000000001 38.0 38.0 38.0 37.4 38.0 25-29 37.376 38.0 38.0 38.0 37.0 38.0 30-34 37.3226 38.0 38.0 38.0 37.0 38.0 35-39 37.150400000000005 38.0 38.0 38.0 36.4 38.0 40-44 37.11935 38.0 38.0 38.0 36.0 38.0 45-49 37.20235 38.0 38.0 38.0 36.2 38.0 50-54 37.0052 38.0 38.0 38.0 35.6 38.0 55-59 36.9098 38.0 38.0 38.0 35.4 38.0 60-64 36.93685 38.0 38.0 38.0 35.4 38.0 65-69 37.005449999999996 38.0 38.0 38.0 35.2 38.0 70-74 37.0125 38.0 38.0 38.0 35.6 38.0 75-79 36.85955 38.0 38.0 38.0 35.0 38.0 80-84 36.5847 38.0 38.0 38.0 34.2 38.0 85-89 36.463849999999994 38.0 38.0 38.0 33.8 38.0 90-94 36.57145 38.0 38.0 38.0 34.0 38.0 95-99 36.562949999999994 38.0 38.0 38.0 34.2 38.0 100-104 36.421200000000006 38.0 38.0 38.0 34.0 38.0 105-109 36.22005 38.0 37.0 38.0 33.4 38.0 110-114 35.9594 38.0 37.0 38.0 32.8 38.0 115-119 35.8697 38.0 36.4 38.0 31.8 38.0 120-124 35.555249999999994 38.0 36.0 38.0 30.6 38.0 125-129 35.44195 38.0 35.8 38.0 31.0 38.0 130-134 35.30145 38.0 35.4 38.0 30.0 38.0 135-139 34.979350000000004 38.0 35.0 38.0 28.2 38.0 140-144 34.58645 38.0 35.0 38.0 27.2 38.0 145-149 33.846050000000005 38.0 34.4 38.0 22.4 38.0 150-151 29.968375 36.0 27.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 1.0 18 0.0 19 2.0 20 2.0 21 5.0 22 4.0 23 3.0 24 8.0 25 11.0 26 5.0 27 17.0 28 28.0 29 41.0 30 49.0 31 69.0 32 95.0 33 142.0 34 231.0 35 444.0 36 1064.0 37 1777.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 18.678526048284624 22.312579415501908 7.9796696315120705 51.0292249047014 2 16.125 21.625 25.650000000000002 36.6 3 17.349999999999998 15.299999999999999 25.124999999999996 42.225 4 23.925 20.775 20.625 34.675 5 25.775 26.474999999999998 25.35 22.400000000000002 6 25.424999999999997 30.375000000000004 21.875 22.325 7 17.9 26.3 37.574999999999996 18.224999999999998 8 20.8 23.9 29.425 25.874999999999996 9 20.724999999999998 22.0 32.4 24.875 10-14 22.8 25.96 25.795 25.445 15-19 22.945 24.25 26.595000000000002 26.21 20-24 23.01 25.145 26.215 25.629999999999995 25-29 23.415 25.165 25.765 25.655 30-34 23.685000000000002 25.145 25.419999999999998 25.75 35-39 22.93 25.564999999999998 25.46 26.045 40-44 23.36 25.255 25.205 26.179999999999996 45-49 22.935 24.5 26.27 26.295 50-54 23.215 25.19 25.435000000000002 26.16 55-59 23.07 24.82 26.185000000000002 25.924999999999997 60-64 23.32 24.575 25.75 26.355 65-69 23.49 25.085 25.505 25.919999999999998 70-74 23.474999999999998 25.224999999999998 25.36 25.94 75-79 23.685000000000002 24.740000000000002 25.66 25.915 80-84 23.365 25.019999999999996 25.590000000000003 26.025 85-89 23.974999999999998 24.095 25.86 26.07 90-94 23.995 24.23 25.985000000000003 25.790000000000003 95-99 23.62 24.665 25.355 26.36 100-104 24.335 24.66 25.564999999999998 25.44 105-109 23.97 24.490000000000002 25.485000000000003 26.055 110-114 24.3 24.43 25.72 25.55 115-119 24.085 24.46 25.215 26.240000000000002 120-124 23.419999999999998 24.834999999999997 25.46 26.284999999999997 125-129 24.415 24.310000000000002 25.474999999999998 25.8 130-134 24.365000000000002 24.23 25.365 26.040000000000003 135-139 23.575 25.130000000000003 25.495 25.8 140-144 24.63 25.105 24.54 25.724999999999998 145-149 24.834999999999997 24.505 24.67 25.990000000000002 150-151 24.534200325121923 24.959359759909965 24.759284731774414 25.747155183193698 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 4.5 29 4.0 30 1.5 31 6.5 32 10.0 33 13.0 34 17.0 35 24.5 36 38.5 37 54.5 38 74.0 39 103.5 40 134.0 41 154.5 42 173.5 43 185.0 44 196.0 45 204.0 46 215.0 47 222.0 48 210.5 49 187.0 50 169.0 51 149.0 52 127.0 53 112.0 54 92.0 55 95.5 56 112.0 57 94.5 58 72.0 59 74.5 60 73.0 61 66.5 62 63.5 63 57.5 64 60.5 65 56.5 66 44.0 67 40.0 68 30.5 69 31.5 70 34.5 71 26.5 72 22.0 73 20.5 74 15.0 75 10.5 76 5.5 77 3.0 78 3.5 79 1.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.4777470455116922 0.95 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.42500000000000004 0.0 0.0 0.0 0.0 110-111 0.4875 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.6625000000000001 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 1.1375000000000002 0.0 0.0 0.0 0.0 122-123 1.3 0.0 0.0 0.0 0.0 124-125 1.5375 0.0 0.0 0.0 0.0 126-127 1.775 0.0 0.0 0.0 0.0 128-129 2.0125 0.0 0.0 0.0 0.0 130-131 2.2 0.0 0.0 0.0 0.0 132-133 2.3375 0.0 0.0 0.0 0.0 134-135 2.625 0.0 0.0 0.0 0.0 136-137 2.9125 0.0 0.0 0.0 0.0 138-139 3.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958328 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958328_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86625 33.0 33.0 34.0 32.0 34.0 2 32.855 33.0 33.0 34.0 32.0 34.0 3 32.847 34.0 33.0 34.0 32.0 34.0 4 32.92625 34.0 33.0 34.0 32.0 34.0 5 32.78325 34.0 33.0 34.0 32.0 34.0 6 36.9715 38.0 38.0 38.0 36.0 38.0 7 36.9875 38.0 38.0 38.0 36.0 38.0 8 36.88975 38.0 38.0 38.0 36.0 38.0 9 36.8805 38.0 38.0 38.0 36.0 38.0 10-14 36.89235 38.0 38.0 38.0 35.6 38.0 15-19 36.848 38.0 38.0 38.0 35.6 38.0 20-24 36.87095 38.0 38.0 38.0 35.6 38.0 25-29 36.876549999999995 38.0 38.0 38.0 36.0 38.0 30-34 36.9067 38.0 38.0 38.0 36.0 38.0 35-39 36.9222 38.0 38.0 38.0 36.0 38.0 40-44 36.849149999999995 38.0 38.0 38.0 35.4 38.0 45-49 36.794599999999996 38.0 38.0 38.0 35.6 38.0 50-54 36.6629 38.0 38.0 38.0 35.0 38.0 55-59 36.699799999999996 38.0 38.0 38.0 35.0 38.0 60-64 36.634 38.0 38.0 38.0 34.6 38.0 65-69 36.5593 38.0 38.0 38.0 34.6 38.0 70-74 36.42095 38.0 38.0 38.0 34.2 38.0 75-79 36.26690000000001 38.0 38.0 38.0 33.8 38.0 80-84 36.09765 38.0 38.0 38.0 32.8 38.0 85-89 36.05925 38.0 37.6 38.0 33.2 38.0 90-94 35.94835 38.0 37.8 38.0 32.8 38.0 95-99 35.816500000000005 38.0 37.0 38.0 31.8 38.0 100-104 35.671549999999996 38.0 36.6 38.0 31.4 38.0 105-109 35.593 38.0 36.8 38.0 31.0 38.0 110-114 35.315 38.0 36.0 38.0 29.2 38.0 115-119 35.07340000000001 38.0 35.8 38.0 28.0 38.0 120-124 35.1231 38.0 35.8 38.0 28.2 38.0 125-129 34.90305 38.0 35.4 38.0 28.0 38.0 130-134 34.5629 38.0 35.0 38.0 25.8 38.0 135-139 33.92215 38.0 34.2 38.0 22.8 38.0 140-144 33.74525 38.0 34.0 38.0 22.6 38.0 145-149 32.7238 38.0 33.2 38.0 16.4 38.0 150-151 27.498125 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 1.0 4 4.0 5 1.0 6 1.0 7 2.0 8 1.0 9 1.0 10 3.0 11 3.0 12 1.0 13 3.0 14 2.0 15 3.0 16 3.0 17 1.0 18 2.0 19 5.0 20 5.0 21 5.0 22 5.0 23 14.0 24 14.0 25 19.0 26 25.0 27 31.0 28 36.0 29 52.0 30 52.0 31 73.0 32 115.0 33 134.0 34 213.0 35 326.0 36 697.0 37 2138.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.324999999999996 17.025000000000002 12.825000000000001 36.825 2 30.025000000000002 22.35 27.450000000000003 20.175 3 22.411205602801402 25.887943971985994 26.338169084542272 25.362681340670335 4 25.737868934467233 28.91445722861431 21.48574287143572 23.861930965482742 5 29.72229171878909 29.622216662496875 20.340255191393545 20.31523642732049 6 22.575 36.375 20.225 20.825 7 22.125 19.3 35.9 22.675 8 24.15 23.7 24.125 28.025 9 24.15 22.125 28.075 25.650000000000002 10-14 25.88 26.22 22.56 25.34 15-19 25.490000000000002 25.185000000000002 24.505 24.82 20-24 25.96 25.45 24.085 24.505 25-29 26.245 25.255 24.08 24.42 30-34 25.355 25.474999999999998 24.38 24.79 35-39 25.585 25.435000000000002 24.485 24.495 40-44 26.224999999999998 25.374999999999996 24.05 24.349999999999998 45-49 25.25 25.745 23.935000000000002 25.069999999999997 50-54 26.314999999999998 25.61 23.885 24.19 55-59 26.255 25.124999999999996 23.945 24.675 60-64 26.135 25.564999999999998 23.990000000000002 24.310000000000002 65-69 25.905 25.685000000000002 24.14 24.27 70-74 25.929999999999996 25.03 24.425 24.615000000000002 75-79 26.245 25.674999999999997 23.855 24.224999999999998 80-84 26.55 25.275 24.19 23.985 85-89 25.840000000000003 25.15 24.59 24.42 90-94 25.735000000000003 25.355 24.715 24.195 95-99 26.39 24.990000000000002 24.85 23.77 100-104 26.86 24.55 24.665 23.925 105-109 26.0 24.87 25.345000000000002 23.785 110-114 26.31 25.840000000000003 24.12 23.73 115-119 26.97 25.575 23.84 23.615 120-124 26.47 24.97 24.585 23.974999999999998 125-129 26.145000000000003 26.125 23.9 23.830000000000002 130-134 26.965 25.46 24.075 23.5 135-139 25.935000000000002 25.679999999999996 24.47 23.915 140-144 27.18 25.324999999999996 24.0 23.494999999999997 145-149 26.995 25.91 24.11 22.985 150-151 27.447792922345883 25.809678629486054 24.246592472177067 22.495935975990996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 0.5 28 2.5 29 4.0 30 5.0 31 7.0 32 9.0 33 10.5 34 15.5 35 28.0 36 39.5 37 47.0 38 64.5 39 92.5 40 112.5 41 128.0 42 160.5 43 190.0 44 192.0 45 188.5 46 185.5 47 181.0 48 183.0 49 169.5 50 157.0 51 154.5 52 142.5 53 123.5 54 111.0 55 111.0 56 104.0 57 90.5 58 83.5 59 86.0 60 87.5 61 87.0 62 85.0 63 74.5 64 64.5 65 58.5 66 54.0 67 50.0 68 51.0 69 47.5 70 37.5 71 35.5 72 27.5 73 15.0 74 13.0 75 14.5 76 9.0 77 2.5 78 0.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.05 4 0.05 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8104277398127 97.6 2 1.1389521640091116 2.25 3 0.05062009617818274 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0125 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.0 0.025 0.0 0.0 0.0 80-81 0.0125 0.025 0.0 0.0 0.0 82-83 0.025 0.025 0.0 0.0 0.0 84-85 0.037500000000000006 0.025 0.0 0.0 0.0 86-87 0.05 0.025 0.0 0.0 0.0 88-89 0.05 0.025 0.0 0.0 0.0 90-91 0.05 0.025 0.0 0.0 0.0 92-93 0.0875 0.025 0.0 0.0 0.0 94-95 0.125 0.025 0.0 0.0 0.0 96-97 0.15 0.025 0.0 0.0 0.0 98-99 0.2 0.025 0.0 0.0 0.0 100-101 0.2375 0.025 0.0 0.0 0.0 102-103 0.3 0.025 0.0 0.0 0.0 104-105 0.3 0.025 0.0 0.0 0.0 106-107 0.35 0.025 0.0 0.0 0.0 108-109 0.4 0.025 0.0 0.0 0.0 110-111 0.4625 0.025 0.0 0.0 0.0 112-113 0.5875 0.025 0.0 0.0 0.0 114-115 0.6625000000000001 0.025 0.0 0.0 0.0 116-117 0.7 0.025 0.0 0.0 0.0 118-119 0.8125 0.025 0.0 0.0 0.0 120-121 1.1124999999999998 0.025 0.0 0.0 0.0 122-123 1.2625 0.025 0.0 0.0 0.0 124-125 1.4874999999999998 0.025 0.0 0.0 0.0 126-127 1.725 0.025 0.0 0.0 0.0 128-129 1.9625 0.025 0.0 0.0 0.0 130-131 2.15 0.025 0.0 0.0 0.0 132-133 2.2875 0.025 0.0 0.0 0.0 134-135 2.5625 0.025 0.0 0.0 0.0 136-137 2.8375 0.025 0.0 0.0 0.0 138-139 3.2875 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 977590 spots for SRR6958328.sra Written 977590 spots for SRR6958328.sra Read 977590 spots for SRR6958328.sra Written 977590 spots for SRR6958328.sra Read 977590 spots for SRR6958328.sra Written 977590 spots for SRR6958328.sra Read 977590 spots for SRR6958328.sra Written 977590 spots for SRR6958328.sra Read 977590 spots for SRR6958328.sra Written 977590 spots for SRR6958328.sra Read 977590 spots for SRR6958328.sra Written 977590 spots for SRR6958328.sra Read 977590 spots for SRR6958328.sra Written 977590 spots for SRR6958328.sra Read 977590 spots for SRR6958328.sra Written 977590 spots for SRR6958328.sra Read 977590 spots for SRR6958328.sra Written 977590 spots for SRR6958328.sra Read 977592 spots for SRR6958328.sra Written 977592 spots for SRR6958328.sra Read 977590 spots for SRR6958328.sra Written 977590 spots for SRR6958328.sra Read 977590 spots for SRR6958328.sra Written 977590 spots for SRR6958328.sra Read 977590 spots for SRR6958328.sra Written 977590 spots for SRR6958328.sra Read 977590 spots for SRR6958328.sra Written 977590 spots for SRR6958328.sra Read 977590 spots for SRR6958328.sra Written 977590 spots for SRR6958328.sra Read 977590 spots for SRR6958328.sra Written 977590 spots for SRR6958328.sra Read 977590 spots for SRR6958328.sra Written 977590 spots for SRR6958328.sra Read 977590 spots for SRR6958328.sra Written 977590 spots for SRR6958328.sra Read 977590 spots for SRR6958328.sra Written 977590 spots for SRR6958328.sra Read 977590 spots for SRR6958328.sra Written 977590 spots for SRR6958328.sra SRR ids: ['SRR6958328.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wmnnmgk6 SRR6958328.sra spots: 19551802 blocks: [[1, 977590], [977591, 1955180], [1955181, 2932770], [2932771, 3910360], [3910361, 4887950], [4887951, 5865540], [5865541, 6843130], [6843131, 7820720], [7820721, 8798310], [8798311, 9775900], [9775901, 10753490], [10753491, 11731080], [11731081, 12708670], [12708671, 13686260], [13686261, 14663850], [14663851, 15641440], [15641441, 16619030], [16619031, 17596620], [17596621, 18574210], [18574211, 19551802]] SRR6958328 file size 6603763 SRR6958328 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958328 SRR6958328_1.fastq SRR6958328_2.fastq Input file: SRR6958328_1.fastq Paired file: SRR6958328_2.fastq trimmed: SRR6958328-trimmed-pair1.fastq, SRR6958328-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:00:28 2024 >> started Fri Dec 6 20:00:52 2024 >> done (24.390s) 19551802 read pairs processed; of these: 16675 ( 0.09%) short read pairs filtered out after trimming by size control 15123 ( 0.08%) empty read pairs filtered out after trimming by size control 19520004 (99.84%) read pairs available; of these: 7354767 (37.68%) trimmed read pairs available after processing 12165237 (62.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 6 0.00% 21 4 0.00% 22 8 0.00% 23 4 0.00% 24 4 0.00% 25 2 0.00% 26 3 0.00% 27 8 0.00% 28 5 0.00% 29 9 0.00% 30 8 0.00% 31 8 0.00% 32 8 0.00% 33 7 0.00% 34 13 0.00% 35 14 0.00% 36 17 0.00% 37 8 0.00% 38 9 0.00% 39 19 0.00% 40 23 0.00% 41 14 0.00% 42 14 0.00% 43 13 0.00% 44 17 0.00% 45 18 0.00% 46 22 0.00% 47 14 0.00% 48 38 0.00% 49 27 0.00% 50 40 0.00% 51 41 0.00% 52 60 0.00% 53 63 0.00% 54 68 0.00% 55 58 0.00% 56 60 0.00% 57 78 0.00% 58 82 0.00% 59 110 0.00% 60 141 0.00% 61 139 0.00% 62 153 0.00% 63 182 0.00% 64 192 0.00% 65 220 0.00% 66 226 0.00% 67 263 0.00% 68 304 0.00% 69 296 0.00% 70 349 0.00% 71 425 0.00% 72 474 0.00% 73 549 0.00% 74 573 0.00% 75 673 0.00% 76 751 0.00% 77 922 0.00% 78 888 0.00% 79 988 0.01% 80 1224 0.01% 81 1297 0.01% 82 1489 0.01% 83 1691 0.01% 84 2509 0.01% 85 3019 0.02% 86 3146 0.02% 87 3390 0.02% 88 3701 0.02% 89 3923 0.02% 90 3912 0.02% 91 4287 0.02% 92 4572 0.02% 93 4998 0.03% 94 5239 0.03% 95 5634 0.03% 96 6113 0.03% 97 6444 0.03% 98 6974 0.04% 99 7339 0.04% 100 7840 0.04% 101 8600 0.04% 102 8737 0.04% 103 9415 0.05% 104 10081 0.05% 105 10438 0.05% 106 11227 0.06% 107 11800 0.06% 108 12523 0.06% 109 13475 0.07% 110 13819 0.07% 111 14869 0.08% 112 15745 0.08% 113 16079 0.08% 114 17394 0.09% 115 18496 0.09% 116 19457 0.10% 117 20242 0.10% 118 21608 0.11% 119 22538 0.12% 120 23453 0.12% 121 24408 0.13% 122 25517 0.13% 123 26848 0.14% 124 27999 0.14% 125 29196 0.15% 126 31339 0.16% 127 32784 0.17% 128 33973 0.17% 129 35628 0.18% 130 37750 0.19% 131 40100 0.21% 132 41975 0.22% 133 44729 0.23% 134 47065 0.24% 135 49386 0.25% 136 52780 0.27% 137 56569 0.29% 138 59595 0.31% 139 64909 0.33% 140 69715 0.36% 141 75523 0.39% 142 84216 0.43% 143 94176 0.48% 144 109302 0.56% 145 132774 0.68% 146 163649 0.84% 147 221845 1.14% 148 340760 1.75% 149 702280 3.60% 150 4199505 21.51% 151 12165237 62.32% 19520004 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=16 prefix-density=0.91 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=40.78 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.0 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=3.70 fanout-score-rank=13 prefix-density=0.65 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=64.66 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.2 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958328 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:01:59 Started mapping on | Dec 06 20:01:59 Finished on | Dec 06 20:03:55 Mapping speed, Million of reads per hour | 605.79 Number of input reads | 19520004 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 18673015 Uniquely mapped reads % | 95.66% Average mapped length | 296.95 Number of splices: Total | 21706761 Number of splices: Annotated (sjdb) | 20469693 Number of splices: GT/AG | 21420743 Number of splices: GC/AG | 253806 Number of splices: AT/AC | 8223 Number of splices: Non-canonical | 23989 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.35 Insertion rate per base | 0.01% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 267635 % of reads mapped to multiple loci | 1.37% Number of reads mapped to too many loci | 53808 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.93% % of reads unmapped: other | 1.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 588032 588032 588032 N_multimapping 267635 267635 267635 N_noFeature 628172 18129401 792307 N_ambiguous 457321 2354 79259 UnstrandedReadsAssigned:17587522 PositiveStrandReadsAssigned:541260 NegativeStrandReadsAssigned:17801449 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958328 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958328-trimmed-pair1.fastq SRR6958328-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,520,004 reads, 17,836,331 reads pseudoaligned [quant] estimated average fragment length: 263.029 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,180 rounds 52973 SRR6958328.ke.tsv 35125 SRR6958328.se.tsv 88098 total ==> SRR6958328.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 674.463 0 0 PNS24247 1044 781.971 56.1202 5.70547 PNS24249 1928 1665.97 70.4791 3.36322 PNS24246 1044 781.971 56.1202 5.70547 PNS24248 1044 781.971 56.1202 5.70547 PNS24244 1471 1208.97 23.1604 1.52298 PNS24243 293 81.8774 0 0 KQK14069 1603 1340.97 8044.14 476.895 KQK14071 474 224.631 91.179 32.2692 ==> SRR6958328.se.tsv <== BRADI_1g14170v3 8625 BRADI_1g53295v3 151 BRADI_1g59795v3 145 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 156 BRADI_1g74790v3 120 BRADI_1g09890v3 0 BRADI_1g77505v3 220 BRADI_1g48960v3 0 SRR6958328 completed mapping pipeline successfully