Starting /dee2/code/volunteer_pipeline.sh SRR6958339 current disk space = 1549577711616 free memory = 1392836320 SRR6958339 SRAfilesize a5d032c278f1873f01d76cf79b6bd485 SRR6958339.sra SRR6958339.sra file validated SRR6958339 is paired end SRR6958339 is conventional basespace SRR6958339 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958339_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.39825 18.0 18.0 30.0 18.0 32.0 2 22.431 18.0 18.0 27.0 18.0 31.0 3 28.18125 28.0 27.0 31.0 25.0 33.0 4 30.79075 31.0 29.0 33.0 27.0 33.0 5 32.3835 33.0 33.0 33.0 31.0 33.0 6 36.74225 38.0 37.0 38.0 35.0 38.0 7 37.41875 38.0 38.0 38.0 37.0 38.0 8 37.48375 38.0 38.0 38.0 37.0 38.0 9 37.629 38.0 38.0 38.0 37.0 38.0 10-14 37.655649999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.6345 38.0 38.0 38.0 38.0 38.0 20-24 37.675850000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.6614 38.0 38.0 38.0 38.0 38.0 30-34 37.615300000000005 38.0 38.0 38.0 37.8 38.0 35-39 37.5718 38.0 38.0 38.0 37.8 38.0 40-44 37.64375 38.0 38.0 38.0 38.0 38.0 45-49 37.6464 38.0 38.0 38.0 38.0 38.0 50-54 37.5658 38.0 38.0 38.0 38.0 38.0 55-59 37.5308 38.0 38.0 38.0 38.0 38.0 60-64 37.50385 38.0 38.0 38.0 38.0 38.0 65-69 37.40455 38.0 38.0 38.0 37.4 38.0 70-74 37.42225 38.0 38.0 38.0 37.0 38.0 75-79 37.3765 38.0 38.0 38.0 37.0 38.0 80-84 37.370400000000004 38.0 38.0 38.0 37.0 38.0 85-89 37.071600000000004 38.0 38.0 38.0 36.0 38.0 90-94 37.144850000000005 38.0 38.0 38.0 36.0 38.0 95-99 37.22035 38.0 38.0 38.0 36.0 38.0 100-104 37.078450000000004 38.0 38.0 38.0 35.8 38.0 105-109 37.0265 38.0 38.0 38.0 35.6 38.0 110-114 36.9196 38.0 38.0 38.0 35.2 38.0 115-119 36.8345 38.0 38.0 38.0 35.0 38.0 120-124 36.67055 38.0 38.0 38.0 34.8 38.0 125-129 36.5107 38.0 38.0 38.0 34.0 38.0 130-134 36.4634 38.0 38.0 38.0 34.0 38.0 135-139 36.38080000000001 38.0 38.0 38.0 34.0 38.0 140-144 34.63195 38.0 34.8 38.0 27.6 38.0 145-149 35.24525 38.0 35.2 38.0 31.2 38.0 150-151 32.381875 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 4.0 20 1.0 21 2.0 22 3.0 23 1.0 24 3.0 25 4.0 26 6.0 27 9.0 28 12.0 29 19.0 30 16.0 31 31.0 32 43.0 33 63.0 34 94.0 35 251.0 36 781.0 37 2655.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 19.9124162802679 25.991756826378154 7.676455435342606 46.419371458011334 2 21.224999999999998 16.475 32.275 30.025000000000002 3 21.9 17.45 24.625 36.025 4 25.275 25.25 20.625 28.849999999999998 5 24.625 29.2 24.375 21.8 6 22.25 33.725 23.0 21.025 7 15.325 24.45 40.875 19.35 8 19.525000000000002 24.175 30.5 25.8 9 20.325 22.975 33.025 23.674999999999997 10-14 22.43 27.169999999999998 26.650000000000002 23.75 15-19 22.155 25.555 27.01 25.28 20-24 22.125 26.305 26.75 24.82 25-29 22.065 26.815 26.56 24.560000000000002 30-34 22.115000000000002 26.61 26.965 24.310000000000002 35-39 22.695 26.009999999999998 26.029999999999998 25.264999999999997 40-44 22.564999999999998 26.279999999999998 26.384999999999998 24.77 45-49 21.865000000000002 26.875 26.31 24.95 50-54 22.275 26.66 26.775 24.29 55-59 22.325 26.56 26.11 25.005 60-64 22.165000000000003 26.555 26.165 25.115 65-69 22.37 26.325 26.884999999999998 24.42 70-74 22.165000000000003 26.3 26.645000000000003 24.89 75-79 22.485 25.755 26.884999999999998 24.875 80-84 22.695 26.290000000000003 26.369999999999997 24.645 85-89 22.73 26.255 26.724999999999998 24.29 90-94 22.21 26.565 25.865 25.36 95-99 22.415 25.7 27.084999999999997 24.8 100-104 22.702946031110887 25.989096183664284 26.514279997999303 24.79367778722553 105-109 22.465 25.995 26.384999999999998 25.155 110-114 23.14694408322497 25.692707812343702 26.818045413624088 24.34230269080724 115-119 23.113089581353474 26.22417846246186 26.07412594408043 24.588606012104236 120-124 22.48 26.265 25.96 25.295 125-129 23.065759183264937 26.31868681813632 25.81323190871785 24.802322089880892 130-134 23.425 26.334999999999997 25.82 24.42 135-139 22.525000000000002 26.185000000000002 25.53 25.759999999999998 140-144 23.075000000000003 26.145000000000003 25.480000000000004 25.3 145-149 23.215 26.085 26.055 24.645 150-151 22.5 26.424999999999997 25.825 25.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 1.0 26 2.0 27 3.0 28 3.5 29 4.0 30 9.5 31 16.5 32 19.0 33 22.5 34 25.0 35 35.0 36 61.0 37 81.5 38 95.0 39 117.5 40 151.5 41 183.5 42 213.0 43 229.5 44 240.0 45 254.5 46 230.0 47 208.5 48 213.0 49 194.0 50 165.0 51 133.0 52 109.5 53 116.0 54 110.0 55 91.0 56 78.0 57 67.0 58 65.0 59 65.0 60 54.5 61 48.0 62 47.5 63 47.5 64 42.0 65 27.0 66 24.0 67 18.5 68 15.5 69 17.5 70 15.5 71 11.5 72 5.0 73 3.5 74 4.0 75 1.5 76 1.0 77 1.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.034999999999999996 105-109 0.0 110-114 0.03 115-119 0.034999999999999996 120-124 0.0 125-129 0.09 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.3263871453678132 0.65 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6499999999999999 0.0 0.0 0.0 0.0 100-101 0.8500000000000001 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.2000000000000002 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.5750000000000002 0.0 0.0 0.0 0.0 112-113 1.775 0.0 0.0 0.0 0.0 114-115 1.9125 0.0 0.0 0.0 0.0 116-117 2.2625 0.0 0.0 0.0 0.0 118-119 2.675 0.0 0.0 0.0 0.0 120-121 3.1500000000000004 0.0 0.0 0.0 0.0 122-123 3.5 0.0 0.0 0.0 0.0 124-125 3.9000000000000004 0.0 0.0 0.0 0.0 126-127 4.375 0.0 0.0 0.0 0.0 128-129 4.9125 0.0 0.0 0.0 0.0 130-131 5.45 0.0 0.0 0.0 0.0 132-133 5.95 0.0 0.0 0.0 0.0 134-135 6.4625 0.0 0.0 0.0 0.0 136-137 6.824999999999999 0.0 0.0 0.0 0.0 138-139 7.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAAGAA 10 0.006883923 144.625 145 CAAGTTC 10 0.006883923 144.625 4 ATATATA 10 0.006883923 144.625 9 >>END_MODULE SRR6958339 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958339_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.9565 33.0 27.0 33.0 18.0 34.0 2 31.70675 33.0 32.0 34.0 27.0 34.0 3 32.534 33.0 32.0 34.0 31.0 34.0 4 32.9795 33.0 33.0 34.0 32.0 34.0 5 33.16625 33.0 33.0 34.0 33.0 34.0 6 37.55225 38.0 38.0 38.0 38.0 38.0 7 37.5785 38.0 38.0 38.0 38.0 38.0 8 37.53975 38.0 38.0 38.0 38.0 38.0 9 37.6215 38.0 38.0 38.0 38.0 38.0 10-14 37.60315 38.0 38.0 38.0 38.0 38.0 15-19 36.46854999999999 38.0 36.8 38.0 31.8 38.0 20-24 36.38525 38.0 37.0 38.0 31.4 38.0 25-29 37.45175 38.0 38.0 38.0 37.6 38.0 30-34 37.53415 38.0 38.0 38.0 38.0 38.0 35-39 37.513600000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.45855 38.0 38.0 38.0 37.8 38.0 45-49 37.09845 38.0 38.0 38.0 36.4 38.0 50-54 37.47525 38.0 38.0 38.0 38.0 38.0 55-59 37.483450000000005 38.0 38.0 38.0 38.0 38.0 60-64 37.436 38.0 38.0 38.0 38.0 38.0 65-69 37.4285 38.0 38.0 38.0 38.0 38.0 70-74 37.37165 38.0 38.0 38.0 38.0 38.0 75-79 37.35985 38.0 38.0 38.0 37.8 38.0 80-84 37.3238 38.0 38.0 38.0 37.8 38.0 85-89 37.279799999999994 38.0 38.0 38.0 37.4 38.0 90-94 37.28995 38.0 38.0 38.0 37.2 38.0 95-99 37.21665 38.0 38.0 38.0 37.2 38.0 100-104 37.0958 38.0 38.0 38.0 36.6 38.0 105-109 37.078199999999995 38.0 38.0 38.0 36.4 38.0 110-114 36.8962 38.0 38.0 38.0 35.6 38.0 115-119 37.012950000000004 38.0 38.0 38.0 36.0 38.0 120-124 36.856700000000004 38.0 38.0 38.0 35.4 38.0 125-129 35.51275 38.0 36.2 38.0 29.0 38.0 130-134 35.818200000000004 38.0 37.2 38.0 31.2 38.0 135-139 35.6109 38.0 37.2 38.0 30.2 38.0 140-144 35.35850000000001 38.0 36.2 38.0 30.8 38.0 145-149 33.303599999999996 38.0 32.8 38.0 23.4 38.0 150-151 29.556 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 1.0 5 1.0 6 3.0 7 0.0 8 1.0 9 1.0 10 1.0 11 3.0 12 0.0 13 1.0 14 1.0 15 2.0 16 1.0 17 0.0 18 1.0 19 0.0 20 2.0 21 2.0 22 2.0 23 0.0 24 5.0 25 10.0 26 2.0 27 15.0 28 16.0 29 10.0 30 28.0 31 35.0 32 49.0 33 66.0 34 125.0 35 217.0 36 664.0 37 2730.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.2 19.85 12.8 30.15 2 30.025000000000002 24.4 28.575 17.0 3 21.05 26.974999999999998 27.925 24.05 4 25.474999999999998 32.35 21.025 21.15 5 26.825 33.275 20.95 18.95 6 21.975 36.775000000000006 21.6 19.650000000000002 7 21.475 19.05 37.275000000000006 22.2 8 23.325000000000003 23.95 25.324999999999996 27.400000000000002 9 23.05 23.45 29.65 23.849999999999998 10-14 25.285000000000004 27.18 24.32 23.215 15-19 25.36 26.19 25.105 23.345 20-24 24.525 26.565 25.81 23.1 25-29 25.03 26.43 25.36 23.18 30-34 24.685000000000002 26.740000000000002 25.480000000000004 23.095 35-39 24.715 27.075 25.155 23.055 40-44 25.22 26.240000000000002 25.569999999999997 22.97 45-49 25.240000000000002 26.150000000000002 25.515 23.095 50-54 25.005 25.585 26.334999999999997 23.075000000000003 55-59 25.729999999999997 25.900000000000002 25.695 22.675 60-64 25.145 26.245 25.735000000000003 22.875 65-69 25.115 26.66 25.674999999999997 22.55 70-74 24.955 26.450000000000003 25.555 23.04 75-79 25.174999999999997 25.995 26.095000000000002 22.735 80-84 24.38 26.61 26.185000000000002 22.825 85-89 25.25 26.22 26.025 22.505 90-94 25.019999999999996 26.334999999999997 25.885 22.759999999999998 95-99 24.275 26.46 26.35 22.915 100-104 25.095 26.5 26.064999999999998 22.34 105-109 25.165 26.834999999999997 25.88 22.12 110-114 24.779999999999998 27.0 25.759999999999998 22.46 115-119 25.974999999999998 26.884999999999998 25.374999999999996 21.765 120-124 25.555 26.779999999999998 25.22 22.445 125-129 25.619999999999997 26.775 25.335 22.27 130-134 26.08 26.590000000000003 25.6 21.73 135-139 26.31 26.43 25.745 21.515 140-144 26.200000000000003 26.619999999999997 25.335 21.845 145-149 26.88 27.205000000000002 24.740000000000002 21.175 150-151 26.8125 27.1625 25.4625 20.5625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 0.5 25 1.5 26 3.0 27 2.5 28 5.5 29 6.5 30 6.5 31 12.0 32 16.5 33 20.5 34 24.5 35 35.0 36 53.5 37 71.0 38 89.0 39 114.0 40 146.0 41 181.5 42 196.0 43 196.5 44 212.5 45 218.5 46 211.0 47 210.0 48 206.0 49 202.0 50 177.5 51 141.5 52 120.0 53 114.0 54 111.5 55 93.0 56 82.0 57 86.0 58 83.0 59 70.0 60 67.5 61 61.0 62 50.0 63 49.0 64 40.5 65 35.0 66 38.0 67 37.5 68 26.0 69 13.5 70 13.5 71 14.0 72 8.0 73 4.5 74 6.5 75 5.5 76 2.0 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5727569741141 99.05000000000001 2 0.3518471977883891 0.7000000000000001 3 0.050263885398341285 0.15 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6499999999999999 0.0 0.0 0.0 0.0 100-101 0.8500000000000001 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.1749999999999998 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.5499999999999998 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.2375 0.0 0.0 0.0 0.0 118-119 2.65 0.0 0.0 0.0 0.0 120-121 3.125 0.0 0.0 0.0 0.0 122-123 3.4124999999999996 0.0 0.0 0.0 0.0 124-125 3.8 0.0 0.0 0.0 0.0 126-127 4.275 0.0 0.0 0.0 0.0 128-129 4.8125 0.0 0.0 0.0 0.0 130-131 5.3375 0.0 0.0 0.0 0.0 132-133 5.85 0.0 0.0 0.0 0.0 134-135 6.3625 0.0 0.0 0.0 0.0 136-137 6.824999999999999 0.0 0.0 0.0 0.0 138-139 7.487500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCACG 10 0.006830828 145.0 2 >>END_MODULE Read 880858 spots for SRR6958339.sra Written 880858 spots for SRR6958339.sra Read 880858 spots for SRR6958339.sra Written 880858 spots for SRR6958339.sra Read 880858 spots for SRR6958339.sra Written 880858 spots for SRR6958339.sra Read 880858 spots for SRR6958339.sra Written 880858 spots for SRR6958339.sra Read 880858 spots for SRR6958339.sra Written 880858 spots for SRR6958339.sra Read 880869 spots for SRR6958339.sra Written 880869 spots for SRR6958339.sra Read 880858 spots for SRR6958339.sra Written 880858 spots for SRR6958339.sra Read 880858 spots for SRR6958339.sra Written 880858 spots for SRR6958339.sra Read 880858 spots for SRR6958339.sra Written 880858 spots for SRR6958339.sra Read 880858 spots for SRR6958339.sra Written 880858 spots for SRR6958339.sra Read 880858 spots for SRR6958339.sra Written 880858 spots for SRR6958339.sra Read 880858 spots for SRR6958339.sra Written 880858 spots for SRR6958339.sra Read 880858 spots for SRR6958339.sra Written 880858 spots for SRR6958339.sra Read 880858 spots for SRR6958339.sra Written 880858 spots for SRR6958339.sra Read 880858 spots for SRR6958339.sra Written 880858 spots for SRR6958339.sra Read 880858 spots for SRR6958339.sra Written 880858 spots for SRR6958339.sra Read 880858 spots for SRR6958339.sra Written 880858 spots for SRR6958339.sra Read 880858 spots for SRR6958339.sra Written 880858 spots for SRR6958339.sra Read 880858 spots for SRR6958339.sra Written 880858 spots for SRR6958339.sra Read 880858 spots for SRR6958339.sra Written 880858 spots for SRR6958339.sra SRR ids: ['SRR6958339.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i4setog_ SRR6958339.sra spots: 17617171 blocks: [[1, 880858], [880859, 1761716], [1761717, 2642574], [2642575, 3523432], [3523433, 4404290], [4404291, 5285148], [5285149, 6166006], [6166007, 7046864], [7046865, 7927722], [7927723, 8808580], [8808581, 9689438], [9689439, 10570296], [10570297, 11451154], [11451155, 12332012], [12332013, 13212870], [13212871, 14093728], [14093729, 14974586], [14974587, 15855444], [15855445, 16736302], [16736303, 17617171]] SRR6958339 file size 5948180 SRR6958339 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958339 SRR6958339_1.fastq SRR6958339_2.fastq Input file: SRR6958339_1.fastq Paired file: SRR6958339_2.fastq trimmed: SRR6958339-trimmed-pair1.fastq, SRR6958339-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:17:40 2024 >> started Fri Dec 6 20:18:03 2024 >> done (22.839s) 17617171 read pairs processed; of these: 5784 ( 0.03%) short read pairs filtered out after trimming by size control 9319 ( 0.05%) empty read pairs filtered out after trimming by size control 17602068 (99.91%) read pairs available; of these: 6358050 (36.12%) trimmed read pairs available after processing 11244018 (63.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 8 0.00% 21 6 0.00% 22 8 0.00% 23 6 0.00% 24 1 0.00% 25 5 0.00% 26 13 0.00% 27 8 0.00% 28 8 0.00% 29 16 0.00% 30 7 0.00% 31 17 0.00% 32 12 0.00% 33 14 0.00% 34 8 0.00% 35 9 0.00% 36 9 0.00% 37 23 0.00% 38 21 0.00% 39 26 0.00% 40 25 0.00% 41 28 0.00% 42 30 0.00% 43 24 0.00% 44 35 0.00% 45 35 0.00% 46 49 0.00% 47 42 0.00% 48 49 0.00% 49 44 0.00% 50 66 0.00% 51 74 0.00% 52 60 0.00% 53 91 0.00% 54 113 0.00% 55 102 0.00% 56 121 0.00% 57 142 0.00% 58 155 0.00% 59 188 0.00% 60 207 0.00% 61 230 0.00% 62 282 0.00% 63 333 0.00% 64 323 0.00% 65 369 0.00% 66 419 0.00% 67 444 0.00% 68 501 0.00% 69 586 0.00% 70 669 0.00% 71 735 0.00% 72 882 0.01% 73 1019 0.01% 74 1177 0.01% 75 1294 0.01% 76 1575 0.01% 77 1708 0.01% 78 1804 0.01% 79 2011 0.01% 80 2250 0.01% 81 2508 0.01% 82 3019 0.02% 83 3386 0.02% 84 3992 0.02% 85 4414 0.03% 86 4714 0.03% 87 5110 0.03% 88 5542 0.03% 89 6004 0.03% 90 6680 0.04% 91 7308 0.04% 92 7920 0.04% 93 8509 0.05% 94 9399 0.05% 95 10031 0.06% 96 10647 0.06% 97 11199 0.06% 98 12367 0.07% 99 13442 0.08% 100 15535 0.09% 101 17339 0.10% 102 15778 0.09% 103 16775 0.10% 104 17600 0.10% 105 18169 0.10% 106 19606 0.11% 107 20607 0.12% 108 21428 0.12% 109 22449 0.13% 110 23600 0.13% 111 24472 0.14% 112 25979 0.15% 113 27107 0.15% 114 28513 0.16% 115 30114 0.17% 116 30958 0.18% 117 32230 0.18% 118 33287 0.19% 119 34003 0.19% 120 35248 0.20% 121 36190 0.21% 122 37616 0.21% 123 39451 0.22% 124 40847 0.23% 125 42541 0.24% 126 43828 0.25% 127 45599 0.26% 128 46297 0.26% 129 47545 0.27% 130 49273 0.28% 131 50128 0.28% 132 52324 0.30% 133 54210 0.31% 134 56006 0.32% 135 58102 0.33% 136 60810 0.35% 137 62333 0.35% 138 63764 0.36% 139 67183 0.38% 140 69886 0.40% 141 73844 0.42% 142 79818 0.45% 143 84685 0.48% 144 94086 0.53% 145 109139 0.62% 146 130126 0.74% 147 159668 0.91% 148 252362 1.43% 149 495088 2.81% 150 3187786 18.11% 151 11244018 63.88% 17602068 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=3.26 fanout-score-rank=19 prefix-density=0.61 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=148.37 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=9.2 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=3.91 fanout-score-rank=20 prefix-density=0.40 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=155.68 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=7.9 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958339 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:19:12 Started mapping on | Dec 06 20:19:12 Finished on | Dec 06 20:20:40 Mapping speed, Million of reads per hour | 720.08 Number of input reads | 17602068 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 17257056 Uniquely mapped reads % | 98.04% Average mapped length | 294.82 Number of splices: Total | 19772893 Number of splices: Annotated (sjdb) | 18520045 Number of splices: GT/AG | 19508498 Number of splices: GC/AG | 230632 Number of splices: AT/AC | 7248 Number of splices: Non-canonical | 26515 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.34 Insertion rate per base | 0.01% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 161978 % of reads mapped to multiple loci | 0.92% Number of reads mapped to too many loci | 12152 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.57% % of reads unmapped: other | 0.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 187442 187442 187442 N_multimapping 161978 161978 161978 N_noFeature 709433 16752321 878251 N_ambiguous 405822 2394 70523 UnstrandedReadsAssigned:16141801 PositiveStrandReadsAssigned:502341 NegativeStrandReadsAssigned:16308282 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958339 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958339-trimmed-pair1.fastq SRR6958339-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,602,068 reads, 16,333,586 reads pseudoaligned [quant] estimated average fragment length: 238.205 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52973 SRR6958339.ke.tsv 35125 SRR6958339.se.tsv 88098 total ==> SRR6958339.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 699.306 0 0 PNS24247 1044 806.795 62.1718 7.35319 PNS24249 1928 1690.79 40.8251 2.304 PNS24246 1044 806.795 62.1718 7.35319 PNS24248 1044 806.795 62.1718 7.35319 PNS24244 1471 1233.79 33.6596 2.60322 PNS24243 293 95.237 0 0 KQK14069 1603 1365.79 4223.95 295.107 KQK14071 474 244.693 70.7613 27.5944 ==> SRR6958339.se.tsv <== BRADI_1g14170v3 4879 BRADI_1g53295v3 226 BRADI_1g59795v3 319 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 196 BRADI_1g74790v3 87 BRADI_1g09890v3 0 BRADI_1g77505v3 209 BRADI_1g48960v3 0 SRR6958339 completed mapping pipeline successfully