Starting /dee2/code/volunteer_pipeline.sh SRR6958331 current disk space = 1549589975040 free memory = 1596479200 SRR6958331 SRAfilesize 916b4d3a447e44c02ee3313cdd1d23be SRR6958331.sra SRR6958331.sra file validated SRR6958331 is paired end SRR6958331 is conventional basespace SRR6958331 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958331_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.08225 32.0 25.0 33.0 18.0 34.0 2 30.7125 31.0 29.0 33.0 27.0 34.0 3 31.502 33.0 31.0 33.0 29.0 33.0 4 31.91 33.0 31.0 33.0 29.0 33.0 5 32.5455 33.0 33.0 33.0 31.0 34.0 6 36.42875 38.0 36.0 38.0 34.0 38.0 7 37.4765 38.0 38.0 38.0 37.0 38.0 8 37.565 38.0 38.0 38.0 37.0 38.0 9 37.73 38.0 38.0 38.0 38.0 38.0 10-14 37.68275 38.0 38.0 38.0 38.0 38.0 15-19 37.7097 38.0 38.0 38.0 38.0 38.0 20-24 37.6745 38.0 38.0 38.0 38.0 38.0 25-29 37.664300000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.6357 38.0 38.0 38.0 37.8 38.0 35-39 37.5884 38.0 38.0 38.0 37.8 38.0 40-44 37.65415 38.0 38.0 38.0 38.0 38.0 45-49 37.615700000000004 38.0 38.0 38.0 38.0 38.0 50-54 37.5766 38.0 38.0 38.0 38.0 38.0 55-59 37.59590000000001 38.0 38.0 38.0 38.0 38.0 60-64 37.5326 38.0 38.0 38.0 37.8 38.0 65-69 37.384100000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.4112 38.0 38.0 38.0 37.0 38.0 75-79 37.31015000000001 38.0 38.0 38.0 36.8 38.0 80-84 37.33825 38.0 38.0 38.0 37.0 38.0 85-89 36.99545 38.0 38.0 38.0 35.8 38.0 90-94 37.09779999999999 38.0 38.0 38.0 35.8 38.0 95-99 37.169 38.0 38.0 38.0 36.2 38.0 100-104 37.03825 38.0 38.0 38.0 35.8 38.0 105-109 36.9996 38.0 38.0 38.0 36.0 38.0 110-114 36.837 38.0 38.0 38.0 35.0 38.0 115-119 36.78595 38.0 38.0 38.0 35.0 38.0 120-124 36.6752 38.0 38.0 38.0 34.8 38.0 125-129 36.44414999999999 38.0 38.0 38.0 34.0 38.0 130-134 36.4982 38.0 38.0 38.0 34.0 38.0 135-139 36.365500000000004 38.0 38.0 38.0 34.0 38.0 140-144 34.56785 37.6 34.4 38.0 27.4 38.0 145-149 35.2741 38.0 35.2 38.0 31.0 38.0 150-151 32.490875 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 2.0 17 1.0 18 1.0 19 4.0 20 2.0 21 0.0 22 0.0 23 2.0 24 1.0 25 6.0 26 4.0 27 8.0 28 10.0 29 15.0 30 21.0 31 24.0 32 46.0 33 51.0 34 123.0 35 226.0 36 656.0 37 2796.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.65770423991727 9.022750775594622 7.755946225439504 40.5635987590486 2 24.425 11.600000000000001 35.275 28.7 3 21.099999999999998 16.825000000000003 24.275 37.8 4 23.849999999999998 25.724999999999998 21.45 28.975 5 25.4 30.4 23.425 20.775 6 20.549999999999997 34.275 24.325 20.849999999999998 7 16.7 24.25 41.25 17.8 8 18.8 24.975 30.0 26.224999999999998 9 18.025 23.849999999999998 33.775 24.349999999999998 10-14 22.189999999999998 28.105000000000004 26.005 23.7 15-19 22.25 25.89 27.11 24.75 20-24 21.97 26.974999999999998 26.025 25.03 25-29 21.77 26.205000000000002 26.61 25.415 30-34 22.470000000000002 26.474999999999998 27.02 24.035 35-39 22.055 26.845000000000002 26.515 24.585 40-44 22.015 27.224999999999998 25.83 24.93 45-49 21.93 26.634999999999998 26.63 24.805 50-54 22.165000000000003 26.150000000000002 26.145000000000003 25.540000000000003 55-59 22.264999999999997 25.96 26.44 25.335 60-64 23.215 26.279999999999998 25.895000000000003 24.610000000000003 65-69 21.654999999999998 26.479999999999997 26.97 24.895 70-74 22.37 26.61 25.895000000000003 25.124999999999996 75-79 21.925 26.435 26.369999999999997 25.27 80-84 22.675 25.945 26.815 24.565 85-89 22.075 26.935 26.365 24.625 90-94 22.645 26.090000000000003 26.435 24.83 95-99 22.765 26.450000000000003 26.16 24.625 100-104 22.082145179848915 26.65466006303467 26.479563760068036 24.783630997048377 105-109 22.275 26.88 25.900000000000002 24.945 110-114 22.722497373555456 27.159937965881237 25.70914002701486 24.40842463354845 115-119 23.067687227975387 26.52458852368803 26.074340887488116 24.33338336084847 120-124 23.05 26.6 25.624999999999996 24.725 125-129 22.61457550713749 26.977210117705987 25.99549211119459 24.412722263961932 130-134 22.655 27.139999999999997 25.759999999999998 24.445 135-139 22.939999999999998 26.52 26.13 24.41 140-144 22.525000000000002 26.840000000000003 25.935000000000002 24.7 145-149 23.255 26.490000000000002 25.669999999999998 24.585 150-151 23.3375 26.400000000000002 24.712500000000002 25.55 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 3.5 27 3.5 28 5.0 29 8.0 30 12.0 31 14.5 32 16.0 33 22.0 34 34.0 35 48.0 36 59.5 37 80.5 38 102.0 39 121.0 40 144.0 41 166.0 42 197.5 43 218.0 44 224.0 45 230.5 46 229.5 47 221.5 48 206.5 49 186.0 50 172.5 51 151.5 52 132.5 53 126.5 54 110.0 55 83.5 56 77.5 57 74.0 58 63.5 59 58.0 60 44.5 61 45.5 62 44.5 63 38.0 64 40.5 65 34.5 66 31.5 67 29.5 68 16.5 69 12.0 70 11.5 71 10.0 72 12.0 73 8.0 74 5.0 75 4.5 76 1.5 77 2.0 78 2.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.3000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.055 105-109 0.0 110-114 0.055 115-119 0.055 120-124 0.0 125-129 0.17500000000000002 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.9750000000000001 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.425 0.0 0.0 0.0 0.0 110-111 1.6375000000000002 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.1500000000000004 0.0 0.0 0.0 0.0 116-117 2.3875 0.0 0.0 0.0 0.0 118-119 2.7249999999999996 0.0 0.0 0.0 0.0 120-121 3.0875 0.0 0.0 0.0 0.0 122-123 3.475 0.0 0.0 0.0 0.0 124-125 3.75 0.0 0.0 0.0 0.0 126-127 4.175000000000001 0.0 0.0 0.0 0.0 128-129 4.65 0.0 0.0 0.0 0.0 130-131 5.1875 0.0 0.0 0.0 0.0 132-133 5.775 0.0 0.0 0.0 0.0 134-135 6.225 0.0 0.0 0.0 0.0 136-137 6.7375 0.0 0.0 0.0 0.0 138-139 7.262499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGAAGA 40 0.007666461 18.120312 140-144 GGAAGAG 40 0.007666461 18.120312 140-144 AGATCGG 40 0.007666461 18.120312 135-139 >>END_MODULE SRR6958331 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958331_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.87825 32.0 27.0 33.0 18.0 34.0 2 31.69275 33.0 32.0 33.0 27.0 34.0 3 32.4785 33.0 32.0 34.0 31.0 34.0 4 32.979 33.0 33.0 34.0 32.0 34.0 5 33.16725 33.0 33.0 34.0 33.0 34.0 6 37.52175 38.0 38.0 38.0 38.0 38.0 7 37.5705 38.0 38.0 38.0 38.0 38.0 8 37.575 38.0 38.0 38.0 38.0 38.0 9 37.53225 38.0 38.0 38.0 38.0 38.0 10-14 37.57145 38.0 38.0 38.0 38.0 38.0 15-19 36.57625 38.0 37.0 38.0 32.4 38.0 20-24 36.3611 38.0 36.8 38.0 31.6 38.0 25-29 37.44305 38.0 38.0 38.0 37.8 38.0 30-34 37.56155 38.0 38.0 38.0 38.0 38.0 35-39 37.47605 38.0 38.0 38.0 38.0 38.0 40-44 37.3985 38.0 38.0 38.0 37.8 38.0 45-49 37.009249999999994 38.0 38.0 38.0 35.6 38.0 50-54 37.46615 38.0 38.0 38.0 38.0 38.0 55-59 37.49715 38.0 38.0 38.0 38.0 38.0 60-64 37.4639 38.0 38.0 38.0 38.0 38.0 65-69 37.4683 38.0 38.0 38.0 38.0 38.0 70-74 37.3873 38.0 38.0 38.0 38.0 38.0 75-79 37.3078 38.0 38.0 38.0 37.6 38.0 80-84 37.2882 38.0 38.0 38.0 37.2 38.0 85-89 37.273399999999995 38.0 38.0 38.0 37.4 38.0 90-94 37.2833 38.0 38.0 38.0 37.4 38.0 95-99 37.19095 38.0 38.0 38.0 37.0 38.0 100-104 37.1048 38.0 38.0 38.0 36.4 38.0 105-109 37.06105 38.0 38.0 38.0 36.6 38.0 110-114 36.811800000000005 38.0 38.0 38.0 35.2 38.0 115-119 36.9144 38.0 38.0 38.0 36.0 38.0 120-124 36.764599999999994 38.0 38.0 38.0 35.2 38.0 125-129 35.41215 38.0 36.0 38.0 29.0 38.0 130-134 35.79685 38.0 37.0 38.0 31.8 38.0 135-139 35.58295 38.0 37.2 38.0 30.0 38.0 140-144 35.336 38.0 35.8 38.0 30.4 38.0 145-149 33.4264 38.0 33.2 38.0 23.8 38.0 150-151 29.618375 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 2.0 5 1.0 6 0.0 7 0.0 8 2.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 1.0 16 1.0 17 1.0 18 1.0 19 3.0 20 2.0 21 3.0 22 2.0 23 8.0 24 3.0 25 3.0 26 7.0 27 10.0 28 9.0 29 21.0 30 15.0 31 38.0 32 47.0 33 51.0 34 129.0 35 258.0 36 728.0 37 2643.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.025 19.400000000000002 12.275 32.300000000000004 2 28.625 23.375 30.725 17.275 3 22.125 25.75 29.7 22.425 4 26.700000000000003 31.15 20.775 21.375 5 27.200000000000003 33.074999999999996 21.45 18.275 6 22.400000000000002 36.475 20.95 20.175 7 20.45 20.525 37.775 21.25 8 23.25 23.724999999999998 26.700000000000003 26.325 9 23.3 23.175 29.349999999999998 24.175 10-14 24.625 26.685 25.245 23.445 15-19 25.074999999999996 26.205000000000002 25.490000000000002 23.23 20-24 25.085 26.46 25.525 22.93 25-29 25.365 25.97 25.724999999999998 22.939999999999998 30-34 24.64 26.240000000000002 26.045 23.075000000000003 35-39 24.985 26.39 25.430000000000003 23.195 40-44 24.73 26.02 26.055 23.195 45-49 24.745 26.855 25.759999999999998 22.64 50-54 24.515 26.479999999999997 25.740000000000002 23.265 55-59 25.25 26.19 25.755 22.805 60-64 24.57 26.555 26.145000000000003 22.73 65-69 24.145 26.69 25.97 23.195 70-74 25.169999999999998 26.435 25.474999999999998 22.919999999999998 75-79 25.11 26.26 25.64 22.99 80-84 25.064999999999998 26.76 25.5 22.675 85-89 24.87 26.424999999999997 25.955000000000002 22.75 90-94 25.615 26.16 26.040000000000003 22.185 95-99 25.295 26.25 26.229999999999997 22.225 100-104 25.25 26.21 26.125 22.415 105-109 24.85 26.08 26.07 23.0 110-114 25.255 27.05 25.945 21.75 115-119 25.96 26.369999999999997 26.015 21.654999999999998 120-124 25.245 26.44 25.955000000000002 22.36 125-129 25.874999999999996 26.75 25.540000000000003 21.834999999999997 130-134 26.06 26.405 25.715 21.82 135-139 26.055 26.605 25.695 21.645 140-144 26.284999999999997 27.05 25.275 21.39 145-149 26.625 26.790000000000003 25.145 21.44 150-151 27.5875 26.7625 25.025 20.625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.5 26 4.0 27 5.0 28 6.0 29 8.0 30 10.5 31 13.0 32 16.0 33 17.5 34 26.5 35 46.5 36 64.5 37 69.0 38 84.0 39 115.5 40 145.0 41 165.5 42 197.5 43 224.5 44 213.0 45 207.5 46 210.0 47 212.5 48 215.0 49 189.0 50 158.5 51 147.5 52 133.0 53 116.5 54 113.5 55 105.0 56 78.0 57 69.0 58 66.5 59 61.0 60 59.5 61 51.5 62 50.5 63 57.0 64 52.5 65 44.5 66 37.5 67 32.0 68 26.5 69 18.0 70 19.5 71 12.0 72 5.0 73 7.0 74 5.0 75 3.0 76 2.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.9750000000000001 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.425 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 1.9 0.0 0.0 0.0 0.0 114-115 2.175 0.0 0.0 0.0 0.0 116-117 2.4125 0.0 0.0 0.0 0.0 118-119 2.75 0.0 0.0 0.0 0.0 120-121 3.1125 0.0 0.0 0.0 0.0 122-123 3.525 0.0 0.0 0.0 0.0 124-125 3.7750000000000004 0.0 0.0 0.0 0.0 126-127 4.2125 0.0 0.0 0.0 0.0 128-129 4.675000000000001 0.0 0.0 0.0 0.0 130-131 5.1875 0.0 0.0 0.0 0.0 132-133 5.775 0.0 0.0 0.0 0.0 134-135 6.2625 0.0 0.0 0.0 0.0 136-137 6.775 0.0 0.0 0.0 0.0 138-139 7.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACTTCC 10 0.006830828 145.0 9 CTACTTC 10 0.006830828 145.0 8 CGGAAGA 35 0.0035366106 20.714287 140-144 GGAAGAG 40 0.0076550315 18.125 140-144 >>END_MODULE Read 800913 spots for SRR6958331.sra Written 800913 spots for SRR6958331.sra Read 800913 spots for SRR6958331.sra Written 800913 spots for SRR6958331.sra Read 800913 spots for SRR6958331.sra Written 800913 spots for SRR6958331.sra Read 800913 spots for SRR6958331.sra Written 800913 spots for SRR6958331.sra Read 800913 spots for SRR6958331.sra Written 800913 spots for SRR6958331.sra Read 800927 spots for SRR6958331.sra Written 800927 spots for SRR6958331.sra Read 800913 spots for SRR6958331.sra Written 800913 spots for SRR6958331.sra Read 800913 spots for SRR6958331.sra Written 800913 spots for SRR6958331.sra Read 800913 spots for SRR6958331.sra Written 800913 spots for SRR6958331.sra Read 800913 spots for SRR6958331.sra Written 800913 spots for SRR6958331.sra Read 800913 spots for SRR6958331.sra Written 800913 spots for SRR6958331.sra Read 800913 spots for SRR6958331.sra Written 800913 spots for SRR6958331.sra Read 800913 spots for SRR6958331.sra Written 800913 spots for SRR6958331.sra Read 800913 spots for SRR6958331.sra Written 800913 spots for SRR6958331.sra Read 800913 spots for SRR6958331.sra Written 800913 spots for SRR6958331.sra Read 800913 spots for SRR6958331.sra Written 800913 spots for SRR6958331.sra Read 800913 spots for SRR6958331.sra Written 800913 spots for SRR6958331.sra Read 800913 spots for SRR6958331.sra Written 800913 spots for SRR6958331.sra Read 800913 spots for SRR6958331.sra Written 800913 spots for SRR6958331.sra Read 800913 spots for SRR6958331.sra Written 800913 spots for SRR6958331.sra SRR ids: ['SRR6958331.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f8c7wo4z SRR6958331.sra spots: 16018274 blocks: [[1, 800913], [800914, 1601826], [1601827, 2402739], [2402740, 3203652], [3203653, 4004565], [4004566, 4805478], [4805479, 5606391], [5606392, 6407304], [6407305, 7208217], [7208218, 8009130], [8009131, 8810043], [8810044, 9610956], [9610957, 10411869], [10411870, 11212782], [11212783, 12013695], [12013696, 12814608], [12814609, 13615521], [13615522, 14416434], [14416435, 15217347], [15217348, 16018274]] SRR6958331 file size 5406367 SRR6958331 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958331 SRR6958331_1.fastq SRR6958331_2.fastq Input file: SRR6958331_1.fastq Paired file: SRR6958331_2.fastq trimmed: SRR6958331-trimmed-pair1.fastq, SRR6958331-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:09:40 2024 >> started Fri Dec 6 20:09:58 2024 >> done (17.857s) 16018274 read pairs processed; of these: 6038 ( 0.04%) short read pairs filtered out after trimming by size control 8025 ( 0.05%) empty read pairs filtered out after trimming by size control 16004211 (99.91%) read pairs available; of these: 5812928 (36.32%) trimmed read pairs available after processing 10191283 (63.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 1 0.00% 21 3 0.00% 22 4 0.00% 23 6 0.00% 24 4 0.00% 25 3 0.00% 26 6 0.00% 27 9 0.00% 28 7 0.00% 29 9 0.00% 30 8 0.00% 31 6 0.00% 32 5 0.00% 33 5 0.00% 34 12 0.00% 35 8 0.00% 36 11 0.00% 37 15 0.00% 38 15 0.00% 39 15 0.00% 40 12 0.00% 41 13 0.00% 42 26 0.00% 43 27 0.00% 44 21 0.00% 45 27 0.00% 46 33 0.00% 47 31 0.00% 48 36 0.00% 49 44 0.00% 50 57 0.00% 51 67 0.00% 52 69 0.00% 53 60 0.00% 54 93 0.00% 55 82 0.00% 56 95 0.00% 57 97 0.00% 58 122 0.00% 59 137 0.00% 60 171 0.00% 61 201 0.00% 62 207 0.00% 63 251 0.00% 64 256 0.00% 65 275 0.00% 66 322 0.00% 67 371 0.00% 68 442 0.00% 69 481 0.00% 70 553 0.00% 71 569 0.00% 72 653 0.00% 73 790 0.00% 74 852 0.01% 75 993 0.01% 76 1119 0.01% 77 1266 0.01% 78 1414 0.01% 79 1670 0.01% 80 1796 0.01% 81 1945 0.01% 82 2317 0.01% 83 2497 0.02% 84 3040 0.02% 85 3604 0.02% 86 3722 0.02% 87 4196 0.03% 88 4527 0.03% 89 5051 0.03% 90 5280 0.03% 91 5954 0.04% 92 6621 0.04% 93 7132 0.04% 94 7774 0.05% 95 8368 0.05% 96 9058 0.06% 97 9783 0.06% 98 10387 0.06% 99 11571 0.07% 100 13830 0.09% 101 15216 0.10% 102 13499 0.08% 103 14688 0.09% 104 15671 0.10% 105 16189 0.10% 106 17424 0.11% 107 18535 0.12% 108 19327 0.12% 109 20596 0.13% 110 21447 0.13% 111 22716 0.14% 112 24090 0.15% 113 24733 0.15% 114 26353 0.16% 115 27756 0.17% 116 28887 0.18% 117 30118 0.19% 118 31142 0.19% 119 32219 0.20% 120 33018 0.21% 121 34685 0.22% 122 35334 0.22% 123 37398 0.23% 124 38947 0.24% 125 40438 0.25% 126 40959 0.26% 127 42895 0.27% 128 44263 0.28% 129 45140 0.28% 130 47256 0.30% 131 48187 0.30% 132 49758 0.31% 133 51712 0.32% 134 53069 0.33% 135 56022 0.35% 136 57527 0.36% 137 59442 0.37% 138 61205 0.38% 139 64507 0.40% 140 67289 0.42% 141 70473 0.44% 142 75594 0.47% 143 80168 0.50% 144 88385 0.55% 145 102790 0.64% 146 120706 0.75% 147 147413 0.92% 148 230492 1.44% 149 447901 2.80% 150 2876730 17.97% 151 10191283 63.68% 16004211 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=4.15 fanout-score-rank=18 prefix-density=0.35 prefix-fanout=3.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=218.50 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=24.9 sequence=TTCTTCTTGTCCA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=12.73 fanout-score-rank=12 prefix-density=0.44 prefix-fanout=6.7 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTACGTCCGCATCAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=644.74 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=11.5 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR6958331 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:10:55 Started mapping on | Dec 06 20:10:55 Finished on | Dec 06 20:12:44 Mapping speed, Million of reads per hour | 528.58 Number of input reads | 16004211 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15514378 Uniquely mapped reads % | 96.94% Average mapped length | 294.57 Number of splices: Total | 18247306 Number of splices: Annotated (sjdb) | 17177992 Number of splices: GT/AG | 17990654 Number of splices: GC/AG | 208028 Number of splices: AT/AC | 10639 Number of splices: Non-canonical | 37985 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 212997 % of reads mapped to multiple loci | 1.33% Number of reads mapped to too many loci | 5379 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.52% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 281543 281543 281543 N_multimapping 212997 212997 212997 N_noFeature 707162 15100224 839394 N_ambiguous 332012 2153 50383 UnstrandedReadsAssigned:14475204 PositiveStrandReadsAssigned:412001 NegativeStrandReadsAssigned:14624601 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958331 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958331-trimmed-pair1.fastq SRR6958331-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,004,211 reads, 14,639,719 reads pseudoaligned [quant] estimated average fragment length: 238.461 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,214 rounds 52973 SRR6958331.ke.tsv 35125 SRR6958331.se.tsv 88098 total ==> SRR6958331.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 698.904 51.2549 7.6421 PNS24247 1044 806.539 20.6932 2.67361 PNS24249 1928 1690.54 54.7653 3.37578 PNS24246 1044 806.539 20.6932 2.67361 PNS24248 1044 806.539 20.6932 2.67361 PNS24244 1471 1233.54 12.9001 1.08977 PNS24243 293 95.2398 1 1.09415 KQK14069 1603 1365.54 271.315 20.7045 KQK14071 474 245.452 3.96623 1.68386 ==> SRR6958331.se.tsv <== BRADI_1g14170v3 300 BRADI_1g53295v3 1057 BRADI_1g59795v3 120 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 799 BRADI_1g74790v3 159 BRADI_1g09890v3 0 BRADI_1g77505v3 269 BRADI_1g48960v3 0 SRR6958331 completed mapping pipeline successfully