Starting /dee2/code/volunteer_pipeline.sh SRR6958333 current disk space = 1549581258752 free memory = 1596461036 SRR6958333 SRAfilesize 9f2369012ad4b50cdb6759cdcb5d5748 SRR6958333.sra SRR6958333.sra file validated SRR6958333 is paired end SRR6958333 is conventional basespace SRR6958333 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958333_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.531 32.0 18.0 33.0 18.0 34.0 2 30.0345 31.0 27.0 33.0 27.0 34.0 3 31.92525 33.0 31.0 33.0 29.0 34.0 4 32.55575 33.0 33.0 33.0 31.0 34.0 5 32.80875 33.0 33.0 34.0 31.0 34.0 6 36.33075 37.0 36.0 38.0 34.0 38.0 7 37.02275 38.0 37.0 38.0 35.0 38.0 8 37.42475 38.0 38.0 38.0 37.0 38.0 9 37.239 38.0 38.0 38.0 37.0 38.0 10-14 37.16895 38.0 38.0 38.0 36.2 38.0 15-19 37.3987 38.0 38.0 38.0 36.8 38.0 20-24 37.391200000000005 38.0 38.0 38.0 36.8 38.0 25-29 37.523250000000004 38.0 38.0 38.0 37.6 38.0 30-34 37.5521 38.0 38.0 38.0 37.8 38.0 35-39 37.51705 38.0 38.0 38.0 37.8 38.0 40-44 37.5467 38.0 38.0 38.0 37.6 38.0 45-49 37.240050000000004 38.0 38.0 38.0 36.6 38.0 50-54 37.356500000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.11825 38.0 38.0 38.0 36.0 38.0 60-64 37.16265 38.0 38.0 38.0 36.2 38.0 65-69 37.14665 38.0 38.0 38.0 36.0 38.0 70-74 36.6345 38.0 37.8 38.0 34.2 38.0 75-79 37.079750000000004 38.0 38.0 38.0 36.0 38.0 80-84 37.048 38.0 38.0 38.0 35.8 38.0 85-89 36.98545 38.0 38.0 38.0 35.6 38.0 90-94 36.89435 38.0 38.0 38.0 35.0 38.0 95-99 36.845299999999995 38.0 38.0 38.0 35.0 38.0 100-104 36.71955 38.0 38.0 38.0 34.6 38.0 105-109 36.50595 38.0 38.0 38.0 34.0 38.0 110-114 36.4072 38.0 37.6 38.0 33.8 38.0 115-119 36.255900000000004 38.0 37.4 38.0 33.6 38.0 120-124 36.089 38.0 37.0 38.0 33.0 38.0 125-129 36.06815 38.0 37.0 38.0 33.0 38.0 130-134 35.79885 38.0 36.4 38.0 32.0 38.0 135-139 35.48524999999999 38.0 35.8 38.0 31.0 38.0 140-144 35.1761 38.0 35.4 38.0 29.4 38.0 145-149 34.46035 38.0 35.0 38.0 27.0 38.0 150-151 30.298375 35.5 28.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 5.0 21 0.0 22 4.0 23 2.0 24 5.0 25 5.0 26 11.0 27 9.0 28 13.0 29 25.0 30 36.0 31 49.0 32 73.0 33 112.0 34 177.0 35 302.0 36 839.0 37 2332.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.48987854251012 13.689271255060728 8.628542510121457 45.19230769230769 2 19.0 13.600000000000001 38.05 29.349999999999998 3 19.004751187796952 15.9039759939985 26.456614153538382 38.63465866466617 4 24.525 24.099999999999998 22.675 28.7 5 25.624999999999996 30.349999999999998 23.025000000000002 21.0 6 21.825 33.15 24.75 20.275000000000002 7 16.75 26.625 39.85 16.775000000000002 8 19.5 25.424999999999997 31.7 23.375 9 19.875 22.75 34.325 23.05 10-14 21.07 28.765 26.96 23.205000000000002 15-19 22.155 27.334999999999997 27.16 23.35 20-24 21.851092554627733 28.056402820141006 27.36136806840342 22.731136556827842 25-29 21.605 28.050000000000004 26.884999999999998 23.46 30-34 21.87 28.42 26.365 23.345 35-39 21.87 27.82 26.905 23.405 40-44 21.85 27.425 27.465 23.26 45-49 21.735 27.73 26.979999999999997 23.555 50-54 21.89 27.435 26.729999999999997 23.945 55-59 21.55 27.57 27.02 23.86 60-64 21.695 27.405 27.16 23.74 65-69 21.55 27.54 27.045 23.865 70-74 21.815 27.365000000000002 26.805 24.015 75-79 21.8 27.150000000000002 26.87 24.18 80-84 22.14 26.945000000000004 27.474999999999998 23.44 85-89 21.65 27.375 27.089999999999996 23.885 90-94 21.78 27.33 26.88 24.01 95-99 21.745 27.195000000000004 26.75 24.310000000000002 100-104 21.897189718971894 27.217721772177217 27.18771877187719 23.697369736973698 105-109 22.155 27.36 27.07 23.415 110-114 22.410602650662664 28.367091772943237 26.316579144786196 22.9057264316079 115-119 22.099364586981537 28.068244358833244 26.64732075849302 23.1850702956922 120-124 22.18 27.265 26.784999999999997 23.77 125-129 22.631973980485366 27.60570427820866 26.4848636477358 23.27745809357018 130-134 22.123849539815925 27.140856342537017 26.95578231292517 23.77951180472189 135-139 22.13 27.355 26.095000000000002 24.42 140-144 21.91 27.08 27.034999999999997 23.974999999999998 145-149 22.23 27.27 26.46 24.04 150-151 22.162499999999998 26.9125 26.3125 24.6125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 1.0 27 3.5 28 5.0 29 7.5 30 10.0 31 15.0 32 21.5 33 25.0 34 33.0 35 54.0 36 73.0 37 93.0 38 117.0 39 156.0 40 187.0 41 219.5 42 263.5 43 255.5 44 253.0 45 261.5 46 236.0 47 208.5 48 203.5 49 200.0 50 177.0 51 139.0 52 107.0 53 91.0 54 77.5 55 73.5 56 58.0 57 45.5 58 42.0 59 41.5 60 37.5 61 30.0 62 32.5 63 27.0 64 21.5 65 21.0 66 14.5 67 11.0 68 13.0 69 11.0 70 7.0 71 3.5 72 3.0 73 3.0 74 2.5 75 1.5 76 2.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.2 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.01 105-109 0.0 110-114 0.025 115-119 0.065 120-124 0.0 125-129 0.075 130-134 0.04 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.38749999999999996 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.6625000000000001 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 1.0125 0.0 0.0 0.0 0.0 116-117 1.2625000000000002 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.9625 0.0 0.0 0.0 0.0 124-125 2.1125 0.0 0.0 0.0 0.0 126-127 2.2875 0.0 0.0 0.0 0.0 128-129 2.5875 0.0 0.0 0.0 0.0 130-131 2.8875 0.0 0.0 0.0 0.0 132-133 3.175 0.0 0.0 0.0 0.0 134-135 3.4375 0.0 0.0 0.0 0.0 136-137 3.6875 0.0 0.0 0.0 0.0 138-139 4.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGAGAG 10 0.006830828 145.0 1 GTTCTTG 10 0.006830828 145.0 1 CCCGTAT 10 0.006830828 145.0 1 TGAGAGA 10 0.006830828 145.0 2 >>END_MODULE SRR6958333 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958333_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.25225 33.0 33.0 34.0 33.0 34.0 2 33.3505 34.0 33.0 34.0 33.0 34.0 3 33.3705 34.0 33.0 34.0 33.0 34.0 4 33.2905 34.0 33.0 34.0 33.0 34.0 5 33.41175 34.0 33.0 34.0 33.0 34.0 6 37.5935 38.0 38.0 38.0 38.0 38.0 7 37.5945 38.0 38.0 38.0 38.0 38.0 8 37.596 38.0 38.0 38.0 38.0 38.0 9 37.556 38.0 38.0 38.0 38.0 38.0 10-14 36.94045 38.0 37.8 38.0 35.4 38.0 15-19 37.351299999999995 38.0 38.0 38.0 37.4 38.0 20-24 37.5064 38.0 38.0 38.0 38.0 38.0 25-29 37.49105 38.0 38.0 38.0 38.0 38.0 30-34 37.5909 38.0 38.0 38.0 38.0 38.0 35-39 36.96300000000001 38.0 38.0 38.0 36.0 38.0 40-44 37.480199999999996 38.0 38.0 38.0 37.8 38.0 45-49 37.21965 38.0 38.0 38.0 36.8 38.0 50-54 37.099650000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.6768 38.0 37.6 38.0 33.6 38.0 60-64 37.50775 38.0 38.0 38.0 38.0 38.0 65-69 37.18044999999999 38.0 38.0 38.0 36.8 38.0 70-74 37.4034 38.0 38.0 38.0 37.4 38.0 75-79 36.99985 38.0 38.0 38.0 36.0 38.0 80-84 37.36965 38.0 38.0 38.0 37.2 38.0 85-89 37.3431 38.0 38.0 38.0 37.4 38.0 90-94 37.18925 38.0 38.0 38.0 37.0 38.0 95-99 37.2312 38.0 38.0 38.0 37.0 38.0 100-104 36.43685 38.0 37.6 38.0 33.2 38.0 105-109 36.17125 38.0 37.2 38.0 30.0 38.0 110-114 36.7444 38.0 38.0 38.0 34.8 38.0 115-119 36.9644 38.0 38.0 38.0 36.0 38.0 120-124 36.81595 38.0 38.0 38.0 35.4 38.0 125-129 36.637699999999995 38.0 38.0 38.0 35.0 38.0 130-134 36.400099999999995 38.0 38.0 38.0 34.2 38.0 135-139 36.100350000000006 38.0 38.0 38.0 33.8 38.0 140-144 35.4207 38.0 36.4 38.0 31.8 38.0 145-149 35.16029999999999 38.0 36.0 38.0 31.0 38.0 150-151 30.1695 35.5 28.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 1.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 2.0 17 2.0 18 2.0 19 1.0 20 2.0 21 0.0 22 2.0 23 4.0 24 6.0 25 7.0 26 13.0 27 18.0 28 13.0 29 13.0 30 24.0 31 32.0 32 47.0 33 53.0 34 124.0 35 210.0 36 574.0 37 2843.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.475 19.400000000000002 12.35 34.775 2 27.35 23.875 31.624999999999996 17.150000000000002 3 21.75 26.625 29.15 22.475 4 25.05 31.175000000000004 21.625 22.15 5 27.500000000000004 33.550000000000004 21.525 17.424999999999997 6 21.975 37.225 21.5 19.3 7 21.975 20.349999999999998 37.375 20.3 8 22.75 24.85 26.775 25.624999999999996 9 22.725 24.65 30.025000000000002 22.6 10-14 24.755 27.465 24.895 22.884999999999998 15-19 24.32 26.284999999999997 26.200000000000003 23.195 20-24 24.16 27.384999999999998 26.1 22.355 25-29 24.275 27.27 25.765 22.689999999999998 30-34 24.21 27.505000000000003 26.169999999999998 22.115000000000002 35-39 24.565 26.99 26.119999999999997 22.325 40-44 24.21 27.27 26.325 22.195 45-49 24.165 26.68 26.76 22.395 50-54 24.295 27.38 26.075 22.25 55-59 24.46 26.974999999999998 26.35 22.215 60-64 23.915 27.015 26.790000000000003 22.28 65-69 23.955000000000002 27.175 26.595000000000002 22.275 70-74 24.68 26.045 27.474999999999998 21.8 75-79 24.285 26.590000000000003 27.400000000000002 21.725 80-84 24.224999999999998 27.060000000000002 26.345000000000002 22.37 85-89 23.76 26.705000000000002 26.955000000000002 22.58 90-94 24.165 26.815 26.915 22.105 95-99 23.73 28.005000000000003 26.35 21.915000000000003 100-104 24.435000000000002 27.02 26.595000000000002 21.95 105-109 23.9 28.025 26.305 21.77 110-114 24.490000000000002 27.425 26.915 21.17 115-119 24.585 26.665 27.045 21.705 120-124 23.855 27.32 26.965 21.86 125-129 24.709999999999997 27.389999999999997 26.3 21.6 130-134 24.115000000000002 27.525 26.705000000000002 21.654999999999998 135-139 24.65 27.450000000000003 26.985 20.915 140-144 24.805 26.924999999999997 27.029999999999998 21.240000000000002 145-149 24.58 26.82 27.255000000000003 21.345 150-151 25.137500000000003 27.700000000000003 26.35 20.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 1.0 26 2.0 27 3.0 28 3.0 29 6.0 30 15.0 31 17.5 32 15.0 33 22.5 34 32.0 35 38.5 36 56.0 37 73.0 38 107.5 39 150.5 40 177.0 41 200.0 42 209.5 43 227.5 44 247.0 45 245.0 46 250.0 47 248.0 48 213.0 49 185.5 50 166.0 51 134.5 52 116.5 53 107.5 54 91.0 55 70.0 56 60.0 57 64.0 58 70.5 59 58.5 60 48.0 61 44.0 62 40.5 63 40.5 64 27.5 65 22.5 66 21.0 67 16.5 68 13.0 69 10.5 70 9.0 71 5.0 72 2.0 73 3.0 74 3.5 75 3.0 76 2.5 77 0.5 78 0.5 79 1.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29471032745592 98.55000000000001 2 0.654911838790932 1.3 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.38749999999999996 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.6375 0.0 0.0 0.0 0.0 110-111 0.7125 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 0.9874999999999999 0.0 0.0 0.0 0.0 116-117 1.2374999999999998 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.9874999999999998 0.0 0.0 0.0 0.0 124-125 2.1375 0.0 0.0 0.0 0.0 126-127 2.325 0.0 0.0 0.0 0.0 128-129 2.5999999999999996 0.0 0.0 0.0 0.0 130-131 2.9000000000000004 0.0 0.0 0.0 0.0 132-133 3.2 0.0 0.0 0.0 0.0 134-135 3.4625 0.0 0.0 0.0 0.0 136-137 3.7125 0.0 0.0 0.0 0.0 138-139 4.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 545150 spots for SRR6958333.sra Written 545150 spots for SRR6958333.sra Read 545150 spots for SRR6958333.sra Written 545150 spots for SRR6958333.sra Read 545150 spots for SRR6958333.sra Written 545150 spots for SRR6958333.sra Read 545150 spots for SRR6958333.sra Written 545150 spots for SRR6958333.sra Read 545150 spots for SRR6958333.sra Written 545150 spots for SRR6958333.sra Read 545150 spots for SRR6958333.sra Written 545150 spots for SRR6958333.sra Read 545150 spots for SRR6958333.sra Written 545150 spots for SRR6958333.sra Read 545150 spots for SRR6958333.sra Written 545150 spots for SRR6958333.sra Read 545150 spots for SRR6958333.sra Written 545150 spots for SRR6958333.sra Read 545150 spots for SRR6958333.sra Written 545150 spots for SRR6958333.sra Read 545150 spots for SRR6958333.sra Written 545150 spots for SRR6958333.sra Read 545150 spots for SRR6958333.sra Written 545150 spots for SRR6958333.sra Read 545157 spots for SRR6958333.sra Written 545157 spots for SRR6958333.sra Read 545150 spots for SRR6958333.sra Written 545150 spots for SRR6958333.sra Read 545150 spots for SRR6958333.sra Written 545150 spots for SRR6958333.sra Read 545150 spots for SRR6958333.sra Written 545150 spots for SRR6958333.sra Read 545150 spots for SRR6958333.sra Written 545150 spots for SRR6958333.sra Read 545150 spots for SRR6958333.sra Written 545150 spots for SRR6958333.sra Read 545150 spots for SRR6958333.sra Written 545150 spots for SRR6958333.sra Read 545150 spots for SRR6958333.sra Written 545150 spots for SRR6958333.sra SRR ids: ['SRR6958333.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_revcs2_9 SRR6958333.sra spots: 10903007 blocks: [[1, 545150], [545151, 1090300], [1090301, 1635450], [1635451, 2180600], [2180601, 2725750], [2725751, 3270900], [3270901, 3816050], [3816051, 4361200], [4361201, 4906350], [4906351, 5451500], [5451501, 5996650], [5996651, 6541800], [6541801, 7086950], [7086951, 7632100], [7632101, 8177250], [8177251, 8722400], [8722401, 9267550], [9267551, 9812700], [9812701, 10357850], [10357851, 10903007]] SRR6958333 file size 3672970 SRR6958333 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958333 SRR6958333_1.fastq SRR6958333_2.fastq Input file: SRR6958333_1.fastq Paired file: SRR6958333_2.fastq trimmed: SRR6958333-trimmed-pair1.fastq, SRR6958333-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:10:12 2024 >> started Fri Dec 6 20:10:27 2024 >> done (14.921s) 10903007 read pairs processed; of these: 4931 ( 0.05%) short read pairs filtered out after trimming by size control 3056 ( 0.03%) empty read pairs filtered out after trimming by size control 10895020 (99.93%) read pairs available; of these: 3747393 (34.40%) trimmed read pairs available after processing 7147627 (65.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 7 0.00% 20 0 0.00% 21 4 0.00% 22 3 0.00% 23 3 0.00% 24 4 0.00% 25 0 0.00% 26 5 0.00% 27 1 0.00% 28 3 0.00% 29 2 0.00% 30 1 0.00% 31 2 0.00% 32 3 0.00% 33 3 0.00% 34 5 0.00% 35 3 0.00% 36 5 0.00% 37 6 0.00% 38 3 0.00% 39 6 0.00% 40 0 0.00% 41 6 0.00% 42 4 0.00% 43 2 0.00% 44 6 0.00% 45 5 0.00% 46 9 0.00% 47 14 0.00% 48 8 0.00% 49 10 0.00% 50 14 0.00% 51 16 0.00% 52 20 0.00% 53 14 0.00% 54 18 0.00% 55 19 0.00% 56 21 0.00% 57 20 0.00% 58 24 0.00% 59 30 0.00% 60 31 0.00% 61 30 0.00% 62 58 0.00% 63 60 0.00% 64 50 0.00% 65 57 0.00% 66 74 0.00% 67 88 0.00% 68 90 0.00% 69 105 0.00% 70 115 0.00% 71 97 0.00% 72 146 0.00% 73 177 0.00% 74 208 0.00% 75 209 0.00% 76 266 0.00% 77 319 0.00% 78 290 0.00% 79 342 0.00% 80 401 0.00% 81 428 0.00% 82 506 0.00% 83 569 0.01% 84 786 0.01% 85 908 0.01% 86 996 0.01% 87 1117 0.01% 88 1235 0.01% 89 1344 0.01% 90 1442 0.01% 91 1661 0.02% 92 1930 0.02% 93 1844 0.02% 94 2157 0.02% 95 2267 0.02% 96 2420 0.02% 97 2508 0.02% 98 2752 0.03% 99 2932 0.03% 100 3482 0.03% 101 3562 0.03% 102 3859 0.04% 103 4215 0.04% 104 4511 0.04% 105 4764 0.04% 106 5215 0.05% 107 5635 0.05% 108 5942 0.05% 109 6217 0.06% 110 6569 0.06% 111 6906 0.06% 112 7318 0.07% 113 7715 0.07% 114 8417 0.08% 115 8925 0.08% 116 9554 0.09% 117 9944 0.09% 118 10112 0.09% 119 10505 0.10% 120 11113 0.10% 121 11812 0.11% 122 12457 0.11% 123 13113 0.12% 124 13735 0.13% 125 14518 0.13% 126 15114 0.14% 127 15561 0.14% 128 16539 0.15% 129 17345 0.16% 130 18287 0.17% 131 19293 0.18% 132 20311 0.19% 133 21637 0.20% 134 22348 0.21% 135 23886 0.22% 136 25058 0.23% 137 26963 0.25% 138 28254 0.26% 139 30602 0.28% 140 33023 0.30% 141 35739 0.33% 142 40032 0.37% 143 44540 0.41% 144 50959 0.47% 145 60607 0.56% 146 75869 0.70% 147 104009 0.95% 148 162234 1.49% 149 341946 3.14% 150 2253776 20.69% 151 7147627 65.60% 10895020 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=3.04 fanout-score-rank=22 prefix-density=0.64 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=75.37 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.3 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=20 prefix-density=0.45 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=25.85 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=4.4 sequence=AAGCAGAAGCTCCCCAAGATGATCTACGACTACTACGCCTCCGGCGCCGAGGATGAGTGGACGCTCCAGGAGAACAGGGAGGCCTTCGCCAGGATCTTGTTCCGCCCGCGCATACTGATCGACGTATCCAAGATTGACATGAC SRR6958333 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:11:11 Started mapping on | Dec 06 20:11:11 Finished on | Dec 06 20:12:12 Mapping speed, Million of reads per hour | 642.98 Number of input reads | 10895020 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 10684001 Uniquely mapped reads % | 98.06% Average mapped length | 298.00 Number of splices: Total | 12848865 Number of splices: Annotated (sjdb) | 12110267 Number of splices: GT/AG | 12689141 Number of splices: GC/AG | 146070 Number of splices: AT/AC | 5151 Number of splices: Non-canonical | 8503 Mismatch rate per base, % | 0.08% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 69270 % of reads mapped to multiple loci | 0.64% Number of reads mapped to too many loci | 6056 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.91% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 143910 143910 143910 N_multimapping 69270 69270 69270 N_noFeature 389604 10381249 477661 N_ambiguous 251905 1330 37848 UnstrandedReadsAssigned:10042492 PositiveStrandReadsAssigned:301422 NegativeStrandReadsAssigned:10168492 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958333 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958333-trimmed-pair1.fastq SRR6958333-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,895,020 reads, 10,182,981 reads pseudoaligned [quant] estimated average fragment length: 237.719 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,148 rounds 52973 SRR6958333.ke.tsv 35125 SRR6958333.se.tsv 88098 total ==> SRR6958333.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 699.676 0 0 PNS24247 1044 807.281 27.7936 5.37699 PNS24249 1928 1691.28 11.0136 1.01703 PNS24246 1044 807.281 27.7936 5.37699 PNS24248 1044 807.281 27.7936 5.37699 PNS24244 1471 1234.28 18.6055 2.35422 PNS24243 293 84.149 0 0 KQK14069 1603 1366.28 2984.41 341.143 KQK14071 474 241.063 32.9282 21.3332 ==> SRR6958333.se.tsv <== BRADI_1g14170v3 3311 BRADI_1g53295v3 122 BRADI_1g59795v3 131 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 122 BRADI_1g74790v3 37 BRADI_1g09890v3 0 BRADI_1g77505v3 143 BRADI_1g48960v3 0 SRR6958333 completed mapping pipeline successfully