Starting /dee2/code/volunteer_pipeline.sh SRR6958334 current disk space = 1549629489152 free memory = 1598083168 SRR6958334 SRAfilesize 400f13271515c788d4c98b3d09514e74 SRR6958334.sra SRR6958334.sra file validated SRR6958334 is paired end SRR6958334 is conventional basespace SRR6958334 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958334_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.3365 33.0 32.0 33.0 18.0 34.0 2 31.84575 33.0 31.0 34.0 28.0 34.0 3 32.338 33.0 33.0 34.0 29.0 34.0 4 32.60775 33.0 33.0 34.0 31.0 34.0 5 32.6035 33.0 33.0 34.0 32.0 34.0 6 36.73225 38.0 37.0 38.0 34.0 38.0 7 37.095 38.0 38.0 38.0 36.0 38.0 8 37.133 38.0 38.0 38.0 36.0 38.0 9 37.34825 38.0 38.0 38.0 37.0 38.0 10-14 37.40715 38.0 38.0 38.0 37.0 38.0 15-19 37.298899999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.415 38.0 38.0 38.0 37.0 38.0 25-29 37.3267 38.0 38.0 38.0 37.0 38.0 30-34 37.2651 38.0 38.0 38.0 36.6 38.0 35-39 37.13195 38.0 38.0 38.0 36.4 38.0 40-44 37.079150000000006 38.0 38.0 38.0 36.0 38.0 45-49 37.229400000000005 38.0 38.0 38.0 36.4 38.0 50-54 37.0336 38.0 38.0 38.0 35.6 38.0 55-59 36.844049999999996 38.0 38.0 38.0 35.2 38.0 60-64 36.86465 38.0 38.0 38.0 35.2 38.0 65-69 37.04855 38.0 38.0 38.0 36.0 38.0 70-74 37.0001 38.0 38.0 38.0 35.4 38.0 75-79 36.82255 38.0 38.0 38.0 35.0 38.0 80-84 36.55265 38.0 38.0 38.0 34.0 38.0 85-89 36.3708 38.0 37.6 38.0 33.8 38.0 90-94 36.52310000000001 38.0 38.0 38.0 34.0 38.0 95-99 36.546499999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.30075 38.0 37.0 38.0 33.2 38.0 105-109 36.098299999999995 38.0 37.0 38.0 33.2 38.0 110-114 35.77145 38.0 36.4 38.0 31.4 38.0 115-119 35.7039 38.0 36.0 38.0 31.4 38.0 120-124 35.44155 38.0 36.0 38.0 29.8 38.0 125-129 35.282799999999995 38.0 35.2 38.0 29.2 38.0 130-134 35.13445 38.0 35.2 38.0 28.2 38.0 135-139 34.647749999999995 38.0 35.0 38.0 27.2 38.0 140-144 34.30495 38.0 34.6 38.0 25.2 38.0 145-149 33.51905000000001 38.0 34.2 38.0 20.0 38.0 150-151 29.1875 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 0.0 16 0.0 17 3.0 18 2.0 19 0.0 20 2.0 21 0.0 22 5.0 23 8.0 24 6.0 25 11.0 26 11.0 27 17.0 28 29.0 29 49.0 30 47.0 31 67.0 32 94.0 33 156.0 34 219.0 35 365.0 36 794.0 37 2113.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.687258687258684 10.012870012870014 8.236808236808237 43.06306306306306 2 21.95 11.75 37.724999999999994 28.575 3 19.6 14.299999999999999 25.124999999999996 40.975 4 24.825 22.875 22.05 30.25 5 25.525 28.275 24.975 21.224999999999998 6 22.275 31.5 23.825 22.400000000000002 7 19.15 24.175 36.7 19.975 8 21.375 24.05 29.075 25.5 9 19.25 22.425 32.45 25.874999999999996 10-14 23.03 26.119999999999997 25.795 25.055 15-19 22.945 24.965 26.1 25.990000000000002 20-24 22.625 25.505 25.995 25.874999999999996 25-29 23.05 25.46 25.8 25.69 30-34 23.565 25.685000000000002 25.595000000000002 25.155 35-39 23.04 24.87 26.279999999999998 25.81 40-44 23.125 25.115 25.729999999999997 26.029999999999998 45-49 22.945 25.095 25.655 26.305 50-54 22.74 25.535000000000004 26.165 25.56 55-59 23.39 25.34 25.580000000000002 25.69 60-64 23.16 25.040000000000003 26.075 25.724999999999998 65-69 22.96 24.97 26.395000000000003 25.674999999999997 70-74 23.485 24.485 26.040000000000003 25.990000000000002 75-79 23.32 25.019999999999996 25.865 25.795 80-84 23.085 25.369999999999997 25.95 25.595000000000002 85-89 23.645 24.925 25.305 26.125 90-94 23.865 24.955 25.990000000000002 25.19 95-99 23.33116655832792 24.616230811540575 25.73628681434072 26.31631581579079 100-104 23.405 24.81 26.36 25.424999999999997 105-109 23.228484272640895 24.953743061459218 25.553833074961247 26.26393959093864 110-114 23.419999999999998 25.169999999999998 25.955000000000002 25.455 115-119 23.705000000000002 25.045 25.305 25.945 120-124 23.599999999999998 24.805 25.569999999999997 26.025 125-129 23.794999999999998 24.335 25.8 26.07 130-134 24.175 25.06 25.06 25.705 135-139 23.562356235623565 25.132513251325133 24.792479247924792 26.512651265126514 140-144 24.044999999999998 24.88 25.319999999999997 25.755 145-149 23.855 25.285000000000004 25.290000000000003 25.569999999999997 150-151 23.424212106053027 24.83741870935468 25.175087543771884 26.563281640820406 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 0.5 26 0.0 27 1.5 28 3.5 29 4.0 30 6.0 31 12.0 32 15.5 33 16.0 34 25.5 35 31.5 36 38.0 37 56.0 38 73.0 39 95.5 40 118.0 41 150.5 42 177.0 43 197.5 44 199.5 45 194.0 46 218.0 47 214.0 48 201.0 49 204.0 50 175.0 51 138.5 52 118.5 53 110.0 54 112.0 55 99.0 56 95.5 57 95.5 58 82.5 59 77.5 60 79.5 61 83.5 62 75.5 63 63.5 64 59.0 65 51.0 66 39.5 67 32.0 68 30.0 69 27.5 70 25.5 71 23.0 72 14.0 73 9.0 74 10.5 75 8.0 76 4.0 77 2.0 78 1.0 79 1.5 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.015 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14184755174155 98.2 2 0.7571933366986371 1.5 3 0.10095911155981827 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.7125 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 0.9 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.1125 0.0 0.0 0.0 0.0 122-123 1.2125 0.0 0.0 0.0 0.0 124-125 1.375 0.0 0.0 0.0 0.0 126-127 1.5875 0.0 0.0 0.0 0.0 128-129 1.775 0.0 0.0 0.0 0.0 130-131 2.0125 0.0 0.0 0.0 0.0 132-133 2.2375 0.0 0.0 0.0 0.0 134-135 2.5 0.0 0.0 0.0 0.0 136-137 2.8 0.0 0.0 0.0 0.0 138-139 2.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958334 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958334_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8975 33.0 33.0 34.0 32.0 34.0 2 32.871 33.0 33.0 34.0 32.0 34.0 3 32.90625 34.0 33.0 34.0 32.0 34.0 4 32.90625 34.0 33.0 34.0 32.0 34.0 5 32.8235 34.0 33.0 34.0 32.0 34.0 6 37.141 38.0 38.0 38.0 37.0 38.0 7 36.9855 38.0 38.0 38.0 36.0 38.0 8 37.005 38.0 38.0 38.0 36.0 38.0 9 36.873 38.0 38.0 38.0 36.0 38.0 10-14 36.954750000000004 38.0 38.0 38.0 36.0 38.0 15-19 36.876599999999996 38.0 38.0 38.0 35.6 38.0 20-24 36.908699999999996 38.0 38.0 38.0 35.8 38.0 25-29 36.959500000000006 38.0 38.0 38.0 36.0 38.0 30-34 37.000699999999995 38.0 38.0 38.0 36.0 38.0 35-39 36.935500000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.897450000000006 38.0 38.0 38.0 35.8 38.0 45-49 36.8277 38.0 38.0 38.0 35.8 38.0 50-54 36.7148 38.0 38.0 38.0 35.0 38.0 55-59 36.8001 38.0 38.0 38.0 35.2 38.0 60-64 36.7533 38.0 38.0 38.0 35.0 38.0 65-69 36.6708 38.0 38.0 38.0 34.6 38.0 70-74 36.50165 38.0 38.0 38.0 34.0 38.0 75-79 36.24250000000001 38.0 38.0 38.0 33.2 38.0 80-84 36.1543 38.0 38.0 38.0 33.2 38.0 85-89 36.06925 38.0 37.6 38.0 33.0 38.0 90-94 35.95915 38.0 37.4 38.0 32.6 38.0 95-99 35.84695 38.0 37.0 38.0 32.0 38.0 100-104 35.70365 38.0 36.8 38.0 31.4 38.0 105-109 35.51005 38.0 36.8 38.0 30.6 38.0 110-114 35.22089999999999 38.0 36.0 38.0 29.0 38.0 115-119 34.9716 38.0 35.2 38.0 27.8 38.0 120-124 34.9308 38.0 35.4 38.0 27.8 38.0 125-129 34.730999999999995 38.0 35.0 38.0 26.8 38.0 130-134 34.375499999999995 38.0 35.0 38.0 25.0 38.0 135-139 33.8283 38.0 34.2 38.0 22.6 38.0 140-144 33.54855 38.0 34.0 38.0 21.4 38.0 145-149 32.7504 38.0 33.4 38.0 16.4 38.0 150-151 27.470875 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 4.0 4 0.0 5 0.0 6 2.0 7 0.0 8 0.0 9 1.0 10 1.0 11 5.0 12 2.0 13 0.0 14 4.0 15 2.0 16 1.0 17 5.0 18 6.0 19 2.0 20 8.0 21 9.0 22 9.0 23 11.0 24 16.0 25 17.0 26 22.0 27 30.0 28 32.0 29 48.0 30 70.0 31 74.0 32 119.0 33 147.0 34 234.0 35 303.0 36 694.0 37 2118.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.025 16.975 11.975 37.025000000000006 2 27.41370685342671 24.262131065532767 28.68934467233617 19.634817408704354 3 22.91718789091819 24.86865148861646 27.120340255191394 25.093820365273956 4 25.64423317488116 29.597197898423815 20.390292719539655 24.36827620715537 5 26.776776776776778 32.95795795795796 20.32032032032032 19.944944944944947 6 22.725 34.875 20.1 22.3 7 23.525 18.575 35.099999999999994 22.8 8 24.775 22.85 24.15 28.225 9 24.6 23.400000000000002 26.775 25.224999999999998 10-14 25.895000000000003 25.915 23.400000000000002 24.79 15-19 25.535000000000004 25.335 24.2 24.93 20-24 25.979999999999997 25.795 24.025 24.2 25-29 26.053908086212935 25.578836825523826 23.98859828974346 24.378656798519778 30-34 25.21 25.165 24.63 24.995 35-39 25.380000000000003 26.200000000000003 24.33 24.09 40-44 25.885 25.535000000000004 24.0 24.58 45-49 25.255 25.53 24.75 24.465 50-54 25.740000000000002 25.569999999999997 24.775 23.915 55-59 25.915 25.545 24.03 24.51 60-64 26.43 24.91 24.04 24.62 65-69 25.490000000000002 25.27 24.654999999999998 24.585 70-74 26.43 24.915000000000003 24.175 24.48 75-79 25.855 25.16 24.34 24.645 80-84 25.7 25.905 24.115000000000002 24.279999999999998 85-89 26.43 25.295 24.22 24.055 90-94 26.169999999999998 25.185000000000002 24.605 24.04 95-99 26.19 25.745 24.425 23.64 100-104 25.82 25.540000000000003 24.45 24.19 105-109 25.955000000000002 25.669999999999998 24.48 23.895 110-114 26.227622762276226 25.802580258025802 24.412441244124413 23.557355735573555 115-119 26.02780834250275 25.982794838451532 24.387316194858457 23.602080624187256 120-124 25.99629981499075 25.51627581379069 24.436221811090554 24.051202560128008 125-129 26.779999999999998 25.624999999999996 24.245 23.35 130-134 26.450000000000003 25.180000000000003 24.88 23.49 135-139 26.19 25.615 24.654999999999998 23.54 140-144 26.705000000000002 26.125 24.305 22.865 145-149 27.024053608041203 26.208931339700953 23.848577286592988 22.91843776566485 150-151 26.775887943971988 26.688344172086044 23.424212106053027 23.111555777888945 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 0.5 28 1.5 29 5.5 30 10.5 31 10.5 32 11.5 33 13.0 34 18.5 35 27.5 36 37.5 37 56.5 38 66.5 39 82.5 40 122.5 41 141.0 42 147.5 43 174.5 44 184.0 45 186.5 46 186.0 47 183.5 48 202.5 49 184.0 50 159.0 51 149.5 52 126.0 53 117.0 54 107.5 55 96.0 56 99.5 57 101.0 58 92.5 59 102.5 60 110.0 61 90.0 62 74.0 63 71.5 64 65.0 65 52.0 66 57.0 67 55.5 68 44.5 69 37.0 70 28.0 71 29.0 72 25.0 73 19.0 74 15.0 75 8.5 76 4.5 77 3.0 78 2.5 79 2.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.075 4 0.075 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.015 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.01 115-119 0.03 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.015 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01390644753477 97.89999999999999 2 0.8343868520859671 1.6500000000000001 3 0.15170670037926676 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5875 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.1124999999999998 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.4500000000000002 0.0 0.0 0.0 0.0 126-127 1.6625 0.0 0.0 0.0 0.0 128-129 1.8250000000000002 0.0 0.0 0.0 0.0 130-131 2.0625 0.0 0.0 0.0 0.0 132-133 2.2875 0.0 0.0 0.0 0.0 134-135 2.55 0.0 0.0 0.0 0.0 136-137 2.8499999999999996 0.0 0.0 0.0 0.0 138-139 3.0250000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1039911 spots for SRR6958334.sra Written 1039911 spots for SRR6958334.sra Read 1039911 spots for SRR6958334.sra Written 1039911 spots for SRR6958334.sra Read 1039911 spots for SRR6958334.sra Written 1039911 spots for SRR6958334.sra Read 1039911 spots for SRR6958334.sra Written 1039911 spots for SRR6958334.sra Read 1039911 spots for SRR6958334.sra Written 1039911 spots for SRR6958334.sra Read 1039911 spots for SRR6958334.sra Written 1039911 spots for SRR6958334.sra Read 1039911 spots for SRR6958334.sra Written 1039911 spots for SRR6958334.sra Read 1039911 spots for SRR6958334.sra Written 1039911 spots for SRR6958334.sra Read 1039911 spots for SRR6958334.sra Written 1039911 spots for SRR6958334.sra Read 1039911 spots for SRR6958334.sra Written 1039911 spots for SRR6958334.sra Read 1039911 spots for SRR6958334.sra Written 1039911 spots for SRR6958334.sra Read 1039911 spots for SRR6958334.sra Written 1039911 spots for SRR6958334.sra Read 1039922 spots for SRR6958334.sra Written 1039922 spots for SRR6958334.sra Read 1039911 spots for SRR6958334.sra Written 1039911 spots for SRR6958334.sra Read 1039911 spots for SRR6958334.sra Written 1039911 spots for SRR6958334.sra Read 1039911 spots for SRR6958334.sra Written 1039911 spots for SRR6958334.sra Read 1039911 spots for SRR6958334.sra Written 1039911 spots for SRR6958334.sra Read 1039911 spots for SRR6958334.sra Written 1039911 spots for SRR6958334.sra Read 1039911 spots for SRR6958334.sra Written 1039911 spots for SRR6958334.sra Read 1039911 spots for SRR6958334.sra Written 1039911 spots for SRR6958334.sra SRR ids: ['SRR6958334.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8ki8crv2 SRR6958334.sra spots: 20798231 blocks: [[1, 1039911], [1039912, 2079822], [2079823, 3119733], [3119734, 4159644], [4159645, 5199555], [5199556, 6239466], [6239467, 7279377], [7279378, 8319288], [8319289, 9359199], [9359200, 10399110], [10399111, 11439021], [11439022, 12478932], [12478933, 13518843], [13518844, 14558754], [14558755, 15598665], [15598666, 16638576], [16638577, 17678487], [17678488, 18718398], [18718399, 19758309], [19758310, 20798231]] SRR6958334 file size 7026137 SRR6958334 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958334 SRR6958334_1.fastq SRR6958334_2.fastq Input file: SRR6958334_1.fastq Paired file: SRR6958334_2.fastq trimmed: SRR6958334-trimmed-pair1.fastq, SRR6958334-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:13:49 2024 >> started Fri Dec 6 20:14:11 2024 >> done (21.342s) 20798231 read pairs processed; of these: 10480 ( 0.05%) short read pairs filtered out after trimming by size control 6979 ( 0.03%) empty read pairs filtered out after trimming by size control 20780772 (99.92%) read pairs available; of these: 7629176 (36.71%) trimmed read pairs available after processing 13151596 (63.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 1 0.00% 20 2 0.00% 21 5 0.00% 22 3 0.00% 23 3 0.00% 24 3 0.00% 25 2 0.00% 26 6 0.00% 27 8 0.00% 28 7 0.00% 29 11 0.00% 30 5 0.00% 31 8 0.00% 32 6 0.00% 33 10 0.00% 34 10 0.00% 35 12 0.00% 36 14 0.00% 37 6 0.00% 38 14 0.00% 39 10 0.00% 40 13 0.00% 41 10 0.00% 42 11 0.00% 43 12 0.00% 44 12 0.00% 45 23 0.00% 46 25 0.00% 47 25 0.00% 48 19 0.00% 49 23 0.00% 50 39 0.00% 51 42 0.00% 52 40 0.00% 53 48 0.00% 54 45 0.00% 55 47 0.00% 56 65 0.00% 57 64 0.00% 58 81 0.00% 59 91 0.00% 60 99 0.00% 61 116 0.00% 62 144 0.00% 63 135 0.00% 64 161 0.00% 65 161 0.00% 66 183 0.00% 67 236 0.00% 68 241 0.00% 69 252 0.00% 70 309 0.00% 71 329 0.00% 72 360 0.00% 73 440 0.00% 74 496 0.00% 75 518 0.00% 76 601 0.00% 77 643 0.00% 78 698 0.00% 79 778 0.00% 80 928 0.00% 81 1003 0.00% 82 1184 0.01% 83 1317 0.01% 84 2000 0.01% 85 2336 0.01% 86 2503 0.01% 87 2686 0.01% 88 2830 0.01% 89 2885 0.01% 90 3233 0.02% 91 3515 0.02% 92 3694 0.02% 93 4021 0.02% 94 4411 0.02% 95 4575 0.02% 96 4947 0.02% 97 5410 0.03% 98 5642 0.03% 99 6156 0.03% 100 6507 0.03% 101 6928 0.03% 102 7418 0.04% 103 7994 0.04% 104 8502 0.04% 105 8774 0.04% 106 9611 0.05% 107 10150 0.05% 108 10495 0.05% 109 11390 0.05% 110 12001 0.06% 111 12600 0.06% 112 13313 0.06% 113 14105 0.07% 114 14940 0.07% 115 15938 0.08% 116 16740 0.08% 117 17851 0.09% 118 18942 0.09% 119 19656 0.09% 120 20700 0.10% 121 21704 0.10% 122 22593 0.11% 123 23441 0.11% 124 25198 0.12% 125 26136 0.13% 126 27698 0.13% 127 29755 0.14% 128 30991 0.15% 129 32213 0.16% 130 34206 0.16% 131 36392 0.18% 132 38399 0.18% 133 40848 0.20% 134 43352 0.21% 135 46437 0.22% 136 48917 0.24% 137 52250 0.25% 138 56026 0.27% 139 61081 0.29% 140 66670 0.32% 141 72122 0.35% 142 81187 0.39% 143 92825 0.45% 144 107985 0.52% 145 131541 0.63% 146 165688 0.80% 147 228254 1.10% 148 358449 1.72% 149 749345 3.61% 150 4539856 21.85% 151 13151596 63.29% 20780772 reads passed initial QC criterion=sequence-density sequence-density=1.03 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=24 prefix-density=1.08 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=40.69 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.0 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=3.63 fanout-score-rank=13 prefix-density=0.76 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=27.88 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=6.4 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958334 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:14:51 Started mapping on | Dec 06 20:14:51 Finished on | Dec 06 20:16:17 Mapping speed, Million of reads per hour | 869.89 Number of input reads | 20780772 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 20497555 Uniquely mapped reads % | 98.64% Average mapped length | 297.87 Number of splices: Total | 23967543 Number of splices: Annotated (sjdb) | 22634732 Number of splices: GT/AG | 23662193 Number of splices: GC/AG | 280923 Number of splices: AT/AC | 8991 Number of splices: Non-canonical | 15436 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.44 Insertion rate per base | 0.00% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 132498 % of reads mapped to multiple loci | 0.64% Number of reads mapped to too many loci | 11806 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.30% % of reads unmapped: other | 0.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 157562 157562 157562 N_multimapping 132498 132498 132498 N_noFeature 617626 19904705 771451 N_ambiguous 515096 2480 77595 UnstrandedReadsAssigned:19364833 PositiveStrandReadsAssigned:590370 NegativeStrandReadsAssigned:19648509 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958334 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958334-trimmed-pair1.fastq SRR6958334-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,780,772 reads, 19,654,761 reads pseudoaligned [quant] estimated average fragment length: 273.532 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52973 SRR6958334.ke.tsv 35125 SRR6958334.se.tsv 88098 total ==> SRR6958334.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 663.971 0 0 PNS24247 1044 771.468 56.8541 5.56023 PNS24249 1928 1655.47 32.8979 1.49933 PNS24246 1044 771.468 56.8541 5.56023 PNS24248 1044 771.468 56.8541 5.56023 PNS24244 1471 1198.47 27.5398 1.73373 PNS24243 293 77.909 0 0 KQK14069 1603 1330.47 6587.88 373.585 KQK14071 474 217.191 73.7522 25.6201 ==> SRR6958334.se.tsv <== BRADI_1g14170v3 7268 BRADI_1g53295v3 220 BRADI_1g59795v3 146 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 263 BRADI_1g74790v3 117 BRADI_1g09890v3 0 BRADI_1g77505v3 200 BRADI_1g48960v3 0 SRR6958334 completed mapping pipeline successfully