Starting /dee2/code/volunteer_pipeline.sh SRR6958332 current disk space = 1549577338880 free memory = 1601946380 SRR6958332 SRAfilesize 903a489d1c67de0a8af69d18270881a1 SRR6958332.sra SRR6958332.sra file validated SRR6958332 is paired end SRR6958332 is conventional basespace SRR6958332 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958332_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.08325 18.0 18.0 31.0 18.0 32.0 2 27.06825 28.0 25.0 31.0 18.0 33.0 3 28.0115 29.0 27.0 31.0 18.0 33.0 4 29.93775 31.0 29.0 33.0 27.0 33.0 5 31.5685 33.0 31.0 33.0 29.0 33.0 6 36.4605 38.0 37.0 38.0 34.0 38.0 7 36.8675 38.0 38.0 38.0 35.0 38.0 8 37.17225 38.0 38.0 38.0 36.0 38.0 9 37.336 38.0 38.0 38.0 37.0 38.0 10-14 37.2966 38.0 38.0 38.0 36.6 38.0 15-19 37.3429 38.0 38.0 38.0 36.8 38.0 20-24 37.311299999999996 38.0 38.0 38.0 36.8 38.0 25-29 37.17505 38.0 38.0 38.0 36.2 38.0 30-34 37.05595 38.0 38.0 38.0 36.0 38.0 35-39 36.990500000000004 38.0 38.0 38.0 36.0 38.0 40-44 36.9056 38.0 38.0 38.0 35.4 38.0 45-49 36.8261 38.0 38.0 38.0 35.0 38.0 50-54 36.35575 38.0 37.8 38.0 33.0 38.0 55-59 36.434799999999996 38.0 38.0 38.0 33.8 38.0 60-64 36.71640000000001 38.0 38.0 38.0 34.6 38.0 65-69 36.825599999999994 38.0 38.0 38.0 35.2 38.0 70-74 36.5636 38.0 38.0 38.0 34.0 38.0 75-79 36.0615 38.0 36.8 38.0 32.4 38.0 80-84 36.052049999999994 38.0 37.0 38.0 32.0 38.0 85-89 36.294850000000004 38.0 37.4 38.0 33.4 38.0 90-94 36.1117 38.0 37.0 38.0 33.2 38.0 95-99 35.7084 38.0 36.4 38.0 31.0 38.0 100-104 35.1449 38.0 35.4 38.0 28.2 38.0 105-109 34.6469 38.0 35.0 38.0 25.2 38.0 110-114 34.760149999999996 38.0 35.0 38.0 26.6 38.0 115-119 34.4145 38.0 34.4 38.0 24.6 38.0 120-124 34.29875 38.0 34.4 38.0 24.6 38.0 125-129 34.255050000000004 38.0 34.2 38.0 24.2 38.0 130-134 33.59140000000001 38.0 33.6 38.0 20.6 38.0 135-139 33.055150000000005 37.8 32.2 38.0 19.4 38.0 140-144 31.904349999999994 36.2 31.0 38.0 13.4 38.0 145-149 29.7708 34.8 28.2 38.0 8.6 38.0 150-151 24.088375 31.0 7.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 0.0 13 1.0 14 1.0 15 1.0 16 2.0 17 1.0 18 4.0 19 2.0 20 7.0 21 8.0 22 4.0 23 9.0 24 7.0 25 19.0 26 39.0 27 44.0 28 59.0 29 61.0 30 93.0 31 124.0 32 164.0 33 208.0 34 318.0 35 549.0 36 1093.0 37 1179.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.574606619641884 15.816603364080303 5.046120455778621 41.56266956049919 2 19.1 13.825000000000001 32.574999999999996 34.5 3 21.3 16.925 25.55 36.225 4 24.45 24.3 23.724999999999998 27.525 5 24.5 28.125 24.85 22.525000000000002 6 21.725 31.724999999999998 24.575 21.975 7 16.525000000000002 24.25 39.65 19.575 8 19.925 24.925 28.625 26.525 9 19.575 22.025 33.875 24.525 10-14 21.93 27.63 25.595000000000002 24.845 15-19 21.325 26.515 26.63 25.53 20-24 21.959999999999997 26.02 26.905 25.115 25-29 21.995 25.745 26.490000000000002 25.77 30-34 22.134999999999998 25.905 26.545 25.415 35-39 22.255 25.674999999999997 26.405 25.665 40-44 22.33 25.46 26.795 25.415 45-49 21.605 26.445 26.095000000000002 25.855 50-54 22.64 26.400000000000002 25.685000000000002 25.275 55-59 22.12 26.31 26.0 25.569999999999997 60-64 22.05 26.325 26.31 25.314999999999998 65-69 22.57 25.679999999999996 26.810000000000002 24.94 70-74 22.33 26.179999999999996 26.195 25.295 75-79 22.025 25.874999999999996 26.009999999999998 26.090000000000003 80-84 23.03 25.595000000000002 26.32 25.055 85-89 22.395 25.790000000000003 26.055 25.759999999999998 90-94 22.305 25.785000000000004 26.695 25.215 95-99 22.485 25.775 26.424999999999997 25.314999999999998 100-104 22.175 25.88 26.435 25.509999999999998 105-109 22.82 25.45 25.97 25.759999999999998 110-114 22.720000000000002 25.355 26.240000000000002 25.685000000000002 115-119 22.185 25.81 26.474999999999998 25.53 120-124 22.314999999999998 25.05 26.495 26.14 125-129 22.78 25.095 26.52 25.605 130-134 22.79 25.869999999999997 25.865 25.474999999999998 135-139 22.49 26.035000000000004 26.02 25.455 140-144 22.759999999999998 25.395 26.075 25.77 145-149 22.985 25.385 26.200000000000003 25.430000000000003 150-151 23.325000000000003 24.275 26.387500000000003 26.0125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.0 26 0.5 27 0.5 28 1.0 29 2.0 30 4.5 31 11.5 32 15.0 33 22.5 34 35.0 35 45.5 36 52.0 37 70.0 38 98.0 39 125.5 40 139.0 41 161.0 42 196.5 43 207.0 44 216.0 45 229.0 46 233.0 47 230.0 48 215.5 49 187.0 50 167.5 51 160.0 52 137.5 53 117.5 54 110.0 55 94.5 56 79.5 57 69.0 58 66.0 59 63.0 60 48.5 61 41.5 62 38.5 63 37.5 64 39.0 65 34.5 66 32.0 67 33.5 68 27.0 69 17.0 70 17.0 71 15.5 72 15.0 73 15.5 74 8.5 75 4.5 76 5.5 77 3.0 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.85 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.025 0.0 0.0 66-67 0.0 0.0 0.025 0.0 0.0 68-69 0.0 0.0 0.025 0.0 0.0 70-71 0.0 0.0 0.025 0.0 0.0 72-73 0.0 0.0 0.025 0.0 0.0 74-75 0.0 0.0 0.025 0.0 0.0 76-77 0.0 0.0 0.025 0.0 0.0 78-79 0.0 0.0 0.025 0.0 0.0 80-81 0.0 0.0 0.025 0.0 0.0 82-83 0.0 0.0 0.025 0.0 0.0 84-85 0.0 0.0 0.025 0.0 0.0 86-87 0.0 0.0 0.025 0.0 0.0 88-89 0.0 0.0 0.025 0.0 0.0 90-91 0.0 0.0 0.025 0.0 0.0 92-93 0.05 0.0 0.025 0.0 0.0 94-95 0.05 0.0 0.025 0.0 0.0 96-97 0.0625 0.0 0.025 0.0 0.0 98-99 0.1 0.0 0.025 0.0 0.0 100-101 0.1375 0.0 0.025 0.0 0.0 102-103 0.15 0.0 0.025 0.0 0.0 104-105 0.1875 0.0 0.025 0.0 0.0 106-107 0.2 0.0 0.025 0.0 0.0 108-109 0.2625 0.0 0.025 0.0 0.0 110-111 0.35 0.0 0.025 0.0 0.0 112-113 0.4 0.0 0.025 0.0 0.0 114-115 0.5 0.0 0.025 0.0 0.0 116-117 0.6 0.0 0.025 0.0 0.0 118-119 0.675 0.0 0.025 0.0 0.0 120-121 0.75 0.0 0.025 0.0 0.0 122-123 0.95 0.0 0.025 0.0 0.0 124-125 1.125 0.0 0.025 0.0 0.0 126-127 1.3 0.0 0.025 0.0 0.0 128-129 1.425 0.0 0.025 0.0 0.0 130-131 1.6625 0.0 0.025 0.0 0.0 132-133 1.9375 0.0 0.025 0.0 0.0 134-135 2.0999999999999996 0.0 0.025 0.0 0.0 136-137 2.25 0.0 0.025 0.0 0.0 138-139 2.4625 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCGTG 10 0.004973884 161.00002 1 >>END_MODULE SRR6958332 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958332_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.55425 33.0 33.0 34.0 32.0 34.0 2 32.51075 33.0 33.0 34.0 31.0 34.0 3 32.5925 33.0 33.0 34.0 32.0 34.0 4 32.4655 33.0 33.0 34.0 32.0 34.0 5 32.52425 33.0 33.0 34.0 32.0 34.0 6 36.65175 38.0 38.0 38.0 35.0 38.0 7 36.63175 38.0 38.0 38.0 34.0 38.0 8 36.50425 38.0 38.0 38.0 34.0 38.0 9 36.658 38.0 38.0 38.0 35.0 38.0 10-14 36.620400000000004 38.0 38.0 38.0 34.6 38.0 15-19 36.79245 38.0 38.0 38.0 35.4 38.0 20-24 36.77525 38.0 38.0 38.0 35.2 38.0 25-29 36.78009999999999 38.0 38.0 38.0 35.0 38.0 30-34 36.769099999999995 38.0 38.0 38.0 35.4 38.0 35-39 36.60025 38.0 38.0 38.0 34.8 38.0 40-44 36.527750000000005 38.0 38.0 38.0 34.2 38.0 45-49 36.5142 38.0 38.0 38.0 34.2 38.0 50-54 36.42375 38.0 38.0 38.0 34.0 38.0 55-59 36.42280000000001 38.0 38.0 38.0 34.0 38.0 60-64 36.34305 38.0 38.0 38.0 34.0 38.0 65-69 36.11375 38.0 37.8 38.0 32.8 38.0 70-74 36.16845 38.0 38.0 38.0 33.2 38.0 75-79 35.985499999999995 38.0 37.0 38.0 32.6 38.0 80-84 35.78985 38.0 37.0 38.0 31.4 38.0 85-89 35.81699999999999 38.0 37.0 38.0 31.8 38.0 90-94 35.5616 38.0 36.4 38.0 30.0 38.0 95-99 35.28935 38.0 36.0 38.0 28.8 38.0 100-104 34.992549999999994 38.0 36.0 38.0 27.6 38.0 105-109 34.6695 38.0 35.2 38.0 25.6 38.0 110-114 34.1868 38.0 34.4 38.0 23.6 38.0 115-119 34.075700000000005 38.0 34.2 38.0 23.2 38.0 120-124 33.757400000000004 38.0 33.2 38.0 22.2 38.0 125-129 32.927749999999996 38.0 32.4 38.0 15.0 38.0 130-134 31.8975 36.6 30.8 38.0 13.2 38.0 135-139 31.5726 36.0 30.0 38.0 13.0 38.0 140-144 30.932550000000003 36.0 28.2 38.0 12.4 38.0 145-149 29.42985 36.0 26.8 38.0 3.8 38.0 150-151 23.394125000000003 30.0 7.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 6.0 4 0.0 5 0.0 6 3.0 7 1.0 8 1.0 9 3.0 10 0.0 11 0.0 12 4.0 13 0.0 14 1.0 15 2.0 16 4.0 17 8.0 18 5.0 19 10.0 20 10.0 21 13.0 22 26.0 23 15.0 24 19.0 25 29.0 26 28.0 27 54.0 28 61.0 29 81.0 30 85.0 31 116.0 32 146.0 33 173.0 34 311.0 35 439.0 36 907.0 37 1430.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.3 18.4 11.325000000000001 28.975 2 28.349999999999998 24.55 26.825 20.275000000000002 3 22.875 25.55 28.9 22.675 4 26.724999999999998 32.1 20.025000000000002 21.15 5 27.900000000000002 32.800000000000004 19.900000000000002 19.400000000000002 6 23.599999999999998 35.725 19.5 21.175 7 22.1 19.725 35.275 22.900000000000002 8 23.549999999999997 24.0 24.85 27.6 9 24.325 22.525000000000002 26.924999999999997 26.224999999999998 10-14 25.805 26.935 23.66 23.599999999999998 15-19 25.435000000000002 26.334999999999997 24.529999999999998 23.7 20-24 25.415 25.865 24.815 23.905 25-29 25.7 26.150000000000002 24.610000000000003 23.54 30-34 25.71 25.8 25.145 23.345 35-39 25.740000000000002 25.8 24.985 23.474999999999998 40-44 25.405 25.83 24.845 23.919999999999998 45-49 26.035000000000004 25.56 24.985 23.419999999999998 50-54 25.480000000000004 25.16 26.095000000000002 23.265 55-59 26.155 26.135 24.905 22.805 60-64 25.290000000000003 25.900000000000002 25.335 23.474999999999998 65-69 26.035000000000004 25.945 25.169999999999998 22.85 70-74 26.265 25.86 24.89 22.985 75-79 26.31 25.995 24.75 22.945 80-84 25.564999999999998 26.805 25.35 22.28 85-89 26.07 26.400000000000002 24.884999999999998 22.645 90-94 25.924999999999997 25.75 25.585 22.74 95-99 25.7 26.05 25.545 22.705000000000002 100-104 26.185000000000002 25.75 25.240000000000002 22.825 105-109 25.94 25.97 25.305 22.785 110-114 25.490000000000002 26.47 25.290000000000003 22.75 115-119 26.200000000000003 26.115 24.68 23.005 120-124 26.135 26.22 25.474999999999998 22.17 125-129 25.665 26.39 25.295 22.650000000000002 130-134 26.14 26.015 25.66 22.185 135-139 25.655 26.795 25.380000000000003 22.17 140-144 25.665 26.56 25.455 22.32 145-149 26.840000000000003 26.115 25.374999999999996 21.67 150-151 26.487500000000004 24.825 26.325 22.3625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 2.0 27 1.0 28 1.5 29 3.5 30 4.5 31 6.5 32 12.5 33 16.0 34 22.0 35 31.0 36 42.0 37 60.5 38 84.0 39 110.0 40 130.5 41 154.5 42 185.5 43 201.5 44 216.0 45 222.5 46 204.5 47 197.0 48 187.0 49 178.0 50 166.5 51 150.5 52 145.5 53 122.0 54 106.0 55 101.5 56 91.0 57 86.0 58 78.0 59 67.5 60 56.5 61 53.5 62 53.5 63 60.5 64 61.5 65 51.0 66 43.5 67 38.0 68 35.0 69 34.0 70 32.0 71 24.0 72 17.0 73 13.0 74 13.5 75 9.5 76 4.5 77 3.0 78 2.5 79 1.0 80 0.0 81 1.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8496993987976 99.65 2 0.125250501002004 0.25 3 0.0 0.0 4 0.0250501002004008 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0125 110-111 0.3375 0.0 0.0 0.0 0.025 112-113 0.4 0.0 0.0 0.0 0.025 114-115 0.5 0.0 0.0 0.0 0.025 116-117 0.6 0.0 0.0 0.0 0.025 118-119 0.675 0.0 0.0 0.0 0.025 120-121 0.75 0.0 0.0 0.0 0.025 122-123 0.925 0.0 0.0 0.0 0.025 124-125 1.05 0.0 0.0 0.0 0.025 126-127 1.2125 0.0 0.0 0.0 0.025 128-129 1.3125 0.0 0.0 0.0 0.025 130-131 1.5375 0.0 0.0 0.0 0.025 132-133 1.8125 0.0 0.0 0.0 0.025 134-135 1.975 0.0 0.0 0.0 0.025 136-137 2.15 0.0 0.0 0.0 0.025 138-139 2.375 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1018333 spots for SRR6958332.sra Written 1018333 spots for SRR6958332.sra Read 1018333 spots for SRR6958332.sra Written 1018333 spots for SRR6958332.sra Read 1018333 spots for SRR6958332.sra Written 1018333 spots for SRR6958332.sra Read 1018333 spots for SRR6958332.sra Written 1018333 spots for SRR6958332.sra Read 1018333 spots for SRR6958332.sra Written 1018333 spots for SRR6958332.sra Read 1018333 spots for SRR6958332.sra Written 1018333 spots for SRR6958332.sra Read 1018349 spots for SRR6958332.sra Written 1018349 spots for SRR6958332.sra Read 1018333 spots for SRR6958332.sra Written 1018333 spots for SRR6958332.sra Read 1018333 spots for SRR6958332.sra Written 1018333 spots for SRR6958332.sra Read 1018333 spots for SRR6958332.sra Written 1018333 spots for SRR6958332.sra Read 1018333 spots for SRR6958332.sra Written 1018333 spots for SRR6958332.sra Read 1018333 spots for SRR6958332.sra Written 1018333 spots for SRR6958332.sra Read 1018333 spots for SRR6958332.sra Written 1018333 spots for SRR6958332.sra Read 1018333 spots for SRR6958332.sra Written 1018333 spots for SRR6958332.sra Read 1018333 spots for SRR6958332.sra Written 1018333 spots for SRR6958332.sra Read 1018333 spots for SRR6958332.sra Written 1018333 spots for SRR6958332.sra Read 1018333 spots for SRR6958332.sra Written 1018333 spots for SRR6958332.sra Read 1018333 spots for SRR6958332.sra Written 1018333 spots for SRR6958332.sra Read 1018333 spots for SRR6958332.sra Written 1018333 spots for SRR6958332.sra Read 1018333 spots for SRR6958332.sra Written 1018333 spots for SRR6958332.sra SRR ids: ['SRR6958332.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wd0lre6s SRR6958332.sra spots: 20366676 blocks: [[1, 1018333], [1018334, 2036666], [2036667, 3054999], [3055000, 4073332], [4073333, 5091665], [5091666, 6109998], [6109999, 7128331], [7128332, 8146664], [8146665, 9164997], [9164998, 10183330], [10183331, 11201663], [11201664, 12219996], [12219997, 13238329], [13238330, 14256662], [14256663, 15274995], [15274996, 16293328], [16293329, 17311661], [17311662, 18329994], [18329995, 19348327], [19348328, 20366676]] SRR6958332 file size 6879897 SRR6958332 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958332 SRR6958332_1.fastq SRR6958332_2.fastq Input file: SRR6958332_1.fastq Paired file: SRR6958332_2.fastq trimmed: SRR6958332-trimmed-pair1.fastq, SRR6958332-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:10:16 2024 >> started Fri Dec 6 20:10:37 2024 >> done (20.952s) 20366676 read pairs processed; of these: 23897 ( 0.12%) short read pairs filtered out after trimming by size control 19250 ( 0.09%) empty read pairs filtered out after trimming by size control 20323529 (99.79%) read pairs available; of these: 9044897 (44.50%) trimmed read pairs available after processing 11278632 (55.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 0 0.00% 21 3 0.00% 22 4 0.00% 23 6 0.00% 24 0 0.00% 25 4 0.00% 26 1 0.00% 27 5 0.00% 28 6 0.00% 29 4 0.00% 30 9 0.00% 31 9 0.00% 32 9 0.00% 33 13 0.00% 34 5 0.00% 35 6 0.00% 36 7 0.00% 37 10 0.00% 38 7 0.00% 39 6 0.00% 40 13 0.00% 41 14 0.00% 42 15 0.00% 43 12 0.00% 44 12 0.00% 45 12 0.00% 46 25 0.00% 47 21 0.00% 48 14 0.00% 49 27 0.00% 50 36 0.00% 51 27 0.00% 52 44 0.00% 53 38 0.00% 54 49 0.00% 55 41 0.00% 56 61 0.00% 57 62 0.00% 58 65 0.00% 59 75 0.00% 60 90 0.00% 61 111 0.00% 62 102 0.00% 63 105 0.00% 64 150 0.00% 65 128 0.00% 66 122 0.00% 67 173 0.00% 68 186 0.00% 69 227 0.00% 70 238 0.00% 71 255 0.00% 72 302 0.00% 73 328 0.00% 74 399 0.00% 75 455 0.00% 76 487 0.00% 77 529 0.00% 78 643 0.00% 79 690 0.00% 80 770 0.00% 81 826 0.00% 82 1042 0.01% 83 1185 0.01% 84 2251 0.01% 85 2810 0.01% 86 2895 0.01% 87 2874 0.01% 88 3057 0.02% 89 3055 0.02% 90 3186 0.02% 91 3459 0.02% 92 3673 0.02% 93 3760 0.02% 94 4016 0.02% 95 4257 0.02% 96 4657 0.02% 97 4863 0.02% 98 5201 0.03% 99 5470 0.03% 100 5816 0.03% 101 6132 0.03% 102 6707 0.03% 103 7103 0.03% 104 7708 0.04% 105 7997 0.04% 106 8704 0.04% 107 9094 0.04% 108 9732 0.05% 109 9981 0.05% 110 10384 0.05% 111 11499 0.06% 112 12354 0.06% 113 13024 0.06% 114 13771 0.07% 115 14850 0.07% 116 15753 0.08% 117 16525 0.08% 118 17238 0.08% 119 18190 0.09% 120 19003 0.09% 121 20136 0.10% 122 21493 0.11% 123 22769 0.11% 124 24824 0.12% 125 26163 0.13% 126 27258 0.13% 127 29775 0.15% 128 31296 0.15% 129 33386 0.16% 130 35166 0.17% 131 37585 0.18% 132 39914 0.20% 133 43284 0.21% 134 46544 0.23% 135 49736 0.24% 136 54189 0.27% 137 59278 0.29% 138 63341 0.31% 139 70534 0.35% 140 77841 0.38% 141 86567 0.43% 142 99498 0.49% 143 114826 0.56% 144 137808 0.68% 145 170214 0.84% 146 220765 1.09% 147 311112 1.53% 148 495897 2.44% 149 1023573 5.04% 150 5258750 25.88% 151 11278632 55.50% 20323529 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=10.96 fanout-score-rank=10 prefix-density=0.47 prefix-fanout=4.6 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=14 fanout-score=377.15 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=35.1 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=37 prefix-density=0.28 prefix-fanout=2.0 sequence=GCGGCAACTGCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=158.49 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.1 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTG SRR6958332 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:11:20 Started mapping on | Dec 06 20:11:20 Finished on | Dec 06 20:13:25 Mapping speed, Million of reads per hour | 585.32 Number of input reads | 20323529 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 19419499 Uniquely mapped reads % | 95.55% Average mapped length | 296.88 Number of splices: Total | 22607222 Number of splices: Annotated (sjdb) | 21327260 Number of splices: GT/AG | 22294410 Number of splices: GC/AG | 255604 Number of splices: AT/AC | 11610 Number of splices: Non-canonical | 45598 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 3.01 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 250048 % of reads mapped to multiple loci | 1.23% Number of reads mapped to too many loci | 10072 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.79% % of reads unmapped: other | 0.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 669843 669843 669843 N_multimapping 250048 250048 250048 N_noFeature 710883 18929090 857501 N_ambiguous 410964 2796 68403 UnstrandedReadsAssigned:18297652 PositiveStrandReadsAssigned:487613 NegativeStrandReadsAssigned:18493595 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958332 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958332-trimmed-pair1.fastq SRR6958332-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,323,529 reads, 18,459,592 reads pseudoaligned [quant] estimated average fragment length: 271.1 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,127 rounds 52973 SRR6958332.ke.tsv 35125 SRR6958332.se.tsv 88098 total ==> SRR6958332.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 666.32 14.8687 1.78912 PNS24247 1044 773.9 56.8264 5.88727 PNS24249 1928 1657.9 77.112 3.72918 PNS24246 1044 773.9 56.8264 5.88727 PNS24248 1044 773.9 56.8264 5.88727 PNS24244 1471 1200.9 74.5401 4.9766 PNS24243 293 76.2806 0 0 KQK14069 1603 1332.9 502.86 30.2481 KQK14071 474 217.08 3.02932 1.11886 ==> SRR6958332.se.tsv <== BRADI_1g14170v3 536 BRADI_1g53295v3 1134 BRADI_1g59795v3 75 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 1041 BRADI_1g74790v3 490 BRADI_1g09890v3 0 BRADI_1g77505v3 258 BRADI_1g48960v3 0 SRR6958332 completed mapping pipeline successfully