Starting /dee2/code/volunteer_pipeline.sh SRR6958329 current disk space = 1549549006848 free memory = 1427817152 SRR6958329 SRAfilesize e64b73190834359b738453e4093a71dd SRR6958329.sra SRR6958329.sra file validated SRR6958329 is paired end SRR6958329 is conventional basespace SRR6958329 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958329_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.1445 32.0 25.0 33.0 18.0 34.0 2 31.5065 33.0 30.0 33.0 27.0 34.0 3 32.3675 33.0 33.0 34.0 29.0 34.0 4 32.8605 33.0 33.0 34.0 31.0 34.0 5 33.068 33.0 33.0 34.0 33.0 34.0 6 36.79425 38.0 37.0 38.0 35.0 38.0 7 37.226 38.0 38.0 38.0 36.0 38.0 8 37.44375 38.0 38.0 38.0 37.0 38.0 9 37.157 38.0 38.0 38.0 36.0 38.0 10-14 37.17100000000001 38.0 38.0 38.0 36.2 38.0 15-19 37.597750000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.498850000000004 38.0 38.0 38.0 37.6 38.0 25-29 37.51885 38.0 38.0 38.0 37.6 38.0 30-34 37.5721 38.0 38.0 38.0 37.8 38.0 35-39 37.55785 38.0 38.0 38.0 37.6 38.0 40-44 37.61735 38.0 38.0 38.0 38.0 38.0 45-49 37.5325 38.0 38.0 38.0 38.0 38.0 50-54 37.420899999999996 38.0 38.0 38.0 37.4 38.0 55-59 37.251149999999996 38.0 38.0 38.0 36.6 38.0 60-64 37.386649999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.3346 38.0 38.0 38.0 37.0 38.0 70-74 37.227 38.0 38.0 38.0 36.2 38.0 75-79 36.97435 38.0 38.0 38.0 35.6 38.0 80-84 37.132799999999996 38.0 38.0 38.0 35.8 38.0 85-89 37.061800000000005 38.0 38.0 38.0 36.0 38.0 90-94 36.9443 38.0 38.0 38.0 35.4 38.0 95-99 36.8515 38.0 38.0 38.0 35.0 38.0 100-104 36.6361 38.0 38.0 38.0 34.4 38.0 105-109 36.514799999999994 38.0 38.0 38.0 34.0 38.0 110-114 36.20635 38.0 37.4 38.0 33.8 38.0 115-119 36.0273 38.0 37.0 38.0 33.2 38.0 120-124 36.022949999999994 38.0 37.0 38.0 32.8 38.0 125-129 35.56975 38.0 36.2 38.0 31.0 38.0 130-134 35.31535 38.0 36.0 38.0 31.0 38.0 135-139 35.095299999999995 38.0 35.6 38.0 29.8 38.0 140-144 34.721 38.0 35.0 38.0 27.8 38.0 145-149 33.54825000000001 38.0 34.0 38.0 21.8 38.0 150-151 27.567125 34.0 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 1.0 17 1.0 18 2.0 19 4.0 20 2.0 21 0.0 22 4.0 23 4.0 24 3.0 25 8.0 26 8.0 27 20.0 28 16.0 29 22.0 30 37.0 31 36.0 32 69.0 33 105.0 34 196.0 35 299.0 36 820.0 37 2340.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.06685669862659 11.505571391552216 9.251101321585903 41.17647058823529 2 21.125 13.325000000000001 36.125 29.425 3 19.1 16.925 26.5 37.475 4 26.575 23.95 22.175 27.3 5 25.650000000000002 28.825 23.974999999999998 21.55 6 22.375 34.175 23.825 19.625 7 17.299999999999997 24.125 39.85 18.725 8 19.725 25.775 30.275000000000002 24.224999999999998 9 18.2 22.975 35.425000000000004 23.400000000000002 10-14 21.69 28.075 26.745 23.49 15-19 21.75 27.05 27.46 23.74 20-24 22.487248724872487 26.927692769276927 26.68266826682668 23.9023902390239 25-29 21.305 27.779999999999998 26.44 24.474999999999998 30-34 21.9 26.900000000000002 26.91 24.29 35-39 22.040000000000003 27.54 26.405 24.015 40-44 21.87 27.095000000000002 26.435 24.6 45-49 21.77 26.685 26.91 24.635 50-54 21.959999999999997 26.924999999999997 26.895000000000003 24.22 55-59 21.82 26.5 27.235 24.445 60-64 21.475 26.85 26.955000000000002 24.72 65-69 22.225 26.634999999999998 26.365 24.775 70-74 22.71 26.875 26.46 23.955000000000002 75-79 21.905 26.56 27.150000000000002 24.385 80-84 22.220000000000002 27.315 26.665 23.799999999999997 85-89 22.040000000000003 26.77 26.745 24.445 90-94 22.37 26.634999999999998 26.340000000000003 24.654999999999998 95-99 22.145 26.775 26.724999999999998 24.355 100-104 22.301690507152145 26.833049914974495 26.317895368610582 24.547364209262778 105-109 22.6 26.575 27.0 23.825 110-114 22.347991585695684 26.65030551938295 26.815586497044976 24.18611639787639 115-119 22.10152182619143 27.217661193432118 26.827192631157388 23.853624349219064 120-124 22.30615307653827 26.623311655827912 26.498249124562278 24.572286143071537 125-129 22.5698099964907 26.38492003810097 26.770942998947213 24.27432696646112 130-134 22.751614033331666 27.330964416195386 25.72443821630549 24.192983334167458 135-139 22.09 26.279999999999998 26.290000000000003 25.34 140-144 22.73 26.334999999999997 26.43 24.505 145-149 22.439999999999998 26.555 26.435 24.57 150-151 23.05 26.450000000000003 25.6125 24.887500000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 0.5 27 2.0 28 4.0 29 5.5 30 11.0 31 16.5 32 20.0 33 30.0 34 44.0 35 61.0 36 65.5 37 76.5 38 112.5 39 152.5 40 168.5 41 175.5 42 213.0 43 229.5 44 224.5 45 222.0 46 221.5 47 228.0 48 218.5 49 191.0 50 165.0 51 141.5 52 131.0 53 119.0 54 96.5 55 99.0 56 92.5 57 63.0 58 45.0 59 42.5 60 40.5 61 37.5 62 33.5 63 30.5 64 30.0 65 29.0 66 21.5 67 16.0 68 15.5 69 13.0 70 12.5 71 8.0 72 5.0 73 4.0 74 4.0 75 4.5 76 2.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5249999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.01 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.03 105-109 0.0 110-114 0.16999999999999998 115-119 0.12 120-124 0.05 125-129 0.265 130-134 0.095 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39607448414695 98.75 2 0.5535983895319577 1.0999999999999999 3 0.050327126321087066 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.48750000000000004 0.0 0.0 0.0 0.0 114-115 0.5874999999999999 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.8375 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.1125 0.0 0.0 0.0 0.0 124-125 1.3875000000000002 0.0 0.0 0.0 0.0 126-127 1.6 0.0 0.0 0.0 0.0 128-129 1.725 0.0 0.0 0.0 0.0 130-131 1.925 0.0 0.0 0.0 0.0 132-133 2.1375 0.0 0.0 0.0 0.0 134-135 2.3625 0.0 0.0 0.0 0.0 136-137 2.75 0.0 0.0 0.0 0.0 138-139 3.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958329 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958329_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.50125 33.0 33.0 34.0 28.0 34.0 2 31.8965 33.0 33.0 34.0 27.0 34.0 3 32.716 33.0 33.0 34.0 31.0 34.0 4 31.4265 33.0 33.0 34.0 27.0 34.0 5 32.65625 33.0 33.0 34.0 30.0 34.0 6 37.12975 38.0 38.0 38.0 36.0 38.0 7 37.341 38.0 38.0 38.0 37.0 38.0 8 37.4055 38.0 38.0 38.0 37.0 38.0 9 37.38775 38.0 38.0 38.0 38.0 38.0 10-14 37.471500000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.42235 38.0 38.0 38.0 38.0 38.0 20-24 37.4505 38.0 38.0 38.0 38.0 38.0 25-29 37.43535000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.4929 38.0 38.0 38.0 38.0 38.0 35-39 37.410000000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.283249999999995 38.0 38.0 38.0 37.4 38.0 45-49 36.86015 38.0 37.8 38.0 35.0 38.0 50-54 36.40025 38.0 36.8 38.0 32.0 38.0 55-59 37.31975 38.0 38.0 38.0 37.0 38.0 60-64 37.427350000000004 38.0 38.0 38.0 38.0 38.0 65-69 37.3694 38.0 38.0 38.0 37.4 38.0 70-74 36.7555 38.0 38.0 38.0 35.2 38.0 75-79 37.08515 38.0 38.0 38.0 36.4 38.0 80-84 35.449349999999995 38.0 36.4 38.0 25.2 38.0 85-89 37.08415 38.0 38.0 38.0 36.4 38.0 90-94 37.12930000000001 38.0 38.0 38.0 36.6 38.0 95-99 37.01205 38.0 38.0 38.0 36.0 38.0 100-104 36.8928 38.0 38.0 38.0 35.4 38.0 105-109 36.71470000000001 38.0 38.0 38.0 34.8 38.0 110-114 36.718500000000006 38.0 38.0 38.0 35.0 38.0 115-119 36.7735 38.0 38.0 38.0 35.2 38.0 120-124 36.5108 38.0 38.0 38.0 34.4 38.0 125-129 36.3326 38.0 38.0 38.0 33.0 38.0 130-134 35.93635 38.0 38.0 38.0 33.0 38.0 135-139 35.16665 38.0 36.4 38.0 28.4 38.0 140-144 33.35770000000001 38.0 32.4 38.0 21.4 38.0 145-149 33.013549999999995 38.0 33.0 38.0 17.8 38.0 150-151 28.279375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 4.0 14 1.0 15 1.0 16 1.0 17 3.0 18 0.0 19 4.0 20 0.0 21 2.0 22 4.0 23 7.0 24 8.0 25 8.0 26 14.0 27 18.0 28 16.0 29 31.0 30 23.0 31 39.0 32 62.0 33 100.0 34 142.0 35 264.0 36 809.0 37 2431.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.525 18.675 13.525 34.275 2 29.599999999999998 25.424999999999997 27.725 17.25 3 21.125 26.950000000000003 29.275000000000002 22.650000000000002 4 24.125 31.275 21.825 22.775000000000002 5 27.450000000000003 34.525 20.424999999999997 17.599999999999998 6 22.1 37.775 20.925 19.2 7 22.35 19.525000000000002 36.7 21.425 8 23.599999999999998 24.575 25.624999999999996 26.200000000000003 9 23.799999999999997 23.425 28.799999999999997 23.974999999999998 10-14 24.805 27.51 24.635 23.05 15-19 24.265 26.525 26.195 23.015 20-24 24.715 26.43 25.695 23.16 25-29 25.069999999999997 26.985 25.230000000000004 22.715 30-34 25.174999999999997 26.3 25.835 22.689999999999998 35-39 24.975 27.355 25.205 22.465 40-44 24.65 26.695 25.955000000000002 22.7 45-49 24.9 26.13 26.745 22.225 50-54 24.240000000000002 26.825 26.450000000000003 22.485 55-59 25.014999999999997 26.525 25.72 22.74 60-64 24.88 26.8 26.13 22.189999999999998 65-69 24.775 26.6 26.495 22.13 70-74 24.54 26.43 26.119999999999997 22.91 75-79 24.175 27.295 25.715 22.814999999999998 80-84 24.47 26.924999999999997 26.419999999999998 22.185 85-89 24.5 26.435 26.36 22.705000000000002 90-94 25.005 26.705000000000002 26.240000000000002 22.05 95-99 24.675 26.71 26.27 22.345000000000002 100-104 24.635 26.815 25.97 22.58 105-109 23.95 26.979999999999997 26.685 22.384999999999998 110-114 24.990000000000002 26.650000000000002 26.490000000000002 21.87 115-119 25.485000000000003 26.169999999999998 26.400000000000002 21.945 120-124 24.98 26.645000000000003 26.145000000000003 22.23 125-129 24.685000000000002 26.924999999999997 26.275 22.115000000000002 130-134 24.66 26.41 26.31 22.62 135-139 24.990000000000002 27.029999999999998 26.235000000000003 21.745 140-144 25.564999999999998 26.965 26.185000000000002 21.285 145-149 25.35 27.015 25.915 21.72 150-151 26.187500000000004 27.0125 25.6 21.2 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 1.0 26 0.5 27 3.0 28 6.5 29 8.5 30 12.0 31 15.0 32 20.5 33 22.5 34 26.0 35 39.5 36 55.0 37 74.0 38 95.5 39 121.5 40 152.0 41 181.5 42 206.5 43 224.0 44 233.0 45 216.5 46 208.5 47 225.0 48 207.0 49 180.5 50 176.5 51 162.0 52 124.0 53 110.5 54 111.0 55 96.0 56 88.0 57 79.5 58 69.0 59 64.5 60 55.0 61 43.0 62 40.0 63 39.0 64 32.5 65 25.5 66 28.5 67 31.0 68 22.5 69 18.0 70 17.5 71 10.0 72 7.5 73 5.0 74 2.0 75 1.0 76 0.0 77 0.5 78 0.5 79 1.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36980085707083 98.55000000000001 2 0.5041593143433325 1.0 3 0.07562389715149988 0.22499999999999998 4 0.025207965717166627 0.1 5 0.025207965717166627 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.48750000000000004 0.0 0.0 0.0 0.0 114-115 0.5874999999999999 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.8375 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.1125 0.0 0.0 0.0 0.0 124-125 1.3875000000000002 0.0 0.0 0.0 0.0 126-127 1.6 0.0 0.0 0.0 0.0 128-129 1.725 0.0 0.0 0.0 0.0 130-131 1.925 0.0 0.0 0.0 0.0 132-133 2.1375 0.0 0.0 0.0 0.0 134-135 2.3375 0.0 0.0 0.0 0.0 136-137 2.7 0.0 0.0 0.0 0.0 138-139 3.0374999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTCCC 10 0.006830828 145.0 3 TGGGCAC 10 0.006830828 145.0 9 >>END_MODULE Read 752820 spots for SRR6958329.sra Written 752820 spots for SRR6958329.sra Read 752820 spots for SRR6958329.sra Written 752820 spots for SRR6958329.sra Read 752820 spots for SRR6958329.sra Written 752820 spots for SRR6958329.sra Read 752820 spots for SRR6958329.sra Written 752820 spots for SRR6958329.sra Read 752827 spots for SRR6958329.sra Written 752827 spots for SRR6958329.sra Read 752820 spots for SRR6958329.sra Written 752820 spots for SRR6958329.sra Read 752820 spots for SRR6958329.sra Written 752820 spots for SRR6958329.sra Read 752820 spots for SRR6958329.sra Written 752820 spots for SRR6958329.sra Read 752820 spots for SRR6958329.sra Written 752820 spots for SRR6958329.sra Read 752820 spots for SRR6958329.sra Written 752820 spots for SRR6958329.sra Read 752820 spots for SRR6958329.sra Written 752820 spots for SRR6958329.sra Read 752820 spots for SRR6958329.sra Written 752820 spots for SRR6958329.sra Read 752820 spots for SRR6958329.sra Written 752820 spots for SRR6958329.sra Read 752820 spots for SRR6958329.sra Written 752820 spots for SRR6958329.sra Read 752820 spots for SRR6958329.sra Written 752820 spots for SRR6958329.sra Read 752820 spots for SRR6958329.sra Written 752820 spots for SRR6958329.sra Read 752820 spots for SRR6958329.sra Written 752820 spots for SRR6958329.sra Read 752820 spots for SRR6958329.sra Written 752820 spots for SRR6958329.sra Read 752820 spots for SRR6958329.sra Written 752820 spots for SRR6958329.sra Read 752820 spots for SRR6958329.sra Written 752820 spots for SRR6958329.sra SRR ids: ['SRR6958329.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ifnjl6n4 SRR6958329.sra spots: 15056407 blocks: [[1, 752820], [752821, 1505640], [1505641, 2258460], [2258461, 3011280], [3011281, 3764100], [3764101, 4516920], [4516921, 5269740], [5269741, 6022560], [6022561, 6775380], [6775381, 7528200], [7528201, 8281020], [8281021, 9033840], [9033841, 9786660], [9786661, 10539480], [10539481, 11292300], [11292301, 12045120], [12045121, 12797940], [12797941, 13550760], [13550761, 14303580], [14303581, 15056407]] SRR6958329 file size 5080421 SRR6958329 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958329 SRR6958329_1.fastq SRR6958329_2.fastq Input file: SRR6958329_1.fastq Paired file: SRR6958329_2.fastq trimmed: SRR6958329-trimmed-pair1.fastq, SRR6958329-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:00:26 2024 >> started Fri Dec 6 20:00:44 2024 >> done (18.586s) 15056407 read pairs processed; of these: 7915 ( 0.05%) short read pairs filtered out after trimming by size control 7695 ( 0.05%) empty read pairs filtered out after trimming by size control 15040797 (99.90%) read pairs available; of these: 6266406 (41.66%) trimmed read pairs available after processing 8774391 (58.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 2 0.00% 21 1 0.00% 22 2 0.00% 23 2 0.00% 24 4 0.00% 25 2 0.00% 26 4 0.00% 27 0 0.00% 28 2 0.00% 29 0 0.00% 30 1 0.00% 31 3 0.00% 32 2 0.00% 33 2 0.00% 34 1 0.00% 35 2 0.00% 36 3 0.00% 37 8 0.00% 38 5 0.00% 39 5 0.00% 40 4 0.00% 41 2 0.00% 42 12 0.00% 43 12 0.00% 44 6 0.00% 45 5 0.00% 46 10 0.00% 47 15 0.00% 48 14 0.00% 49 15 0.00% 50 12 0.00% 51 27 0.00% 52 26 0.00% 53 22 0.00% 54 26 0.00% 55 22 0.00% 56 30 0.00% 57 23 0.00% 58 25 0.00% 59 34 0.00% 60 48 0.00% 61 48 0.00% 62 50 0.00% 63 62 0.00% 64 75 0.00% 65 93 0.00% 66 78 0.00% 67 85 0.00% 68 93 0.00% 69 121 0.00% 70 139 0.00% 71 175 0.00% 72 183 0.00% 73 207 0.00% 74 258 0.00% 75 273 0.00% 76 335 0.00% 77 346 0.00% 78 396 0.00% 79 397 0.00% 80 515 0.00% 81 607 0.00% 82 609 0.00% 83 747 0.00% 84 1034 0.01% 85 1274 0.01% 86 1455 0.01% 87 1580 0.01% 88 1722 0.01% 89 1851 0.01% 90 1853 0.01% 91 2054 0.01% 92 2244 0.01% 93 2353 0.02% 94 2675 0.02% 95 2871 0.02% 96 3057 0.02% 97 3333 0.02% 98 3525 0.02% 99 3986 0.03% 100 4142 0.03% 101 4524 0.03% 102 4942 0.03% 103 5262 0.03% 104 5626 0.04% 105 5919 0.04% 106 6470 0.04% 107 6892 0.05% 108 7277 0.05% 109 7907 0.05% 110 8201 0.05% 111 8769 0.06% 112 9242 0.06% 113 9858 0.07% 114 10949 0.07% 115 11527 0.08% 116 12248 0.08% 117 12482 0.08% 118 13185 0.09% 119 13647 0.09% 120 14489 0.10% 121 15435 0.10% 122 16572 0.11% 123 17272 0.11% 124 18120 0.12% 125 19349 0.13% 126 20288 0.13% 127 21288 0.14% 128 22801 0.15% 129 24218 0.16% 130 26327 0.18% 131 26941 0.18% 132 28650 0.19% 133 30680 0.20% 134 32529 0.22% 135 34733 0.23% 136 37600 0.25% 137 40422 0.27% 138 43203 0.29% 139 47295 0.31% 140 51971 0.35% 141 57359 0.38% 142 65281 0.43% 143 74377 0.49% 144 86702 0.58% 145 106483 0.71% 146 135360 0.90% 147 186996 1.24% 148 296670 1.97% 149 625503 4.16% 150 3829220 25.46% 151 8774391 58.34% 15040797 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=20 prefix-density=0.46 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=40.94 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.8 sequence=TGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.95 fanout-score-rank=18 prefix-density=0.32 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=19.44 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=2.2 sequence=CCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGCGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAGAAGAAGGTGCAGACCGAGTGCGCCTCCATGCCTTTCGATGACCAATGCGCCGTCTTGGAAAAGGAGGCCGTGAACGTGTCCCTCGAGAACCTCAAGACCTACCCGTTCGTCAAGGAAGGC SRR6958329 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:01:47 Started mapping on | Dec 06 20:01:48 Finished on | Dec 06 20:03:49 Mapping speed, Million of reads per hour | 447.49 Number of input reads | 15040797 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 14394613 Uniquely mapped reads % | 95.70% Average mapped length | 297.40 Number of splices: Total | 17254872 Number of splices: Annotated (sjdb) | 16280644 Number of splices: GT/AG | 17018118 Number of splices: GC/AG | 198770 Number of splices: AT/AC | 7073 Number of splices: Non-canonical | 30911 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 234078 % of reads mapped to multiple loci | 1.56% Number of reads mapped to too many loci | 22368 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.58% % of reads unmapped: other | 1.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 415328 415328 415328 N_multimapping 234078 234078 234078 N_noFeature 617579 13998555 728690 N_ambiguous 337698 1651 53474 UnstrandedReadsAssigned:13439336 PositiveStrandReadsAssigned:394407 NegativeStrandReadsAssigned:13612449 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958329 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958329-trimmed-pair1.fastq SRR6958329-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,040,797 reads, 13,628,113 reads pseudoaligned [quant] estimated average fragment length: 248.017 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52973 SRR6958329.ke.tsv 35125 SRR6958329.se.tsv 88098 total ==> SRR6958329.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 689.401 0 0 PNS24247 1044 796.983 37.2581 5.31264 PNS24249 1928 1680.98 44.1391 2.984 PNS24246 1044 796.983 37.2581 5.31264 PNS24248 1044 796.983 37.2581 5.31264 PNS24244 1471 1223.98 20.0866 1.86496 PNS24243 293 81.2485 0 0 KQK14069 1603 1355.98 2694.16 225.792 KQK14071 474 232.364 70.776 34.6143 ==> SRR6958329.se.tsv <== BRADI_1g14170v3 3367 BRADI_1g53295v3 805 BRADI_1g59795v3 142 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 319 BRADI_1g74790v3 60 BRADI_1g09890v3 0 BRADI_1g77505v3 200 BRADI_1g48960v3 0 SRR6958329 completed mapping pipeline successfully