Starting /dee2/code/volunteer_pipeline.sh SRR6958337 current disk space = 1549574397952 free memory = 1602850528 SRR6958337 SRAfilesize bf505e1af82e54cfc05b24229691988c SRR6958337.sra SRR6958337.sra file validated SRR6958337 is paired end SRR6958337 is conventional basespace SRR6958337 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958337_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.322 33.0 32.0 34.0 27.0 34.0 2 32.0125 33.0 33.0 34.0 28.0 34.0 3 32.15175 33.0 33.0 34.0 29.0 34.0 4 32.26175 33.0 33.0 34.0 29.0 34.0 5 32.43375 33.0 33.0 34.0 31.0 34.0 6 36.5545 38.0 37.0 38.0 34.0 38.0 7 36.94175 38.0 38.0 38.0 35.0 38.0 8 37.0945 38.0 38.0 38.0 36.0 38.0 9 36.99025 38.0 38.0 38.0 35.0 38.0 10-14 37.2082 38.0 38.0 38.0 36.2 38.0 15-19 37.1566 38.0 38.0 38.0 36.2 38.0 20-24 37.239 38.0 38.0 38.0 36.6 38.0 25-29 37.16295 38.0 38.0 38.0 36.0 38.0 30-34 36.99165000000001 38.0 38.0 38.0 35.6 38.0 35-39 36.91155 38.0 38.0 38.0 35.6 38.0 40-44 36.821299999999994 38.0 38.0 38.0 35.4 38.0 45-49 36.9607 38.0 38.0 38.0 35.4 38.0 50-54 36.941100000000006 38.0 38.0 38.0 35.4 38.0 55-59 36.760149999999996 38.0 38.0 38.0 34.6 38.0 60-64 36.7651 38.0 38.0 38.0 34.6 38.0 65-69 36.742200000000004 38.0 38.0 38.0 34.4 38.0 70-74 36.80575 38.0 38.0 38.0 34.6 38.0 75-79 36.66705 38.0 38.0 38.0 34.2 38.0 80-84 36.35425 38.0 37.6 38.0 33.6 38.0 85-89 36.29965 38.0 37.6 38.0 33.4 38.0 90-94 36.39905 38.0 38.0 38.0 33.8 38.0 95-99 36.33885 38.0 37.4 38.0 33.6 38.0 100-104 36.177550000000004 38.0 37.0 38.0 33.4 38.0 105-109 35.7337 38.0 36.2 38.0 31.0 38.0 110-114 35.6871 38.0 36.0 38.0 31.0 38.0 115-119 35.49925 38.0 36.0 38.0 30.6 38.0 120-124 35.39115 38.0 35.8 38.0 29.4 38.0 125-129 35.156549999999996 38.0 35.4 38.0 28.6 38.0 130-134 34.96485 38.0 35.0 38.0 28.0 38.0 135-139 34.53345 38.0 34.8 38.0 26.2 38.0 140-144 34.24865 38.0 34.4 38.0 24.8 38.0 145-149 33.3452 38.0 34.2 38.0 18.2 38.0 150-151 29.172875 36.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 0.0 18 0.0 19 1.0 20 3.0 21 3.0 22 5.0 23 3.0 24 3.0 25 24.0 26 21.0 27 29.0 28 36.0 29 48.0 30 70.0 31 93.0 32 122.0 33 138.0 34 190.0 35 365.0 36 825.0 37 2019.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.47741935483871 10.116129032258064 8.774193548387096 42.63225806451613 2 23.504380475594495 12.615769712140176 35.86983729662078 28.010012515644554 3 20.349999999999998 15.075 25.55 39.025 4 25.775 21.7 22.55 29.975 5 26.083688298672016 28.890002505637685 24.27962916562265 20.74668003006765 6 22.75 30.675 23.775 22.8 7 17.075000000000003 25.374999999999996 38.550000000000004 19.0 8 21.25 23.724999999999998 29.5 25.525 9 20.825 22.1 33.875 23.200000000000003 10-14 22.49 26.69 26.015 24.805 15-19 22.830000000000002 25.380000000000003 26.775 25.014999999999997 20-24 22.96 26.13 26.505000000000003 24.404999999999998 25-29 22.875 25.3 26.584999999999997 25.240000000000002 30-34 22.67 24.95 26.784999999999997 25.595000000000002 35-39 22.994999999999997 24.995 26.650000000000002 25.36 40-44 22.994999999999997 25.314999999999998 26.325 25.365 45-49 22.625 26.0 25.679999999999996 25.695 50-54 22.62 25.245 26.590000000000003 25.545 55-59 23.580000000000002 25.380000000000003 25.990000000000002 25.05 60-64 22.8 24.91 26.655 25.635 65-69 23.175 24.97 26.22 25.635 70-74 23.48 24.825 26.025 25.669999999999998 75-79 23.74 25.069999999999997 26.005 25.185000000000002 80-84 22.955000000000002 25.230000000000004 26.125 25.69 85-89 23.575 24.185000000000002 26.695 25.545 90-94 23.435 25.39 25.779999999999998 25.395 95-99 22.81 25.135 26.25 25.805 100-104 23.400000000000002 25.045 25.669999999999998 25.885 105-109 23.485 24.695 26.179999999999996 25.64 110-114 23.385 25.46 25.929999999999996 25.224999999999998 115-119 23.29 24.865000000000002 25.705 26.14 120-124 23.31 24.94 25.72 26.029999999999998 125-129 23.45 24.775 25.465 26.31 130-134 23.435 25.52 25.52 25.525 135-139 23.9 25.16 24.990000000000002 25.95 140-144 23.27 25.28 25.619999999999997 25.83 145-149 23.555 25.11 25.674999999999997 25.66 150-151 24.251909352698135 24.402153499436587 25.679228746713413 25.666708401151872 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.0 25 1.5 26 2.5 27 2.5 28 4.5 29 6.5 30 7.0 31 10.0 32 14.5 33 17.0 34 19.0 35 23.5 36 41.5 37 65.0 38 86.0 39 112.5 40 131.5 41 149.5 42 182.0 43 215.5 44 216.5 45 213.0 46 216.5 47 202.0 48 204.5 49 197.0 50 173.5 51 146.5 52 126.0 53 108.5 54 101.0 55 104.0 56 100.0 57 94.5 58 79.0 59 61.0 60 64.5 61 70.0 62 61.0 63 54.0 64 47.0 65 48.0 66 39.5 67 31.0 68 31.5 69 25.5 70 24.0 71 22.5 72 14.5 73 9.5 74 6.5 75 5.0 76 3.0 77 2.0 78 1.0 79 1.0 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.125 2 0.125 3 0.0 4 0.0 5 0.22499999999999998 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52237305178483 98.97500000000001 2 0.4273504273504274 0.8500000000000001 3 0.025138260432378077 0.075 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.5875 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.7749999999999999 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.05 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.2625 0.0 0.0 0.0 0.0 128-129 1.4125 0.0 0.0 0.0 0.0 130-131 1.6125 0.0 0.0 0.0 0.0 132-133 1.7374999999999998 0.0 0.0 0.0 0.0 134-135 1.8875000000000002 0.0 0.0 0.0 0.0 136-137 2.1500000000000004 0.0 0.0 0.0 0.0 138-139 2.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAAG 10 0.006832588 144.9875 8 >>END_MODULE SRR6958337 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958337_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8355 33.0 33.0 34.0 32.0 34.0 2 32.86175 33.0 33.0 34.0 32.0 34.0 3 32.868 33.0 33.0 34.0 32.0 34.0 4 32.87475 34.0 33.0 34.0 32.0 34.0 5 32.78725 34.0 33.0 34.0 32.0 34.0 6 36.90625 38.0 38.0 38.0 35.0 38.0 7 36.95725 38.0 38.0 38.0 36.0 38.0 8 36.98525 38.0 38.0 38.0 36.0 38.0 9 37.0125 38.0 38.0 38.0 36.0 38.0 10-14 36.827299999999994 38.0 38.0 38.0 35.0 38.0 15-19 36.740300000000005 38.0 38.0 38.0 34.8 38.0 20-24 36.83215 38.0 38.0 38.0 35.4 38.0 25-29 36.8855 38.0 38.0 38.0 35.4 38.0 30-34 36.95265 38.0 38.0 38.0 36.0 38.0 35-39 36.854699999999994 38.0 38.0 38.0 35.4 38.0 40-44 36.775850000000005 38.0 38.0 38.0 34.8 38.0 45-49 36.72285 38.0 38.0 38.0 34.8 38.0 50-54 36.69925 38.0 38.0 38.0 34.6 38.0 55-59 36.77055 38.0 38.0 38.0 35.0 38.0 60-64 36.690799999999996 38.0 38.0 38.0 34.8 38.0 65-69 36.5133 38.0 38.0 38.0 34.0 38.0 70-74 36.39835 38.0 38.0 38.0 34.0 38.0 75-79 36.36785 38.0 38.0 38.0 33.8 38.0 80-84 36.2023 38.0 38.0 38.0 33.4 38.0 85-89 36.10359999999999 38.0 37.6 38.0 32.4 38.0 90-94 35.994350000000004 38.0 37.2 38.0 32.4 38.0 95-99 35.85065 38.0 37.0 38.0 31.2 38.0 100-104 35.8822 38.0 37.0 38.0 31.8 38.0 105-109 35.61 38.0 36.6 38.0 30.8 38.0 110-114 35.303700000000006 38.0 36.0 38.0 28.8 38.0 115-119 35.249500000000005 38.0 36.0 38.0 28.8 38.0 120-124 35.19324999999999 38.0 36.0 38.0 28.4 38.0 125-129 34.953950000000006 38.0 35.0 38.0 28.0 38.0 130-134 34.5496 38.0 35.0 38.0 25.8 38.0 135-139 34.067150000000005 38.0 34.4 38.0 23.4 38.0 140-144 33.747249999999994 38.0 34.2 38.0 22.0 38.0 145-149 33.04774999999999 38.0 33.8 38.0 18.2 38.0 150-151 28.414 35.5 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 2.0 14 3.0 15 1.0 16 2.0 17 5.0 18 5.0 19 4.0 20 2.0 21 6.0 22 8.0 23 16.0 24 18.0 25 22.0 26 17.0 27 37.0 28 50.0 29 54.0 30 64.0 31 91.0 32 119.0 33 147.0 34 192.0 35 307.0 36 670.0 37 2150.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.475 18.05 11.375 34.1 2 28.599999999999998 23.875 30.175 17.349999999999998 3 21.85 27.375 26.5 24.275 4 26.5 31.525 20.8 21.175 5 27.825 31.5 21.5 19.175 6 22.650000000000002 35.9 20.65 20.8 7 22.125 19.875 34.925 23.075000000000003 8 23.549999999999997 23.150000000000002 26.025 27.275 9 24.975 21.925 27.700000000000003 25.4 10-14 25.935000000000002 26.58 23.775 23.71 15-19 26.19 25.695 24.145 23.97 20-24 25.509999999999998 26.064999999999998 24.565 23.86 25-29 26.040000000000003 25.924999999999997 24.355 23.68 30-34 25.385 26.38 24.19 24.044999999999998 35-39 25.56 25.629999999999995 24.779999999999998 24.03 40-44 25.895000000000003 25.695 24.555 23.855 45-49 25.52 25.419999999999998 24.82 24.240000000000002 50-54 25.915 25.869999999999997 23.93 24.285 55-59 26.029999999999998 25.669999999999998 24.64 23.66 60-64 25.855 25.629999999999995 24.535 23.98 65-69 25.795 25.91 24.41 23.885 70-74 25.75 25.540000000000003 24.43 24.279999999999998 75-79 26.31 25.319999999999997 25.22 23.150000000000002 80-84 25.869999999999997 26.029999999999998 24.6 23.5 85-89 25.81 25.009999999999998 25.115 24.065 90-94 25.11 25.955000000000002 24.97 23.965 95-99 25.85 25.695 24.645 23.810000000000002 100-104 25.635 26.295 23.945 24.125 105-109 25.095 26.125 25.095 23.685000000000002 110-114 25.435000000000002 26.265 24.865000000000002 23.435 115-119 26.055 25.755 24.725 23.465 120-124 26.08 26.150000000000002 24.345 23.425 125-129 26.275 26.064999999999998 24.33 23.330000000000002 130-134 26.669999999999998 25.900000000000002 23.89 23.54 135-139 25.66 26.52 24.615000000000002 23.205000000000002 140-144 25.765 26.305 25.124999999999996 22.805 145-149 26.669999999999998 26.229999999999997 24.099999999999998 23.0 150-151 26.83110053837486 26.230123951421056 24.201827970451983 22.736947539752098 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 2.0 26 2.0 27 1.5 28 3.0 29 3.5 30 4.0 31 10.5 32 14.0 33 14.5 34 20.5 35 30.5 36 38.0 37 52.5 38 74.5 39 93.0 40 122.0 41 139.0 42 162.0 43 177.0 44 172.0 45 201.0 46 225.0 47 217.5 48 204.0 49 198.5 50 173.5 51 145.5 52 135.5 53 116.5 54 96.5 55 92.0 56 95.5 57 93.0 58 91.5 59 92.0 60 81.5 61 73.0 62 67.0 63 57.5 64 55.5 65 51.0 66 48.5 67 48.0 68 43.5 69 35.5 70 28.5 71 23.5 72 17.0 73 13.5 74 12.5 75 9.5 76 4.5 77 4.0 78 5.0 79 3.5 80 1.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29453262786596 98.52499999999999 2 0.6298815822625347 1.25 3 0.07558578987150416 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.5875 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.7749999999999999 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.05 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.2375 0.0 0.0 0.0 0.0 128-129 1.375 0.0 0.0 0.0 0.0 130-131 1.5625 0.0 0.0 0.0 0.0 132-133 1.6875 0.0 0.0 0.0 0.0 134-135 1.8375 0.0 0.0 0.0 0.0 136-137 2.0999999999999996 0.0 0.0 0.0 0.0 138-139 2.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCCGCT 10 0.006830828 145.0 9 >>END_MODULE Read 1130378 spots for SRR6958337.sra Written 1130378 spots for SRR6958337.sra Read 1130378 spots for SRR6958337.sra Written 1130378 spots for SRR6958337.sra Read 1130378 spots for SRR6958337.sra Written 1130378 spots for SRR6958337.sra Read 1130378 spots for SRR6958337.sra Written 1130378 spots for SRR6958337.sra Read 1130378 spots for SRR6958337.sra Written 1130378 spots for SRR6958337.sra Read 1130378 spots for SRR6958337.sra Written 1130378 spots for SRR6958337.sra Read 1130378 spots for SRR6958337.sra Written 1130378 spots for SRR6958337.sra Read 1130378 spots for SRR6958337.sra Written 1130378 spots for SRR6958337.sra Read 1130378 spots for SRR6958337.sra Written 1130378 spots for SRR6958337.sra Read 1130381 spots for SRR6958337.sra Written 1130381 spots for SRR6958337.sra Read 1130378 spots for SRR6958337.sra Written 1130378 spots for SRR6958337.sra Read 1130378 spots for SRR6958337.sra Written 1130378 spots for SRR6958337.sra Read 1130378 spots for SRR6958337.sra Written 1130378 spots for SRR6958337.sra Read 1130378 spots for SRR6958337.sra Written 1130378 spots for SRR6958337.sra Read 1130378 spots for SRR6958337.sra Written 1130378 spots for SRR6958337.sra Read 1130378 spots for SRR6958337.sra Written 1130378 spots for SRR6958337.sra Read 1130378 spots for SRR6958337.sra Written 1130378 spots for SRR6958337.sra Read 1130378 spots for SRR6958337.sra Written 1130378 spots for SRR6958337.sra Read 1130378 spots for SRR6958337.sra Written 1130378 spots for SRR6958337.sra Read 1130378 spots for SRR6958337.sra Written 1130378 spots for SRR6958337.sra SRR ids: ['SRR6958337.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__jk37i99 SRR6958337.sra spots: 22607563 blocks: [[1, 1130378], [1130379, 2260756], [2260757, 3391134], [3391135, 4521512], [4521513, 5651890], [5651891, 6782268], [6782269, 7912646], [7912647, 9043024], [9043025, 10173402], [10173403, 11303780], [11303781, 12434158], [12434159, 13564536], [13564537, 14694914], [14694915, 15825292], [15825293, 16955670], [16955671, 18086048], [18086049, 19216426], [19216427, 20346804], [20346805, 21477182], [21477183, 22607563]] SRR6958337 file size 7639260 SRR6958337 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958337 SRR6958337_1.fastq SRR6958337_2.fastq Input file: SRR6958337_1.fastq Paired file: SRR6958337_2.fastq trimmed: SRR6958337-trimmed-pair1.fastq, SRR6958337-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:19:35 2024 >> started Fri Dec 6 20:19:58 2024 >> done (23.185s) 22607563 read pairs processed; of these: 10338 ( 0.05%) short read pairs filtered out after trimming by size control 7143 ( 0.03%) empty read pairs filtered out after trimming by size control 22590082 (99.92%) read pairs available; of these: 7796189 (34.51%) trimmed read pairs available after processing 14793893 (65.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 1 0.00% 20 0 0.00% 21 5 0.00% 22 4 0.00% 23 5 0.00% 24 7 0.00% 25 5 0.00% 26 7 0.00% 27 6 0.00% 28 11 0.00% 29 9 0.00% 30 10 0.00% 31 7 0.00% 32 5 0.00% 33 13 0.00% 34 16 0.00% 35 13 0.00% 36 8 0.00% 37 9 0.00% 38 13 0.00% 39 17 0.00% 40 15 0.00% 41 14 0.00% 42 15 0.00% 43 15 0.00% 44 18 0.00% 45 16 0.00% 46 12 0.00% 47 22 0.00% 48 27 0.00% 49 23 0.00% 50 40 0.00% 51 25 0.00% 52 37 0.00% 53 37 0.00% 54 53 0.00% 55 42 0.00% 56 58 0.00% 57 58 0.00% 58 68 0.00% 59 80 0.00% 60 77 0.00% 61 90 0.00% 62 95 0.00% 63 120 0.00% 64 115 0.00% 65 127 0.00% 66 147 0.00% 67 140 0.00% 68 153 0.00% 69 187 0.00% 70 225 0.00% 71 263 0.00% 72 296 0.00% 73 298 0.00% 74 317 0.00% 75 391 0.00% 76 462 0.00% 77 486 0.00% 78 538 0.00% 79 617 0.00% 80 700 0.00% 81 792 0.00% 82 903 0.00% 83 1038 0.00% 84 1602 0.01% 85 2004 0.01% 86 2015 0.01% 87 2176 0.01% 88 2260 0.01% 89 2415 0.01% 90 2530 0.01% 91 2760 0.01% 92 2887 0.01% 93 3115 0.01% 94 3451 0.02% 95 3663 0.02% 96 3860 0.02% 97 4252 0.02% 98 4621 0.02% 99 4855 0.02% 100 5209 0.02% 101 5507 0.02% 102 5991 0.03% 103 6497 0.03% 104 6908 0.03% 105 7427 0.03% 106 8028 0.04% 107 8381 0.04% 108 8963 0.04% 109 9662 0.04% 110 10216 0.05% 111 10705 0.05% 112 11677 0.05% 113 12127 0.05% 114 13127 0.06% 115 13900 0.06% 116 15180 0.07% 117 15628 0.07% 118 16797 0.07% 119 17705 0.08% 120 19019 0.08% 121 19547 0.09% 122 21028 0.09% 123 21978 0.10% 124 23146 0.10% 125 25086 0.11% 126 26199 0.12% 127 28098 0.12% 128 29229 0.13% 129 31407 0.14% 130 33077 0.15% 131 35104 0.16% 132 37806 0.17% 133 40280 0.18% 134 42846 0.19% 135 45959 0.20% 136 50184 0.22% 137 53330 0.24% 138 57347 0.25% 139 62871 0.28% 140 68363 0.30% 141 75668 0.33% 142 85944 0.38% 143 98353 0.44% 144 115080 0.51% 145 141738 0.63% 146 178020 0.79% 147 245892 1.09% 148 387769 1.72% 149 798637 3.54% 150 4629654 20.49% 151 14793893 65.49% 22590082 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=3.09 fanout-score-rank=24 prefix-density=0.68 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=43.77 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.6 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=24 prefix-density=0.54 prefix-fanout=2.6 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=78.57 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.4 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958337 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:20:39 Started mapping on | Dec 06 20:20:40 Finished on | Dec 06 20:22:09 Mapping speed, Million of reads per hour | 913.76 Number of input reads | 22590082 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 22273880 Uniquely mapped reads % | 98.60% Average mapped length | 298.37 Number of splices: Total | 26441501 Number of splices: Annotated (sjdb) | 24922935 Number of splices: GT/AG | 26098099 Number of splices: GC/AG | 313968 Number of splices: AT/AC | 10052 Number of splices: Non-canonical | 19382 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.43 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 159048 % of reads mapped to multiple loci | 0.70% Number of reads mapped to too many loci | 14256 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.22% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 163772 163772 163772 N_multimapping 159048 159048 159048 N_noFeature 774850 21654994 949668 N_ambiguous 530796 2870 88205 UnstrandedReadsAssigned:20968234 PositiveStrandReadsAssigned:616016 NegativeStrandReadsAssigned:21236007 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958337 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958337-trimmed-pair1.fastq SRR6958337-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,590,082 reads, 21,267,561 reads pseudoaligned [quant] estimated average fragment length: 275.987 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,195 rounds 52973 SRR6958337.ke.tsv 35125 SRR6958337.se.tsv 88098 total ==> SRR6958337.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 661.372 0 0 PNS24247 1044 769.013 75.2868 6.88468 PNS24249 1928 1653.01 37.0004 1.57409 PNS24246 1044 769.013 75.2868 6.88468 PNS24248 1044 769.013 75.2868 6.88468 PNS24244 1471 1196.01 30.1393 1.77213 PNS24243 293 75.4464 0 0 KQK14069 1603 1328.01 6181.7 327.344 KQK14071 474 213.731 147.268 48.4552 ==> SRR6958337.se.tsv <== BRADI_1g14170v3 7270 BRADI_1g53295v3 305 BRADI_1g59795v3 278 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 257 BRADI_1g74790v3 93 BRADI_1g09890v3 0 BRADI_1g77505v3 309 BRADI_1g48960v3 0 SRR6958337 completed mapping pipeline successfully