Starting /dee2/code/volunteer_pipeline.sh SRR6958336 current disk space = 1549583765504 free memory = 1476495832 SRR6958336 SRAfilesize e7a56f932229d435eeba0819b4cb11a9 SRR6958336.sra SRR6958336.sra file validated SRR6958336 is paired end SRR6958336 is conventional basespace SRR6958336 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958336_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.621 18.0 18.0 30.0 18.0 32.0 2 25.6625 27.0 25.0 29.0 18.0 31.0 3 28.741 29.0 27.0 31.0 25.0 33.0 4 31.20875 32.0 32.0 33.0 27.0 33.0 5 31.99 33.0 32.0 33.0 31.0 33.0 6 35.577 37.0 35.0 38.0 31.0 38.0 7 37.05975 38.0 37.0 38.0 35.0 38.0 8 37.402 38.0 38.0 38.0 37.0 38.0 9 37.19525 38.0 38.0 38.0 36.0 38.0 10-14 37.415549999999996 38.0 38.0 38.0 37.4 38.0 15-19 37.45505 38.0 38.0 38.0 37.8 38.0 20-24 37.2893 38.0 38.0 38.0 36.8 38.0 25-29 36.82665000000001 38.0 38.0 38.0 35.2 38.0 30-34 36.90235 38.0 37.8 38.0 34.8 38.0 35-39 37.25255 38.0 38.0 38.0 36.6 38.0 40-44 37.5145 38.0 38.0 38.0 38.0 38.0 45-49 37.612700000000004 38.0 38.0 38.0 38.0 38.0 50-54 37.57039999999999 38.0 38.0 38.0 38.0 38.0 55-59 37.10335 38.0 38.0 38.0 36.0 38.0 60-64 36.992000000000004 38.0 37.8 38.0 35.4 38.0 65-69 37.47539999999999 38.0 38.0 38.0 37.2 38.0 70-74 37.439750000000004 38.0 38.0 38.0 37.0 38.0 75-79 36.305 38.0 37.4 38.0 32.2 38.0 80-84 36.729 38.0 37.6 38.0 34.0 38.0 85-89 37.27845000000001 38.0 38.0 38.0 36.8 38.0 90-94 37.3309 38.0 38.0 38.0 36.8 38.0 95-99 37.21385 38.0 38.0 38.0 36.2 38.0 100-104 37.1311 38.0 38.0 38.0 36.0 38.0 105-109 36.9952 38.0 38.0 38.0 35.6 38.0 110-114 37.11705 38.0 38.0 38.0 36.0 38.0 115-119 36.870599999999996 38.0 38.0 38.0 35.2 38.0 120-124 36.58165 38.0 38.0 38.0 34.4 38.0 125-129 36.614050000000006 38.0 38.0 38.0 34.2 38.0 130-134 35.73935 38.0 36.4 38.0 30.0 38.0 135-139 34.7692 38.0 35.2 38.0 25.8 38.0 140-144 35.557649999999995 38.0 36.4 38.0 30.2 38.0 145-149 35.73785 38.0 36.4 38.0 32.8 38.0 150-151 32.352 36.0 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 0.0 20 3.0 21 1.0 22 3.0 23 2.0 24 2.0 25 4.0 26 5.0 27 13.0 28 15.0 29 16.0 30 32.0 31 47.0 32 58.0 33 94.0 34 155.0 35 260.0 36 890.0 37 2395.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.22665988298143 11.523785296362249 6.741287204273721 42.5082676163826 2 24.55 12.925 32.975 29.549999999999997 3 22.925 15.85 22.525000000000002 38.7 4 25.624999999999996 24.099999999999998 21.475 28.799999999999997 5 27.325 28.375 22.95 21.349999999999998 6 21.875 31.724999999999998 23.65 22.75 7 17.349999999999998 23.0 40.175 19.475 8 20.724999999999998 23.474999999999998 29.725 26.075 9 19.675 20.625 34.949999999999996 24.75 10-14 22.86 26.375 25.295 25.47 15-19 22.67 25.0 26.51 25.82 20-24 23.47 25.2 26.125 25.205 25-29 22.93 25.230000000000004 26.43 25.41 30-34 23.169999999999998 25.105 25.855 25.869999999999997 35-39 22.759999999999998 24.855 25.974999999999998 26.41 40-44 23.345 24.8 26.465 25.39 45-49 22.715 25.06 26.205000000000002 26.02 50-54 23.385 25.0 25.88 25.735000000000003 55-59 23.169999999999998 24.759999999999998 26.58 25.490000000000002 60-64 23.31 25.215 25.445 26.029999999999998 65-69 23.081154057702886 24.88624431221561 25.99129956497825 26.041302065103256 70-74 23.365 24.685000000000002 25.724999999999998 26.224999999999998 75-79 23.65 24.654999999999998 26.045 25.650000000000002 80-84 22.925 24.81 26.6 25.665 85-89 23.275000000000002 25.080000000000002 25.779999999999998 25.865 90-94 23.73 24.595 26.265 25.41 95-99 23.52 24.415 26.145000000000003 25.919999999999998 100-104 23.794999999999998 24.779999999999998 25.82 25.605 105-109 23.005 24.7 26.375 25.919999999999998 110-114 23.75 24.23 26.445 25.575 115-119 24.235 24.51 25.645 25.61 120-124 23.77 25.455 25.56 25.215 125-129 23.435 25.365 24.93 26.27 130-134 23.64 25.135 25.515 25.71 135-139 24.18 25.074999999999996 25.25 25.495 140-144 23.805 25.16 24.925 26.11 145-149 24.08 25.21 25.035 25.674999999999997 150-151 23.474999999999998 24.925 25.5375 26.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.5 26 2.5 27 2.5 28 3.0 29 5.5 30 8.0 31 10.5 32 12.5 33 17.5 34 24.0 35 34.0 36 45.0 37 44.0 38 64.0 39 105.5 40 135.5 41 149.5 42 173.0 43 203.5 44 209.0 45 200.0 46 200.0 47 190.5 48 187.5 49 188.5 50 172.5 51 152.5 52 135.5 53 131.5 54 115.5 55 94.0 56 86.0 57 81.5 58 74.5 59 77.0 60 85.5 61 78.5 62 63.0 63 58.5 64 60.0 65 50.5 66 45.0 67 47.0 68 34.0 69 24.0 70 29.5 71 26.5 72 14.0 73 11.0 74 12.5 75 9.5 76 4.5 77 2.0 78 2.0 79 1.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.2125 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.7250000000000001 0.0 0.0 0.0 0.0 106-107 0.9125 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 1.9375 0.0 0.0 0.0 0.0 116-117 2.0875 0.0 0.0 0.0 0.0 118-119 2.3875 0.0 0.0 0.0 0.0 120-121 2.6875 0.0 0.0 0.0 0.0 122-123 3.0125 0.0 0.0 0.0 0.0 124-125 3.3499999999999996 0.0 0.0 0.0 0.0 126-127 3.6875 0.0 0.0 0.0 0.0 128-129 4.0875 0.0 0.0 0.0 0.0 130-131 4.375 0.0 0.0 0.0 0.0 132-133 4.8375 0.0 0.0 0.0 0.0 134-135 5.3125 0.0 0.0 0.0 0.0 136-137 5.775 0.0 0.0 0.0 0.0 138-139 6.175000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTTTC 10 0.006832588 144.9875 4 TGTTTCC 10 0.006832588 144.9875 5 TGTGTTT 10 0.006832588 144.9875 3 >>END_MODULE SRR6958336 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958336_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.14525 33.0 33.0 34.0 33.0 34.0 2 33.3025 34.0 33.0 34.0 33.0 34.0 3 33.3255 34.0 33.0 34.0 33.0 34.0 4 33.28625 34.0 33.0 34.0 33.0 34.0 5 33.2125 34.0 33.0 34.0 33.0 34.0 6 37.531 38.0 38.0 38.0 38.0 38.0 7 37.57 38.0 38.0 38.0 38.0 38.0 8 37.4815 38.0 38.0 38.0 38.0 38.0 9 37.5185 38.0 38.0 38.0 38.0 38.0 10-14 37.4525 38.0 38.0 38.0 37.8 38.0 15-19 37.49645 38.0 38.0 38.0 38.0 38.0 20-24 37.498149999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.43935 38.0 38.0 38.0 37.8 38.0 30-34 37.5058 38.0 38.0 38.0 38.0 38.0 35-39 37.4162 38.0 38.0 38.0 38.0 38.0 40-44 37.08195 38.0 38.0 38.0 36.6 38.0 45-49 37.14639999999999 38.0 38.0 38.0 36.6 38.0 50-54 37.2264 38.0 38.0 38.0 36.8 38.0 55-59 37.42045 38.0 38.0 38.0 38.0 38.0 60-64 37.411350000000006 38.0 38.0 38.0 37.8 38.0 65-69 37.3409 38.0 38.0 38.0 37.2 38.0 70-74 37.31415 38.0 38.0 38.0 37.0 38.0 75-79 37.36135 38.0 38.0 38.0 37.0 38.0 80-84 37.219550000000005 38.0 38.0 38.0 36.8 38.0 85-89 37.05675 38.0 38.0 38.0 36.2 38.0 90-94 37.0573 38.0 38.0 38.0 36.0 38.0 95-99 36.9834 38.0 38.0 38.0 36.0 38.0 100-104 36.917 38.0 38.0 38.0 35.6 38.0 105-109 37.0481 38.0 38.0 38.0 36.0 38.0 110-114 36.859449999999995 38.0 38.0 38.0 35.2 38.0 115-119 36.787699999999994 38.0 38.0 38.0 35.0 38.0 120-124 36.60654999999999 38.0 38.0 38.0 34.4 38.0 125-129 36.381049999999995 38.0 38.0 38.0 34.0 38.0 130-134 36.4462 38.0 38.0 38.0 34.0 38.0 135-139 36.137350000000005 38.0 38.0 38.0 33.2 38.0 140-144 35.7741 38.0 37.8 38.0 31.6 38.0 145-149 35.43495 38.0 37.2 38.0 31.2 38.0 150-151 31.313625000000002 35.5 31.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 1.0 20 4.0 21 0.0 22 3.0 23 5.0 24 3.0 25 5.0 26 13.0 27 6.0 28 14.0 29 25.0 30 30.0 31 31.0 32 59.0 33 71.0 34 116.0 35 175.0 36 435.0 37 2994.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.825 17.825 9.475 32.875 2 28.999999999999996 24.425 28.375 18.2 3 22.125 25.95 28.175 23.75 4 26.174999999999997 31.25 19.475 23.1 5 27.725 32.324999999999996 19.8 20.150000000000002 6 22.875 36.25 20.75 20.125 7 21.7 19.625 36.075 22.6 8 23.75 24.05 23.75 28.449999999999996 9 23.175 23.849999999999998 27.200000000000003 25.775 10-14 25.915 25.765 24.060000000000002 24.26 15-19 25.337533753375336 26.082608260826085 24.427442744274426 24.152415241524153 20-24 24.805 25.945 25.365 23.885 25-29 25.66 25.715 24.515 24.11 30-34 25.330000000000002 25.715 24.565 24.39 35-39 26.035000000000004 24.905 24.490000000000002 24.57 40-44 25.590000000000003 25.650000000000002 24.215 24.545 45-49 25.505 25.53 24.73 24.235 50-54 25.915 26.045 24.195 23.845 55-59 25.564999999999998 25.205 24.615000000000002 24.615000000000002 60-64 25.424999999999997 25.619999999999997 24.740000000000002 24.215 65-69 26.045 25.745 24.195 24.015 70-74 25.805 25.46 24.52 24.215 75-79 25.330000000000002 26.025 24.4 24.245 80-84 25.965 26.119999999999997 24.145 23.77 85-89 25.629999999999995 25.965 24.235 24.169999999999998 90-94 25.759999999999998 26.11 24.224999999999998 23.905 95-99 26.02 25.61 24.865000000000002 23.505000000000003 100-104 25.924999999999997 25.650000000000002 24.875 23.549999999999997 105-109 25.845000000000002 25.515 24.58 24.060000000000002 110-114 26.38 26.125 24.285 23.21 115-119 26.82134106705335 25.73628681434072 24.451222561128056 22.991149557477875 120-124 26.205000000000002 26.55 24.19 23.055 125-129 27.0 26.575 23.674999999999997 22.75 130-134 26.295 26.145000000000003 24.325 23.235 135-139 26.240000000000002 25.790000000000003 24.585 23.385 140-144 26.85 26.72 23.785 22.645 145-149 27.155 25.735000000000003 24.01 23.1 150-151 27.0625 26.625 24.2375 22.075 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.0 25 0.5 26 3.0 27 4.5 28 4.5 29 8.0 30 8.0 31 10.5 32 14.0 33 15.0 34 24.0 35 28.5 36 39.5 37 55.5 38 77.5 39 103.5 40 118.5 41 139.5 42 170.5 43 178.0 44 182.5 45 203.5 46 198.0 47 170.5 48 168.5 49 187.0 50 172.0 51 151.0 52 134.0 53 117.0 54 108.0 55 98.0 56 91.0 57 87.0 58 93.0 59 89.0 60 82.0 61 80.5 62 73.0 63 66.5 64 63.5 65 60.5 66 54.5 67 50.5 68 40.0 69 38.5 70 39.5 71 26.0 72 19.5 73 17.5 74 12.5 75 5.5 76 4.5 77 5.5 78 2.0 79 0.5 80 1.0 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1121258244546 97.675 2 0.6341958396752917 1.25 3 0.10147133434804667 0.3 4 0.050735667174023336 0.2 5 0.025367833587011668 0.125 6 0.076103500761035 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 6 0.15 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 6 0.15 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.2125 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.7250000000000001 0.0 0.0 0.0 0.0 106-107 0.9125 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.6375 0.0 0.0 0.0 0.0 114-115 1.9375 0.0 0.0 0.0 0.0 116-117 2.0875 0.0 0.0 0.0 0.0 118-119 2.3875 0.0 0.0 0.0 0.0 120-121 2.6625 0.0 0.0 0.0 0.0 122-123 2.9875 0.0 0.0 0.0 0.0 124-125 3.325 0.0 0.0 0.0 0.0 126-127 3.6875 0.0 0.0 0.0 0.0 128-129 4.075 0.0 0.0 0.0 0.0 130-131 4.375 0.0 0.0 0.0 0.0 132-133 4.8375 0.0 0.0 0.0 0.0 134-135 5.3625 0.0 0.0 0.0 0.0 136-137 5.875 0.0 0.0 0.0 0.0 138-139 6.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAATA 10 0.006830828 145.0 2 AAGGTGA 10 0.006830828 145.0 9 >>END_MODULE Read 1078066 spots for SRR6958336.sra Written 1078066 spots for SRR6958336.sra Read 1078066 spots for SRR6958336.sra Written 1078066 spots for SRR6958336.sra Read 1078066 spots for SRR6958336.sra Written 1078066 spots for SRR6958336.sra Read 1078066 spots for SRR6958336.sra Written 1078066 spots for SRR6958336.sra Read 1078066 spots for SRR6958336.sra Written 1078066 spots for SRR6958336.sra Read 1078066 spots for SRR6958336.sra Written 1078066 spots for SRR6958336.sra Read 1078066 spots for SRR6958336.sra Written 1078066 spots for SRR6958336.sra Read 1078066 spots for SRR6958336.sra Written 1078066 spots for SRR6958336.sra Read 1078066 spots for SRR6958336.sra Written 1078066 spots for SRR6958336.sra Read 1078066 spots for SRR6958336.sra Written 1078066 spots for SRR6958336.sra Read 1078066 spots for SRR6958336.sra Written 1078066 spots for SRR6958336.sra Read 1078066 spots for SRR6958336.sra Written 1078066 spots for SRR6958336.sra Read 1078066 spots for SRR6958336.sra Written 1078066 spots for SRR6958336.sra Read 1078066 spots for SRR6958336.sra Written 1078066 spots for SRR6958336.sra Read 1078066 spots for SRR6958336.sra Written 1078066 spots for SRR6958336.sra Read 1078066 spots for SRR6958336.sra Written 1078066 spots for SRR6958336.sra Read 1078073 spots for SRR6958336.sra Written 1078073 spots for SRR6958336.sra Read 1078066 spots for SRR6958336.sra Written 1078066 spots for SRR6958336.sra Read 1078066 spots for SRR6958336.sra Written 1078066 spots for SRR6958336.sra Read 1078066 spots for SRR6958336.sra Written 1078066 spots for SRR6958336.sra SRR ids: ['SRR6958336.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__0ad9v53 SRR6958336.sra spots: 21561327 blocks: [[1, 1078066], [1078067, 2156132], [2156133, 3234198], [3234199, 4312264], [4312265, 5390330], [5390331, 6468396], [6468397, 7546462], [7546463, 8624528], [8624529, 9702594], [9702595, 10780660], [10780661, 11858726], [11858727, 12936792], [12936793, 14014858], [14014859, 15092924], [15092925, 16170990], [16170991, 17249056], [17249057, 18327122], [18327123, 19405188], [19405189, 20483254], [20483255, 21561327]] SRR6958336 file size 7284725 SRR6958336 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958336 SRR6958336_1.fastq SRR6958336_2.fastq Input file: SRR6958336_1.fastq Paired file: SRR6958336_2.fastq trimmed: SRR6958336-trimmed-pair1.fastq, SRR6958336-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:21:39 2024 >> started Fri Dec 6 20:25:40 2024 >> done (241.745s) 21561327 read pairs processed; of these: 12819 ( 0.06%) short read pairs filtered out after trimming by size control 11333 ( 0.05%) empty read pairs filtered out after trimming by size control 21537175 (99.89%) read pairs available; of these: 7636550 (35.46%) trimmed read pairs available after processing 13900625 (64.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 5 0.00% 20 5 0.00% 21 11 0.00% 22 7 0.00% 23 9 0.00% 24 11 0.00% 25 8 0.00% 26 8 0.00% 27 11 0.00% 28 11 0.00% 29 11 0.00% 30 14 0.00% 31 10 0.00% 32 13 0.00% 33 13 0.00% 34 13 0.00% 35 10 0.00% 36 8 0.00% 37 20 0.00% 38 20 0.00% 39 19 0.00% 40 19 0.00% 41 26 0.00% 42 36 0.00% 43 25 0.00% 44 26 0.00% 45 37 0.00% 46 28 0.00% 47 34 0.00% 48 35 0.00% 49 47 0.00% 50 55 0.00% 51 56 0.00% 52 77 0.00% 53 87 0.00% 54 100 0.00% 55 89 0.00% 56 113 0.00% 57 129 0.00% 58 134 0.00% 59 187 0.00% 60 171 0.00% 61 232 0.00% 62 229 0.00% 63 257 0.00% 64 295 0.00% 65 304 0.00% 66 345 0.00% 67 395 0.00% 68 430 0.00% 69 522 0.00% 70 537 0.00% 71 660 0.00% 72 819 0.00% 73 840 0.00% 74 971 0.00% 75 1092 0.01% 76 1223 0.01% 77 1378 0.01% 78 1547 0.01% 79 1757 0.01% 80 1982 0.01% 81 2247 0.01% 82 2562 0.01% 83 2905 0.01% 84 3613 0.02% 85 4317 0.02% 86 4695 0.02% 87 5047 0.02% 88 5469 0.03% 89 6012 0.03% 90 6271 0.03% 91 6942 0.03% 92 7676 0.04% 93 8202 0.04% 94 9032 0.04% 95 9583 0.04% 96 10236 0.05% 97 11226 0.05% 98 11901 0.06% 99 12762 0.06% 100 13872 0.06% 101 14595 0.07% 102 15590 0.07% 103 16925 0.08% 104 17644 0.08% 105 18753 0.09% 106 20158 0.09% 107 21070 0.10% 108 22091 0.10% 109 23545 0.11% 110 24361 0.11% 111 25956 0.12% 112 27428 0.13% 113 28408 0.13% 114 30015 0.14% 115 31840 0.15% 116 33575 0.16% 117 34142 0.16% 118 35567 0.17% 119 36666 0.17% 120 38328 0.18% 121 39600 0.18% 122 41175 0.19% 123 43396 0.20% 124 44778 0.21% 125 46689 0.22% 126 48021 0.22% 127 49609 0.23% 128 50804 0.24% 129 52882 0.25% 130 54951 0.26% 131 56336 0.26% 132 59081 0.27% 133 61900 0.29% 134 63139 0.29% 135 65701 0.31% 136 68366 0.32% 137 70800 0.33% 138 73247 0.34% 139 78269 0.36% 140 81234 0.38% 141 84988 0.39% 142 94635 0.44% 143 110974 0.52% 144 110483 0.51% 145 127444 0.59% 146 155406 0.72% 147 208148 0.97% 148 306792 1.42% 149 565134 2.62% 150 4043767 18.78% 151 13900625 64.54% 21537175 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=17 prefix-density=0.74 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=129.44 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.7 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=24 prefix-density=0.43 prefix-fanout=2.4 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.13 sequence-density-rank=23 fanout-score=55.83 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=11.1 sequence=GCCGCCGCCGCC SRR6958336 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:30:50 Started mapping on | Dec 06 20:30:51 Finished on | Dec 06 20:57:39 Mapping speed, Million of reads per hour | 48.22 Number of input reads | 21537175 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 20995321 Uniquely mapped reads % | 97.48% Average mapped length | 295.59 Number of splices: Total | 23730047 Number of splices: Annotated (sjdb) | 22226778 Number of splices: GT/AG | 23409856 Number of splices: GC/AG | 277777 Number of splices: AT/AC | 8745 Number of splices: Non-canonical | 33669 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.47 Insertion rate per base | 0.01% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 214705 % of reads mapped to multiple loci | 1.00% Number of reads mapped to too many loci | 29066 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.61% % of reads unmapped: other | 0.77% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 336223 336223 336223 N_multimapping 214705 214705 214705 N_noFeature 831130 20376001 1038267 N_ambiguous 501986 3131 90715 UnstrandedReadsAssigned:19662205 PositiveStrandReadsAssigned:616189 NegativeStrandReadsAssigned:19866339 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958336 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958336-trimmed-pair1.fastq SRR6958336-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,537,175 reads, 19,896,265 reads pseudoaligned [quant] estimated average fragment length: 259.455 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52973 SRR6958336.ke.tsv 35125 SRR6958336.se.tsv 88098 total ==> SRR6958336.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 678.236 0 0 PNS24247 1044 785.545 74.5282 7.21354 PNS24249 1928 1669.54 71.14 3.23977 PNS24246 1044 785.545 74.5282 7.21354 PNS24248 1044 785.545 74.5282 7.21354 PNS24244 1471 1212.54 33.2755 2.08653 PNS24243 293 92.4471 0 0 KQK14069 1603 1344.54 4904.47 277.342 KQK14071 474 234.129 116.271 37.7585 ==> SRR6958336.se.tsv <== BRADI_1g14170v3 5646 BRADI_1g53295v3 290 BRADI_1g59795v3 387 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 211 BRADI_1g74790v3 78 BRADI_1g09890v3 0 BRADI_1g77505v3 233 BRADI_1g48960v3 0 SRR6958336 completed mapping pipeline successfully