Starting /dee2/code/volunteer_pipeline.sh SRR6958335 current disk space = 1549563064320 free memory = 1600592276 SRR6958335 SRAfilesize 553a206a3033eefd071a3396bf2d5c16 SRR6958335.sra SRR6958335.sra file validated SRR6958335 is paired end SRR6958335 is conventional basespace SRR6958335 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958335_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.63825 25.0 18.0 32.0 18.0 33.0 2 26.8775 28.0 25.0 31.0 18.0 33.0 3 28.95675 30.0 27.0 33.0 25.0 33.0 4 30.7775 31.0 30.0 33.0 27.0 33.0 5 31.98775 33.0 32.0 33.0 31.0 33.0 6 36.37225 38.0 36.0 38.0 33.0 38.0 7 36.8555 38.0 37.0 38.0 35.0 38.0 8 36.88825 38.0 38.0 38.0 35.0 38.0 9 37.071 38.0 38.0 38.0 36.0 38.0 10-14 37.2846 38.0 38.0 38.0 36.4 38.0 15-19 37.336949999999995 38.0 38.0 38.0 36.8 38.0 20-24 37.3282 38.0 38.0 38.0 36.6 38.0 25-29 37.4479 38.0 38.0 38.0 37.0 38.0 30-34 37.277899999999995 38.0 38.0 38.0 36.6 38.0 35-39 37.23535 38.0 38.0 38.0 36.2 38.0 40-44 37.124199999999995 38.0 38.0 38.0 36.0 38.0 45-49 37.23325 38.0 38.0 38.0 36.4 38.0 50-54 37.074850000000005 38.0 38.0 38.0 35.6 38.0 55-59 36.5979 38.0 37.8 38.0 34.2 38.0 60-64 36.2155 38.0 37.0 38.0 32.8 38.0 65-69 35.8027 38.0 36.6 38.0 30.6 38.0 70-74 35.8762 38.0 36.8 38.0 30.4 38.0 75-79 36.384600000000006 38.0 37.2 38.0 33.6 38.0 80-84 36.433949999999996 38.0 37.4 38.0 33.8 38.0 85-89 36.2941 38.0 37.0 38.0 33.2 38.0 90-94 36.142399999999995 38.0 37.0 38.0 33.2 38.0 95-99 35.8619 38.0 36.6 38.0 31.4 38.0 100-104 35.444399999999995 38.0 35.8 38.0 29.4 38.0 105-109 35.025549999999996 38.0 35.2 38.0 27.8 38.0 110-114 34.338300000000004 38.0 34.2 38.0 25.0 38.0 115-119 33.8355 38.0 34.0 38.0 22.6 38.0 120-124 33.6411 37.6 33.8 38.0 22.4 38.0 125-129 34.332800000000006 38.0 34.0 38.0 24.4 38.0 130-134 34.30575 38.0 34.2 38.0 24.6 38.0 135-139 33.9935 38.0 34.0 38.0 23.0 38.0 140-144 33.43384999999999 38.0 33.8 38.0 20.2 38.0 145-149 32.2209 36.6 32.6 38.0 14.0 38.0 150-151 26.898375 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 2.0 19 1.0 20 1.0 21 1.0 22 8.0 23 10.0 24 11.0 25 13.0 26 21.0 27 33.0 28 29.0 29 58.0 30 83.0 31 109.0 32 139.0 33 219.0 34 350.0 35 603.0 36 1152.0 37 1155.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.127847761994104 16.483516483516482 7.611900294827125 42.77673545966229 2 22.55 14.95 30.25 32.25 3 19.725 18.65 22.900000000000002 38.725 4 26.125 25.900000000000002 19.975 28.000000000000004 5 24.056014003500874 30.457614403600903 24.10602650662666 21.380345086271568 6 21.099999999999998 32.0 24.224999999999998 22.675 7 16.35 23.525 40.425 19.7 8 20.474999999999998 23.425 28.575 27.525 9 19.900000000000002 21.425 33.35 25.324999999999996 10-14 22.96 27.52 25.564999999999998 23.955000000000002 15-19 22.18 26.369999999999997 26.16 25.290000000000003 20-24 22.985 25.86 26.484999999999996 24.67 25-29 22.49 25.924999999999997 26.474999999999998 25.11 30-34 21.89 26.1 26.424999999999997 25.585 35-39 22.905 26.25 25.490000000000002 25.355 40-44 22.57 26.515 26.340000000000003 24.575 45-49 22.675 26.16 25.679999999999996 25.485000000000003 50-54 22.03 25.729999999999997 27.345000000000002 24.895 55-59 22.93 26.015 25.745 25.31 60-64 22.415 25.745 26.284999999999997 25.555 65-69 22.37 25.779999999999998 26.43 25.419999999999998 70-74 22.845 25.290000000000003 26.169999999999998 25.695 75-79 22.85 25.39 26.085 25.674999999999997 80-84 22.74 25.979999999999997 26.555 24.725 85-89 23.275000000000002 25.575 25.97 25.180000000000003 90-94 23.575 25.715 25.264999999999997 25.445 95-99 22.405 25.759999999999998 26.540000000000003 25.295 100-104 23.345 25.6 26.735 24.32 105-109 22.98 25.705 25.96 25.355 110-114 22.495 25.629999999999995 26.355 25.52 115-119 23.205000000000002 25.085 26.085 25.624999999999996 120-124 22.705000000000002 25.629999999999995 26.355 25.31 125-129 23.21 25.564999999999998 25.86 25.365 130-134 23.01 25.615 26.33 25.045 135-139 23.11 25.19 26.27 25.430000000000003 140-144 23.11 25.240000000000002 26.490000000000002 25.16 145-149 23.645 25.215 25.945 25.195 150-151 23.9375 24.3625 25.374999999999996 26.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 0.5 27 1.5 28 5.5 29 8.0 30 9.5 31 13.0 32 14.0 33 19.5 34 31.0 35 42.0 36 51.5 37 61.0 38 77.0 39 109.0 40 145.5 41 176.0 42 197.5 43 203.5 44 219.5 45 234.0 46 218.0 47 209.5 48 200.0 49 177.0 50 163.5 51 150.0 52 136.0 53 116.5 54 117.0 55 110.0 56 84.0 57 74.0 58 71.5 59 68.0 60 60.5 61 57.5 62 54.0 63 45.5 64 45.5 65 42.5 66 29.0 67 27.5 68 30.0 69 21.5 70 13.0 71 13.5 72 14.5 73 12.5 74 7.5 75 3.5 76 2.0 77 0.5 78 0.5 79 1.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.7250000000000005 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32007051120625 98.6 2 0.6547469151347267 1.3 3 0.0 0.0 4 0.02518257365902795 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.5874999999999999 0.0 0.0 0.0 0.0 116-117 0.7125 0.0 0.0 0.0 0.0 118-119 0.8999999999999999 0.0 0.0 0.0 0.0 120-121 1.075 0.0 0.0 0.0 0.0 122-123 1.2375 0.0 0.0 0.0 0.0 124-125 1.3625 0.0 0.0 0.0 0.0 126-127 1.525 0.0 0.0 0.0 0.0 128-129 1.7000000000000002 0.0 0.0 0.0 0.0 130-131 1.975 0.0 0.0 0.0 0.0 132-133 2.3375 0.0 0.0 0.0 0.0 134-135 2.5250000000000004 0.0 0.0 0.0 0.0 136-137 2.7750000000000004 0.0 0.0 0.0 0.0 138-139 3.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTGGC 10 0.0068378756 144.95 7 ATGTAAG 10 0.0068378756 144.95 6 >>END_MODULE SRR6958335 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958335_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8895 33.0 33.0 34.0 32.0 34.0 2 32.93675 33.0 33.0 34.0 32.0 34.0 3 32.874 34.0 33.0 34.0 32.0 34.0 4 32.87625 34.0 33.0 34.0 32.0 34.0 5 32.8225 34.0 33.0 34.0 32.0 34.0 6 36.761 38.0 38.0 38.0 36.0 38.0 7 36.684 38.0 38.0 38.0 35.0 38.0 8 36.67825 38.0 38.0 38.0 35.0 38.0 9 36.7355 38.0 38.0 38.0 35.0 38.0 10-14 36.7136 38.0 38.0 38.0 35.0 38.0 15-19 36.84695000000001 38.0 38.0 38.0 36.0 38.0 20-24 36.9148 38.0 38.0 38.0 36.2 38.0 25-29 36.9007 38.0 38.0 38.0 35.8 38.0 30-34 36.79285 38.0 38.0 38.0 35.6 38.0 35-39 36.5925 38.0 38.0 38.0 34.8 38.0 40-44 36.5538 38.0 38.0 38.0 34.6 38.0 45-49 36.64155000000001 38.0 38.0 38.0 34.8 38.0 50-54 36.554449999999996 38.0 38.0 38.0 34.4 38.0 55-59 36.50985 38.0 38.0 38.0 34.4 38.0 60-64 36.5362 38.0 38.0 38.0 34.0 38.0 65-69 36.48855 38.0 38.0 38.0 34.2 38.0 70-74 36.4125 38.0 38.0 38.0 34.0 38.0 75-79 36.208 38.0 38.0 38.0 33.4 38.0 80-84 35.98175 38.0 37.6 38.0 33.0 38.0 85-89 35.922650000000004 38.0 37.2 38.0 32.6 38.0 90-94 35.98885 38.0 38.0 38.0 33.0 38.0 95-99 35.82255 38.0 37.0 38.0 32.2 38.0 100-104 35.66455 38.0 37.0 38.0 31.0 38.0 105-109 35.2133 38.0 36.2 38.0 29.0 38.0 110-114 34.94955 38.0 35.6 38.0 27.6 38.0 115-119 34.634100000000004 38.0 35.0 38.0 25.8 38.0 120-124 34.29215 38.0 34.8 38.0 23.6 38.0 125-129 33.78495 38.0 34.0 38.0 21.8 38.0 130-134 33.03255 38.0 33.2 38.0 17.2 38.0 135-139 31.6188 36.0 29.8 38.0 14.0 38.0 140-144 31.4113 36.0 31.0 38.0 13.8 38.0 145-149 31.2389 36.4 31.2 38.0 11.0 38.0 150-151 26.728625 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 5.0 4 3.0 5 3.0 6 2.0 7 2.0 8 1.0 9 0.0 10 3.0 11 1.0 12 1.0 13 3.0 14 5.0 15 2.0 16 1.0 17 3.0 18 4.0 19 3.0 20 10.0 21 12.0 22 10.0 23 23.0 24 22.0 25 27.0 26 21.0 27 40.0 28 39.0 29 52.0 30 65.0 31 91.0 32 121.0 33 165.0 34 241.0 35 413.0 36 919.0 37 1679.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.325 18.725 12.85 31.1 2 30.225 23.5 27.675 18.6 3 22.95 26.474999999999998 26.8 23.775 4 24.075 31.4 22.0 22.525000000000002 5 26.1 33.324999999999996 20.150000000000002 20.424999999999997 6 23.575 36.199999999999996 20.525 19.7 7 22.6 18.675 35.225 23.5 8 25.224999999999998 23.3 23.225 28.249999999999996 9 24.05 23.05 28.025 24.875 10-14 25.84629231461573 26.066303315165758 23.90119505975299 24.18620931046552 15-19 25.014999999999997 25.89 25.235000000000003 23.86 20-24 25.0 26.58 24.94 23.48 25-29 25.09125456272814 26.16630831541577 24.841242062103106 23.90119505975299 30-34 25.255 25.669999999999998 25.314999999999998 23.76 35-39 26.040000000000003 25.785000000000004 24.815 23.36 40-44 25.380000000000003 25.845000000000002 25.180000000000003 23.595 45-49 25.82 25.86 24.654999999999998 23.665 50-54 25.385 26.334999999999997 24.62 23.66 55-59 26.0 25.655 25.040000000000003 23.305 60-64 25.52 25.564999999999998 25.715 23.200000000000003 65-69 25.480000000000004 26.645000000000003 24.935 22.939999999999998 70-74 25.8 25.855 25.21 23.135 75-79 25.419999999999998 25.97 25.374999999999996 23.235 80-84 25.19 26.08 25.415 23.315 85-89 25.240000000000002 25.905 25.365 23.49 90-94 25.865 26.145000000000003 25.330000000000002 22.66 95-99 25.195 25.825 25.455 23.525 100-104 26.25 25.88 25.03 22.84 105-109 25.405 26.035000000000004 25.03 23.53 110-114 25.5 26.279999999999998 25.130000000000003 23.09 115-119 25.835 26.06 25.21 22.895 120-124 25.16 26.529999999999998 25.5 22.81 125-129 25.785000000000004 26.19 25.245 22.78 130-134 26.45764576457646 26.41764176417642 24.52245224522452 22.6022602260226 135-139 26.021505376344084 26.281570392598148 25.05126281570393 22.64566141535384 140-144 25.99779933980194 26.803040912273683 25.35260578173452 21.84655396618986 145-149 26.474999999999998 26.36 25.335 21.83 150-151 26.387500000000003 26.125 25.025 22.4625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 3.0 26 3.5 27 4.5 28 6.5 29 5.0 30 3.0 31 9.5 32 15.5 33 22.0 34 29.0 35 33.5 36 41.5 37 53.5 38 69.5 39 91.0 40 116.5 41 150.0 42 190.5 43 205.0 44 204.5 45 204.5 46 203.5 47 211.5 48 203.5 49 181.0 50 162.0 51 155.0 52 141.0 53 120.0 54 109.0 55 101.5 56 98.5 57 93.5 58 84.5 59 79.5 60 71.5 61 65.5 62 66.0 63 58.0 64 47.0 65 37.0 66 36.5 67 33.5 68 31.5 69 29.5 70 28.5 71 28.0 72 17.5 73 11.5 74 7.5 75 5.5 76 5.5 77 4.0 78 2.0 79 1.0 80 0.5 81 1.0 82 1.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.01 135-139 0.025 140-144 0.03 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29328621908127 98.35000000000001 2 0.5300353356890459 1.05 3 0.10095911155981827 0.3 4 0.0757193336698637 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.23750000000000002 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.48750000000000004 0.0 0.0 0.0 0.0 114-115 0.6125 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.95 0.0 0.0 0.0 0.0 120-121 1.125 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.575 0.0 0.0 0.0 0.0 128-129 1.75 0.0 0.0 0.0 0.0 130-131 2.025 0.0 0.0 0.0 0.0 132-133 2.4 0.0 0.0 0.0 0.0 134-135 2.5999999999999996 0.0 0.0 0.0 0.0 136-137 2.8125 0.0 0.0 0.0 0.0 138-139 3.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGTGTG 10 0.006830828 145.0 9 TGAAGTG 10 0.006830828 145.0 8 GTCCAAG 10 0.006830828 145.0 1 AGTGAAG 10 0.006830828 145.0 6 AAGTGAA 10 0.006830828 145.0 5 TTAGTGT 10 0.006830828 145.0 8 >>END_MODULE Read 820531 spots for SRR6958335.sra Written 820531 spots for SRR6958335.sra Read 820531 spots for SRR6958335.sra Written 820531 spots for SRR6958335.sra Read 820531 spots for SRR6958335.sra Written 820531 spots for SRR6958335.sra Read 820531 spots for SRR6958335.sra Written 820531 spots for SRR6958335.sra Read 820531 spots for SRR6958335.sra Written 820531 spots for SRR6958335.sra Read 820531 spots for SRR6958335.sra Written 820531 spots for SRR6958335.sra Read 820531 spots for SRR6958335.sra Written 820531 spots for SRR6958335.sra Read 820531 spots for SRR6958335.sra Written 820531 spots for SRR6958335.sra Read 820531 spots for SRR6958335.sra Written 820531 spots for SRR6958335.sra Read 820531 spots for SRR6958335.sra Written 820531 spots for SRR6958335.sra Read 820531 spots for SRR6958335.sra Written 820531 spots for SRR6958335.sra Read 820531 spots for SRR6958335.sra Written 820531 spots for SRR6958335.sra Read 820531 spots for SRR6958335.sra Written 820531 spots for SRR6958335.sra Read 820531 spots for SRR6958335.sra Written 820531 spots for SRR6958335.sra Read 820531 spots for SRR6958335.sra Written 820531 spots for SRR6958335.sra Read 820531 spots for SRR6958335.sra Written 820531 spots for SRR6958335.sra Read 820531 spots for SRR6958335.sra Written 820531 spots for SRR6958335.sra Read 820531 spots for SRR6958335.sra Written 820531 spots for SRR6958335.sra Read 820543 spots for SRR6958335.sra Written 820543 spots for SRR6958335.sra Read 820531 spots for SRR6958335.sra Written 820531 spots for SRR6958335.sra SRR ids: ['SRR6958335.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_13fxgof1 SRR6958335.sra spots: 16410632 blocks: [[1, 820531], [820532, 1641062], [1641063, 2461593], [2461594, 3282124], [3282125, 4102655], [4102656, 4923186], [4923187, 5743717], [5743718, 6564248], [6564249, 7384779], [7384780, 8205310], [8205311, 9025841], [9025842, 9846372], [9846373, 10666903], [10666904, 11487434], [11487435, 12307965], [12307966, 13128496], [13128497, 13949027], [13949028, 14769558], [14769559, 15590089], [15590090, 16410632]] SRR6958335 file size 5539324 SRR6958335 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958335 SRR6958335_1.fastq SRR6958335_2.fastq Input file: SRR6958335_1.fastq Paired file: SRR6958335_2.fastq trimmed: SRR6958335-trimmed-pair1.fastq, SRR6958335-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:15:33 2024 >> started Fri Dec 6 20:15:50 2024 >> done (17.048s) 16410632 read pairs processed; of these: 15608 ( 0.10%) short read pairs filtered out after trimming by size control 11861 ( 0.07%) empty read pairs filtered out after trimming by size control 16383163 (99.83%) read pairs available; of these: 6721951 (41.03%) trimmed read pairs available after processing 9661212 (58.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 0 0.00% 21 5 0.00% 22 2 0.00% 23 4 0.00% 24 8 0.00% 25 0 0.00% 26 6 0.00% 27 3 0.00% 28 4 0.00% 29 3 0.00% 30 6 0.00% 31 6 0.00% 32 3 0.00% 33 5 0.00% 34 8 0.00% 35 10 0.00% 36 7 0.00% 37 7 0.00% 38 4 0.00% 39 12 0.00% 40 16 0.00% 41 6 0.00% 42 12 0.00% 43 16 0.00% 44 6 0.00% 45 11 0.00% 46 8 0.00% 47 20 0.00% 48 18 0.00% 49 22 0.00% 50 16 0.00% 51 29 0.00% 52 25 0.00% 53 42 0.00% 54 31 0.00% 55 48 0.00% 56 41 0.00% 57 56 0.00% 58 56 0.00% 59 60 0.00% 60 71 0.00% 61 102 0.00% 62 99 0.00% 63 117 0.00% 64 141 0.00% 65 132 0.00% 66 162 0.00% 67 164 0.00% 68 189 0.00% 69 213 0.00% 70 247 0.00% 71 253 0.00% 72 320 0.00% 73 341 0.00% 74 377 0.00% 75 430 0.00% 76 507 0.00% 77 558 0.00% 78 585 0.00% 79 654 0.00% 80 768 0.00% 81 926 0.01% 82 1047 0.01% 83 1261 0.01% 84 1972 0.01% 85 2417 0.01% 86 2399 0.01% 87 2568 0.02% 88 2659 0.02% 89 2710 0.02% 90 2972 0.02% 91 3148 0.02% 92 3389 0.02% 93 3754 0.02% 94 3944 0.02% 95 4226 0.03% 96 4441 0.03% 97 4716 0.03% 98 5009 0.03% 99 5500 0.03% 100 5792 0.04% 101 6155 0.04% 102 6685 0.04% 103 7274 0.04% 104 7756 0.05% 105 8227 0.05% 106 8670 0.05% 107 9194 0.06% 108 9570 0.06% 109 10077 0.06% 110 10603 0.06% 111 11313 0.07% 112 12382 0.08% 113 13202 0.08% 114 14067 0.09% 115 14846 0.09% 116 16084 0.10% 117 16411 0.10% 118 17171 0.10% 119 17995 0.11% 120 18867 0.12% 121 19667 0.12% 122 21078 0.13% 123 22613 0.14% 124 23929 0.15% 125 25728 0.16% 126 27065 0.17% 127 28638 0.17% 128 30184 0.18% 129 31794 0.19% 130 33663 0.21% 131 35716 0.22% 132 38221 0.23% 133 41734 0.25% 134 45082 0.28% 135 48798 0.30% 136 52960 0.32% 137 57375 0.35% 138 62799 0.38% 139 68580 0.42% 140 75450 0.46% 141 84461 0.52% 142 92456 0.56% 143 100033 0.61% 144 109499 0.67% 145 122663 0.75% 146 147761 0.90% 147 206307 1.26% 148 336813 2.06% 149 714395 4.36% 150 3708015 22.63% 151 9661212 58.97% 16383163 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=22 prefix-density=0.73 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=127.26 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.4 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=24 prefix-density=0.57 prefix-fanout=2.4 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=370.45 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=16.2 sequence=AGCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958335 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:16:42 Started mapping on | Dec 06 20:16:42 Finished on | Dec 06 20:17:50 Mapping speed, Million of reads per hour | 867.34 Number of input reads | 16383163 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16047695 Uniquely mapped reads % | 97.95% Average mapped length | 296.97 Number of splices: Total | 18960663 Number of splices: Annotated (sjdb) | 17869249 Number of splices: GT/AG | 18715761 Number of splices: GC/AG | 224416 Number of splices: AT/AC | 6904 Number of splices: Non-canonical | 13582 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 108293 % of reads mapped to multiple loci | 0.66% Number of reads mapped to too many loci | 10281 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.92% % of reads unmapped: other | 0.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 237245 237245 237245 N_multimapping 108293 108293 108293 N_noFeature 556341 15600840 678734 N_ambiguous 387546 2205 64269 UnstrandedReadsAssigned:15103808 PositiveStrandReadsAssigned:444650 NegativeStrandReadsAssigned:15304692 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958335 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958335-trimmed-pair1.fastq SRR6958335-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,383,163 reads, 15,332,173 reads pseudoaligned [quant] estimated average fragment length: 271.943 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,183 rounds 52973 SRR6958335.ke.tsv 35125 SRR6958335.se.tsv 88098 total ==> SRR6958335.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 665.579 0 0 PNS24247 1044 773.057 52.5637 6.74288 PNS24249 1928 1657.06 38.2116 2.2868 PNS24246 1044 773.057 52.5637 6.74288 PNS24248 1044 773.057 52.5637 6.74288 PNS24244 1471 1200.06 29.0974 2.40449 PNS24243 293 80.1833 0 0 KQK14069 1603 1332.06 2669.65 198.748 KQK14071 474 218.701 56.3688 25.5599 ==> SRR6958335.se.tsv <== BRADI_1g14170v3 3143 BRADI_1g53295v3 195 BRADI_1g59795v3 187 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 191 BRADI_1g74790v3 76 BRADI_1g09890v3 0 BRADI_1g77505v3 174 BRADI_1g48960v3 0 SRR6958335 completed mapping pipeline successfully