Starting /dee2/code/volunteer_pipeline.sh SRR6958338 current disk space = 1549545664512 free memory = 1600141300 SRR6958338 SRAfilesize 6c87109e629a2f87d62d3684d9fd7bf1 SRR6958338.sra SRR6958338.sra file validated SRR6958338 is paired end SRR6958338 is conventional basespace SRR6958338 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958338_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.27175 30.0 18.0 33.0 18.0 33.0 2 25.4215 27.0 18.0 31.0 18.0 33.0 3 28.495 29.0 27.0 31.0 25.0 33.0 4 29.34975 31.0 29.0 33.0 25.0 33.0 5 31.645 33.0 32.0 33.0 30.0 33.0 6 36.53075 38.0 37.0 38.0 34.0 38.0 7 37.029 38.0 38.0 38.0 35.0 38.0 8 37.05525 38.0 38.0 38.0 36.0 38.0 9 37.16475 38.0 38.0 38.0 36.0 38.0 10-14 37.3081 38.0 38.0 38.0 36.6 38.0 15-19 37.3195 38.0 38.0 38.0 37.0 38.0 20-24 37.32685 38.0 38.0 38.0 36.8 38.0 25-29 37.39405 38.0 38.0 38.0 37.0 38.0 30-34 37.29665 38.0 38.0 38.0 36.8 38.0 35-39 37.26219999999999 38.0 38.0 38.0 36.8 38.0 40-44 37.15775 38.0 38.0 38.0 36.0 38.0 45-49 37.1946 38.0 38.0 38.0 36.6 38.0 50-54 37.055 38.0 38.0 38.0 35.8 38.0 55-59 36.607899999999994 38.0 38.0 38.0 34.2 38.0 60-64 36.15939999999999 38.0 37.0 38.0 32.6 38.0 65-69 35.78055 38.0 36.4 38.0 30.6 38.0 70-74 35.81635 38.0 36.4 38.0 30.4 38.0 75-79 36.3804 38.0 37.2 38.0 33.8 38.0 80-84 36.4177 38.0 37.6 38.0 34.0 38.0 85-89 36.2639 38.0 37.0 38.0 33.0 38.0 90-94 36.0974 38.0 37.0 38.0 33.0 38.0 95-99 35.8458 38.0 36.6 38.0 31.4 38.0 100-104 35.41310000000001 38.0 35.8 38.0 29.4 38.0 105-109 34.933299999999996 38.0 35.0 38.0 27.6 38.0 110-114 34.28645 38.0 34.2 38.0 24.2 38.0 115-119 33.6222 37.8 33.6 38.0 21.8 38.0 120-124 33.40655 37.2 33.2 38.0 17.8 38.0 125-129 34.27575 38.0 34.4 38.0 24.4 38.0 130-134 34.132400000000004 38.0 34.0 38.0 23.4 38.0 135-139 33.92185 38.0 34.0 38.0 23.0 38.0 140-144 33.25365 38.0 33.6 38.0 18.6 38.0 145-149 32.02105 36.8 32.6 38.0 11.4 38.0 150-151 26.756 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 0.0 16 1.0 17 1.0 18 1.0 19 3.0 20 6.0 21 3.0 22 7.0 23 6.0 24 12.0 25 16.0 26 19.0 27 38.0 28 47.0 29 66.0 30 74.0 31 100.0 32 147.0 33 208.0 34 355.0 35 562.0 36 1199.0 37 1127.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.02286018075492 7.73524720893142 7.655502392344498 37.58639021796917 2 30.925000000000004 10.725 31.3 27.05 3 23.45 16.775000000000002 22.725 37.05 4 26.375 23.775 23.150000000000002 26.700000000000003 5 26.038019009504755 26.738369184592298 24.012006003001503 23.21160580290145 6 22.15 32.300000000000004 23.125 22.425 7 17.224999999999998 22.175 38.875 21.725 8 21.175 23.175 29.125 26.525 9 19.75 21.75 32.525 25.974999999999998 10-14 22.919999999999998 26.125 25.895000000000003 25.06 15-19 23.52 24.9 26.279999999999998 25.3 20-24 23.14 24.6 26.825 25.435000000000002 25-29 23.335 25.36 25.569999999999997 25.735000000000003 30-34 23.294999999999998 24.975 26.325 25.405 35-39 23.565 24.65 26.31 25.474999999999998 40-44 23.53 24.51 26.075 25.885 45-49 22.73 25.424999999999997 26.245 25.6 50-54 23.875 24.44 25.995 25.69 55-59 22.86 25.05 25.935000000000002 26.155 60-64 23.585 24.995 25.624999999999996 25.795 65-69 23.580000000000002 25.169999999999998 25.655 25.595000000000002 70-74 23.11 25.380000000000003 25.474999999999998 26.035000000000004 75-79 23.035 24.59 25.665 26.71 80-84 23.41 24.42 25.795 26.375 85-89 23.175 24.27 25.929999999999996 26.625 90-94 23.635 24.91 25.540000000000003 25.915 95-99 23.215 25.224999999999998 25.6 25.96 100-104 24.14 25.135 25.195 25.53 105-109 23.915 24.945 25.535000000000004 25.605 110-114 23.75 24.759999999999998 25.555 25.935000000000002 115-119 23.990000000000002 25.130000000000003 25.019999999999996 25.86 120-124 23.915 24.715 25.91 25.46 125-129 23.705000000000002 25.11 25.674999999999997 25.509999999999998 130-134 23.925 24.625 25.4 26.05 135-139 23.69 24.84 25.885 25.585 140-144 23.799999999999997 24.565 25.915 25.72 145-149 23.794999999999998 24.94 25.4 25.865 150-151 24.2 24.425 24.975 26.400000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 2.0 28 3.0 29 3.5 30 4.5 31 6.0 32 8.0 33 17.5 34 25.5 35 28.5 36 34.0 37 47.0 38 58.5 39 78.0 40 115.5 41 136.5 42 170.0 43 209.0 44 221.0 45 212.0 46 215.0 47 215.0 48 197.5 49 193.5 50 183.5 51 157.0 52 125.0 53 116.0 54 111.5 55 110.0 56 112.0 57 103.0 58 90.0 59 80.0 60 80.5 61 67.5 62 56.0 63 53.0 64 51.0 65 45.0 66 31.5 67 37.0 68 35.5 69 26.5 70 25.5 71 25.0 72 22.0 73 16.0 74 12.5 75 11.5 76 8.5 77 2.0 78 0.0 79 1.0 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.949999999999999 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26952141057934 98.52499999999999 2 0.7052896725440806 1.4000000000000001 3 0.025188916876574305 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5375 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 1.0 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.4 0.0 0.0 0.0 0.0 122-123 1.5 0.0 0.0 0.0 0.0 124-125 1.65 0.0 0.0 0.0 0.0 126-127 1.725 0.0 0.0 0.0 0.0 128-129 1.925 0.0 0.0 0.0 0.0 130-131 2.1125 0.0 0.0 0.0 0.0 132-133 2.4125 0.0 0.0 0.0 0.0 134-135 2.7375 0.0 0.0 0.0 0.0 136-137 3.0250000000000004 0.0 0.0 0.0 0.0 138-139 3.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958338 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958338_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.915 33.0 33.0 34.0 32.0 34.0 2 32.9285 34.0 33.0 34.0 32.0 34.0 3 32.91175 34.0 33.0 34.0 32.0 34.0 4 32.88375 34.0 33.0 34.0 32.0 34.0 5 32.85175 34.0 33.0 34.0 32.0 34.0 6 36.779 38.0 38.0 38.0 35.0 38.0 7 36.75975 38.0 38.0 38.0 36.0 38.0 8 36.64175 38.0 38.0 38.0 35.0 38.0 9 36.72825 38.0 38.0 38.0 35.0 38.0 10-14 36.75605 38.0 38.0 38.0 35.0 38.0 15-19 36.90695 38.0 38.0 38.0 36.0 38.0 20-24 36.96070000000001 38.0 38.0 38.0 36.2 38.0 25-29 36.875600000000006 38.0 38.0 38.0 36.0 38.0 30-34 36.8569 38.0 38.0 38.0 35.8 38.0 35-39 36.6622 38.0 38.0 38.0 34.8 38.0 40-44 36.6292 38.0 38.0 38.0 35.0 38.0 45-49 36.65785 38.0 38.0 38.0 35.0 38.0 50-54 36.63555 38.0 38.0 38.0 35.0 38.0 55-59 36.57915 38.0 38.0 38.0 34.4 38.0 60-64 36.5971 38.0 38.0 38.0 34.6 38.0 65-69 36.51015 38.0 38.0 38.0 34.2 38.0 70-74 36.43755 38.0 38.0 38.0 34.0 38.0 75-79 36.268 38.0 38.0 38.0 33.6 38.0 80-84 36.09805 38.0 37.8 38.0 33.0 38.0 85-89 35.9695 38.0 37.4 38.0 32.6 38.0 90-94 35.989 38.0 37.2 38.0 33.0 38.0 95-99 35.89665 38.0 37.2 38.0 33.0 38.0 100-104 35.619600000000005 38.0 37.0 38.0 31.0 38.0 105-109 35.1161 38.0 35.8 38.0 28.8 38.0 110-114 34.78705 38.0 35.2 38.0 27.2 38.0 115-119 34.59439999999999 38.0 35.0 38.0 26.2 38.0 120-124 34.26195 38.0 34.8 38.0 24.0 38.0 125-129 33.6922 38.0 34.0 38.0 21.4 38.0 130-134 32.8794 37.8 33.0 38.0 14.8 38.0 135-139 31.3804 35.8 30.0 38.0 14.0 38.0 140-144 31.02325 36.0 29.6 38.0 13.0 38.0 145-149 31.009149999999998 36.2 31.0 38.0 8.6 38.0 150-151 26.458750000000002 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 8.0 4 3.0 5 0.0 6 1.0 7 1.0 8 4.0 9 0.0 10 1.0 11 1.0 12 2.0 13 3.0 14 4.0 15 4.0 16 4.0 17 5.0 18 4.0 19 5.0 20 5.0 21 14.0 22 16.0 23 15.0 24 15.0 25 22.0 26 25.0 27 45.0 28 50.0 29 43.0 30 78.0 31 75.0 32 131.0 33 154.0 34 245.0 35 440.0 36 909.0 37 1661.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.725 19.025 13.65 31.6 2 31.374999999999996 22.875 25.8 19.950000000000003 3 23.974999999999998 26.1 27.55 22.375 4 26.950000000000003 30.575000000000003 19.725 22.75 5 25.900000000000002 32.7 19.625 21.775 6 24.825 35.025 19.625 20.525 7 23.674999999999997 19.425 33.6 23.3 8 25.124999999999996 23.125 23.625 28.125 9 23.425 22.650000000000002 27.85 26.075 10-14 25.765 26.015 23.26 24.959999999999997 15-19 25.6 25.740000000000002 24.035 24.625 20-24 25.585 26.085 24.04 24.29 25-29 25.81 25.28 24.12 24.79 30-34 25.319999999999997 25.264999999999997 24.785 24.63 35-39 25.845000000000002 26.21 23.335 24.610000000000003 40-44 26.450000000000003 25.2 24.075 24.275 45-49 25.759999999999998 25.655 24.22 24.365000000000002 50-54 26.064999999999998 25.629999999999995 24.035 24.27 55-59 26.38 25.575 23.885 24.16 60-64 26.185000000000002 24.73 24.45 24.635 65-69 25.729999999999997 25.66 24.77 23.84 70-74 26.174999999999997 24.83 24.95 24.044999999999998 75-79 26.075 24.73 24.490000000000002 24.705 80-84 26.145000000000003 25.490000000000002 24.55 23.815 85-89 26.06 25.369999999999997 24.465 24.104999999999997 90-94 25.855 25.585 24.779999999999998 23.78 95-99 26.325 25.28 24.43 23.965 100-104 25.72 25.735000000000003 24.6 23.945 105-109 25.805 25.34 25.380000000000003 23.474999999999998 110-114 26.125 25.669999999999998 24.47 23.735 115-119 26.279999999999998 25.83 24.22 23.669999999999998 120-124 26.340000000000003 26.174999999999997 24.185000000000002 23.3 125-129 26.895000000000003 25.919999999999998 24.235 22.95 130-134 26.009999999999998 26.119999999999997 24.63 23.24 135-139 26.640000000000004 25.94 24.125 23.294999999999998 140-144 26.979999999999997 26.340000000000003 23.880000000000003 22.8 145-149 26.195 25.605 24.22 23.98 150-151 26.487500000000004 25.8 24.25 23.4625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 1.0 27 1.0 28 2.5 29 4.0 30 2.5 31 4.0 32 8.0 33 10.5 34 18.5 35 25.0 36 35.0 37 55.5 38 71.5 39 92.5 40 111.0 41 114.0 42 137.5 43 166.0 44 192.0 45 197.5 46 195.0 47 202.0 48 197.0 49 185.0 50 174.0 51 173.5 52 150.0 53 127.5 54 118.5 55 109.5 56 107.0 57 98.0 58 95.5 59 98.0 60 87.0 61 71.0 62 54.0 63 55.0 64 63.5 65 55.0 66 49.0 67 47.5 68 46.5 69 40.0 70 28.0 71 27.0 72 23.5 73 16.5 74 13.0 75 12.5 76 10.0 77 6.5 78 6.0 79 3.0 80 2.0 81 1.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98759807643634 97.775 2 0.8605416350291066 1.7000000000000002 3 0.10124019235636549 0.3 4 0.02531004808909137 0.1 5 0.02531004808909137 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCTTGCGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGCAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5375 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 1.025 0.0 0.0 0.0 0.0 118-119 1.3625 0.0 0.0 0.0 0.0 120-121 1.45 0.0 0.0 0.0 0.0 122-123 1.5750000000000002 0.0 0.0 0.0 0.0 124-125 1.7000000000000002 0.0 0.0 0.0 0.0 126-127 1.7625 0.0 0.0 0.0 0.0 128-129 1.95 0.0 0.0 0.0 0.0 130-131 2.1375 0.0 0.0 0.0 0.0 132-133 2.425 0.0 0.0 0.0 0.0 134-135 2.7375 0.0 0.0 0.0 0.0 136-137 3.0125 0.0 0.0 0.0 0.0 138-139 3.4124999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCCCC 35 0.0035366106 20.714287 125-129 >>END_MODULE Read 783402 spots for SRR6958338.sra Written 783402 spots for SRR6958338.sra Read 783402 spots for SRR6958338.sra Written 783402 spots for SRR6958338.sra Read 783402 spots for SRR6958338.sra Written 783402 spots for SRR6958338.sra Read 783402 spots for SRR6958338.sra Written 783402 spots for SRR6958338.sra Read 783402 spots for SRR6958338.sra Written 783402 spots for SRR6958338.sra Read 783402 spots for SRR6958338.sra Written 783402 spots for SRR6958338.sra Read 783413 spots for SRR6958338.sra Written 783413 spots for SRR6958338.sra Read 783402 spots for SRR6958338.sra Written 783402 spots for SRR6958338.sra Read 783402 spots for SRR6958338.sra Written 783402 spots for SRR6958338.sra Read 783402 spots for SRR6958338.sra Written 783402 spots for SRR6958338.sra Read 783402 spots for SRR6958338.sra Written 783402 spots for SRR6958338.sra Read 783402 spots for SRR6958338.sra Written 783402 spots for SRR6958338.sra Read 783402 spots for SRR6958338.sra Written 783402 spots for SRR6958338.sra Read 783402 spots for SRR6958338.sra Written 783402 spots for SRR6958338.sra Read 783402 spots for SRR6958338.sra Written 783402 spots for SRR6958338.sra Read 783402 spots for SRR6958338.sra Written 783402 spots for SRR6958338.sra Read 783402 spots for SRR6958338.sra Written 783402 spots for SRR6958338.sra Read 783402 spots for SRR6958338.sra Written 783402 spots for SRR6958338.sra Read 783402 spots for SRR6958338.sra Written 783402 spots for SRR6958338.sra Read 783402 spots for SRR6958338.sra Written 783402 spots for SRR6958338.sra SRR ids: ['SRR6958338.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_puzcf2ic SRR6958338.sra spots: 15668051 blocks: [[1, 783402], [783403, 1566804], [1566805, 2350206], [2350207, 3133608], [3133609, 3917010], [3917011, 4700412], [4700413, 5483814], [5483815, 6267216], [6267217, 7050618], [7050619, 7834020], [7834021, 8617422], [8617423, 9400824], [9400825, 10184226], [10184227, 10967628], [10967629, 11751030], [11751031, 12534432], [12534433, 13317834], [13317835, 14101236], [14101237, 14884638], [14884639, 15668051]] SRR6958338 file size 5287688 SRR6958338 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958338 SRR6958338_1.fastq SRR6958338_2.fastq Input file: SRR6958338_1.fastq Paired file: SRR6958338_2.fastq trimmed: SRR6958338-trimmed-pair1.fastq, SRR6958338-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:18:14 2024 >> started Fri Dec 6 20:18:33 2024 >> done (18.514s) 15668051 read pairs processed; of these: 15903 ( 0.10%) short read pairs filtered out after trimming by size control 11724 ( 0.07%) empty read pairs filtered out after trimming by size control 15640424 (99.82%) read pairs available; of these: 6539784 (41.81%) trimmed read pairs available after processing 9100640 (58.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 0 0.00% 21 2 0.00% 22 4 0.00% 23 4 0.00% 24 2 0.00% 25 6 0.00% 26 5 0.00% 27 7 0.00% 28 4 0.00% 29 8 0.00% 30 6 0.00% 31 3 0.00% 32 3 0.00% 33 8 0.00% 34 4 0.00% 35 8 0.00% 36 6 0.00% 37 9 0.00% 38 10 0.00% 39 13 0.00% 40 11 0.00% 41 11 0.00% 42 6 0.00% 43 13 0.00% 44 16 0.00% 45 20 0.00% 46 21 0.00% 47 16 0.00% 48 21 0.00% 49 23 0.00% 50 19 0.00% 51 31 0.00% 52 38 0.00% 53 42 0.00% 54 36 0.00% 55 37 0.00% 56 51 0.00% 57 44 0.00% 58 77 0.00% 59 71 0.00% 60 84 0.00% 61 104 0.00% 62 94 0.00% 63 108 0.00% 64 140 0.00% 65 153 0.00% 66 152 0.00% 67 195 0.00% 68 204 0.00% 69 238 0.00% 70 263 0.00% 71 285 0.00% 72 340 0.00% 73 359 0.00% 74 420 0.00% 75 435 0.00% 76 522 0.00% 77 592 0.00% 78 642 0.00% 79 737 0.00% 80 865 0.01% 81 949 0.01% 82 1123 0.01% 83 1330 0.01% 84 2070 0.01% 85 2567 0.02% 86 2541 0.02% 87 2784 0.02% 88 2878 0.02% 89 2956 0.02% 90 3083 0.02% 91 3397 0.02% 92 3640 0.02% 93 3953 0.03% 94 4197 0.03% 95 4623 0.03% 96 4783 0.03% 97 5252 0.03% 98 5443 0.03% 99 5710 0.04% 100 6299 0.04% 101 6551 0.04% 102 7057 0.05% 103 7833 0.05% 104 8269 0.05% 105 8950 0.06% 106 9436 0.06% 107 9879 0.06% 108 10311 0.07% 109 10998 0.07% 110 11432 0.07% 111 12191 0.08% 112 13235 0.08% 113 14174 0.09% 114 15141 0.10% 115 16049 0.10% 116 17188 0.11% 117 17850 0.11% 118 18453 0.12% 119 19511 0.12% 120 20413 0.13% 121 21255 0.14% 122 22788 0.15% 123 24134 0.15% 124 25254 0.16% 125 27350 0.17% 126 28454 0.18% 127 29784 0.19% 128 31002 0.20% 129 33095 0.21% 130 35032 0.22% 131 36838 0.24% 132 39401 0.25% 133 43077 0.28% 134 45904 0.29% 135 49445 0.32% 136 53377 0.34% 137 58257 0.37% 138 62881 0.40% 139 69342 0.44% 140 75715 0.48% 141 83616 0.53% 142 92403 0.59% 143 99973 0.64% 144 108608 0.69% 145 121141 0.77% 146 146625 0.94% 147 202058 1.29% 148 324692 2.08% 149 687030 4.39% 150 3529098 22.56% 151 9100640 58.19% 15640424 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.92 fanout-score-rank=17 prefix-density=0.80 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=42.77 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.6 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.79 fanout-score-rank=16 prefix-density=0.55 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=50.96 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=4.8 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958338 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:19:15 Started mapping on | Dec 06 20:19:15 Finished on | Dec 06 20:21:02 Mapping speed, Million of reads per hour | 526.22 Number of input reads | 15640424 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14830080 Uniquely mapped reads % | 94.82% Average mapped length | 296.63 Number of splices: Total | 17104939 Number of splices: Annotated (sjdb) | 16144729 Number of splices: GT/AG | 16889828 Number of splices: GC/AG | 197129 Number of splices: AT/AC | 5942 Number of splices: Non-canonical | 12040 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 207772 % of reads mapped to multiple loci | 1.33% Number of reads mapped to too many loci | 42889 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.72% % of reads unmapped: other | 1.86% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 611532 611532 611532 N_multimapping 207772 207772 207772 N_noFeature 513262 14419974 620783 N_ambiguous 358634 1907 56911 UnstrandedReadsAssigned:13958184 PositiveStrandReadsAssigned:408199 NegativeStrandReadsAssigned:14152386 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958338 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958338-trimmed-pair1.fastq SRR6958338-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,640,424 reads, 14,219,411 reads pseudoaligned [quant] estimated average fragment length: 264.957 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52973 SRR6958338.ke.tsv 35125 SRR6958338.se.tsv 88098 total ==> SRR6958338.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 672.502 0 0 PNS24247 1044 780.043 49.5599 6.47753 PNS24249 1928 1664.04 44.0044 2.69606 PNS24246 1044 780.043 49.5599 6.47753 PNS24248 1044 780.043 49.5599 6.47753 PNS24244 1471 1207.04 19.3159 1.63151 PNS24243 293 82.8619 0 0 KQK14069 1603 1339.04 4752.4 361.84 KQK14071 474 224.004 55.1035 25.0796 ==> SRR6958338.se.tsv <== BRADI_1g14170v3 5139 BRADI_1g53295v3 138 BRADI_1g59795v3 101 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 164 BRADI_1g74790v3 70 BRADI_1g09890v3 0 BRADI_1g77505v3 176 BRADI_1g48960v3 0 SRR6958338 completed mapping pipeline successfully