Starting /dee2/code/volunteer_pipeline.sh SRR6958340 current disk space = 1549546008576 free memory = 1601549992 SRR6958340 SRAfilesize 0003c2029ffc82154988899969c52dd3 SRR6958340.sra SRR6958340.sra file validated SRR6958340 is paired end SRR6958340 is conventional basespace SRR6958340 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958340_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.12575 18.0 18.0 27.0 18.0 32.0 2 22.3955 18.0 18.0 27.0 18.0 31.0 3 26.05075 27.0 25.0 30.0 18.0 31.0 4 27.69025 29.0 27.0 31.0 15.0 33.0 5 31.281 33.0 31.0 33.0 29.0 33.0 6 35.70175 37.0 35.0 38.0 31.0 38.0 7 37.073 38.0 37.0 38.0 36.0 38.0 8 37.09 38.0 38.0 38.0 35.0 38.0 9 37.24925 38.0 38.0 38.0 36.0 38.0 10-14 37.478300000000004 38.0 38.0 38.0 37.2 38.0 15-19 37.59805 38.0 38.0 38.0 38.0 38.0 20-24 37.616350000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.67165 38.0 38.0 38.0 38.0 38.0 30-34 37.63285 38.0 38.0 38.0 38.0 38.0 35-39 37.6521 38.0 38.0 38.0 38.0 38.0 40-44 37.62355000000001 38.0 38.0 38.0 38.0 38.0 45-49 37.60485 38.0 38.0 38.0 38.0 38.0 50-54 37.558099999999996 38.0 38.0 38.0 38.0 38.0 55-59 37.5196 38.0 38.0 38.0 38.0 38.0 60-64 37.5002 38.0 38.0 38.0 37.8 38.0 65-69 37.3197 38.0 38.0 38.0 36.8 38.0 70-74 37.38665 38.0 38.0 38.0 37.0 38.0 75-79 37.3732 38.0 38.0 38.0 37.0 38.0 80-84 37.341449999999995 38.0 38.0 38.0 37.0 38.0 85-89 36.88075 38.0 37.8 38.0 35.0 38.0 90-94 37.04715 38.0 38.0 38.0 35.6 38.0 95-99 37.119699999999995 38.0 38.0 38.0 36.0 38.0 100-104 37.0241 38.0 38.0 38.0 35.8 38.0 105-109 37.01675 38.0 38.0 38.0 35.6 38.0 110-114 36.85555 38.0 38.0 38.0 35.0 38.0 115-119 36.79475 38.0 38.0 38.0 35.0 38.0 120-124 36.656600000000005 38.0 38.0 38.0 34.4 38.0 125-129 36.45465 38.0 38.0 38.0 34.2 38.0 130-134 36.47735 38.0 38.0 38.0 34.0 38.0 135-139 36.40385 38.0 38.0 38.0 34.2 38.0 140-144 34.817049999999995 38.0 35.4 38.0 27.4 38.0 145-149 35.32899999999999 38.0 35.2 38.0 31.6 38.0 150-151 32.924125000000004 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 1.0 18 0.0 19 2.0 20 0.0 21 0.0 22 5.0 23 0.0 24 8.0 25 5.0 26 4.0 27 5.0 28 7.0 29 16.0 30 21.0 31 32.0 32 52.0 33 70.0 34 117.0 35 258.0 36 863.0 37 2530.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 15.128205128205128 39.05128205128205 6.102564102564102 39.71794871794872 2 19.325 20.599999999999998 25.575 34.5 3 19.825 21.325 25.374999999999996 33.475 4 23.25 28.675 22.2 25.874999999999996 5 25.05 32.35 22.05 20.549999999999997 6 21.375 34.625 23.974999999999998 20.025000000000002 7 14.725 24.474999999999998 41.949999999999996 18.85 8 19.525000000000002 23.275000000000002 28.975 28.225 9 18.55 21.975 33.650000000000006 25.825 10-14 21.865000000000002 27.35 26.615 24.169999999999998 15-19 22.065 26.275 26.590000000000003 25.069999999999997 20-24 22.49 26.77 26.965 23.775 25-29 22.125 26.8 26.33 24.745 30-34 21.765 26.240000000000002 27.575 24.42 35-39 22.345000000000002 26.950000000000003 26.095000000000002 24.610000000000003 40-44 22.24 27.084999999999997 26.745 23.93 45-49 22.220000000000002 26.26 26.6 24.92 50-54 21.865000000000002 26.715 26.575 24.845 55-59 22.35 26.31 26.465 24.875 60-64 22.195 26.290000000000003 26.625 24.89 65-69 21.88 26.784999999999997 26.47 24.865000000000002 70-74 21.995 26.590000000000003 26.46 24.955 75-79 22.33 26.090000000000003 26.605 24.975 80-84 22.63 26.085 26.665 24.62 85-89 22.665 26.035000000000004 26.345000000000002 24.955 90-94 22.705000000000002 26.479999999999997 26.21 24.605 95-99 22.48 26.11 26.735 24.675 100-104 22.2366775081311 26.00450337753315 26.564923692769575 25.193895421566175 105-109 22.505 26.810000000000002 26.150000000000002 24.535 110-114 22.503502101260757 26.515909545727435 26.550930558335 24.429657794676807 115-119 23.298979387632578 26.36581949169502 25.805483289973985 24.52971783069842 120-124 22.755 26.21 26.450000000000003 24.585 125-129 22.87274002103471 26.488706365503077 25.657334602093457 24.981219011368758 130-134 22.525000000000002 26.455000000000002 26.11 24.91 135-139 22.975 25.895000000000003 25.825 25.305 140-144 22.81 25.900000000000002 25.705 25.585 145-149 22.665 26.76 25.215 25.36 150-151 22.325 26.5625 25.650000000000002 25.4625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.0 25 2.0 26 2.5 27 2.0 28 4.0 29 6.5 30 8.5 31 14.5 32 21.0 33 27.0 34 39.0 35 51.0 36 70.0 37 87.5 38 101.5 39 129.0 40 152.0 41 181.0 42 210.5 43 221.0 44 224.0 45 245.5 46 251.5 47 218.0 48 193.0 49 189.5 50 172.0 51 138.0 52 110.0 53 97.5 54 94.0 55 89.5 56 89.0 57 77.5 58 62.5 59 60.5 60 51.0 61 42.0 62 43.0 63 39.0 64 32.0 65 26.0 66 26.0 67 23.5 68 18.5 69 15.0 70 14.0 71 9.5 72 5.5 73 4.0 74 2.5 75 1.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.075 105-109 0.0 110-114 0.06 115-119 0.06 120-124 0.0 125-129 0.165 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5475113122172 99.0 2 0.3770739064856712 0.75 3 0.050276520864756154 0.15 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.5875 0.0 0.0 0.0 0.0 106-107 1.7875 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.2125 0.0 0.0 0.0 0.0 112-113 2.5375 0.0 0.0 0.0 0.0 114-115 2.8875 0.0 0.0 0.0 0.0 116-117 3.2625 0.0 0.0 0.0 0.0 118-119 3.7375 0.0 0.0 0.0 0.0 120-121 4.1875 0.0 0.0 0.0 0.0 122-123 4.85 0.0 0.0 0.0 0.0 124-125 5.4875 0.0 0.0 0.0 0.0 126-127 6.025 0.0 0.0 0.0 0.0 128-129 6.6375 0.0 0.0 0.0 0.0 130-131 7.237500000000001 0.0 0.0 0.0 0.0 132-133 7.9375 0.0 0.0 0.0 0.0 134-135 8.5875 0.0 0.0 0.0 0.0 136-137 9.2625 0.0 0.0 0.0 0.0 138-139 9.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAGAC 10 0.006883923 144.625 5 GAAGACA 10 0.006883923 144.625 6 >>END_MODULE SRR6958340 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958340_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.7435 33.0 27.0 33.0 18.0 34.0 2 31.98225 33.0 32.0 34.0 27.0 34.0 3 32.60575 33.0 33.0 34.0 32.0 34.0 4 32.9615 33.0 33.0 34.0 32.0 34.0 5 33.085 33.0 33.0 34.0 33.0 34.0 6 37.40575 38.0 38.0 38.0 37.0 38.0 7 37.49925 38.0 38.0 38.0 38.0 38.0 8 37.477 38.0 38.0 38.0 38.0 38.0 9 37.46125 38.0 38.0 38.0 38.0 38.0 10-14 37.458600000000004 38.0 38.0 38.0 38.0 38.0 15-19 36.6477 38.0 37.4 38.0 32.6 38.0 20-24 36.478750000000005 38.0 37.4 38.0 32.2 38.0 25-29 37.3584 38.0 38.0 38.0 37.6 38.0 30-34 37.4248 38.0 38.0 38.0 38.0 38.0 35-39 37.38555 38.0 38.0 38.0 38.0 38.0 40-44 37.28615 38.0 38.0 38.0 37.8 38.0 45-49 36.6943 38.0 37.8 38.0 34.8 38.0 50-54 37.31485 38.0 38.0 38.0 38.0 38.0 55-59 37.35455 38.0 38.0 38.0 38.0 38.0 60-64 37.303549999999994 38.0 38.0 38.0 38.0 38.0 65-69 37.31609999999999 38.0 38.0 38.0 38.0 38.0 70-74 37.2534 38.0 38.0 38.0 37.4 38.0 75-79 37.2034 38.0 38.0 38.0 37.0 38.0 80-84 37.171200000000006 38.0 38.0 38.0 37.0 38.0 85-89 37.1642 38.0 38.0 38.0 37.0 38.0 90-94 37.155499999999996 38.0 38.0 38.0 37.0 38.0 95-99 37.0389 38.0 38.0 38.0 37.0 38.0 100-104 36.948 38.0 38.0 38.0 36.2 38.0 105-109 36.89905 38.0 38.0 38.0 36.0 38.0 110-114 36.4277 38.0 38.0 38.0 34.2 38.0 115-119 36.83 38.0 38.0 38.0 35.8 38.0 120-124 36.627449999999996 38.0 38.0 38.0 35.0 38.0 125-129 35.48434999999999 38.0 36.4 38.0 29.0 38.0 130-134 35.51815 38.0 36.6 38.0 30.4 38.0 135-139 35.3288 38.0 37.2 38.0 29.6 38.0 140-144 35.03959999999999 38.0 35.8 38.0 29.8 38.0 145-149 33.624399999999994 38.0 34.0 38.0 23.4 38.0 150-151 29.81375 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 3.0 4 0.0 5 0.0 6 2.0 7 2.0 8 2.0 9 1.0 10 0.0 11 2.0 12 3.0 13 3.0 14 0.0 15 2.0 16 2.0 17 3.0 18 1.0 19 2.0 20 3.0 21 3.0 22 3.0 23 7.0 24 6.0 25 8.0 26 9.0 27 14.0 28 11.0 29 26.0 30 13.0 31 37.0 32 59.0 33 67.0 34 119.0 35 214.0 36 675.0 37 2691.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.475 21.6 10.0 24.925 2 29.225 24.099999999999998 28.15 18.525 3 23.150000000000002 25.624999999999996 29.9 21.325 4 25.674999999999997 32.95 20.724999999999998 20.65 5 27.800000000000004 34.55 18.525 19.125 6 22.75 37.95 20.5 18.8 7 22.975 20.75 35.35 20.925 8 21.775 23.799999999999997 26.525 27.900000000000002 9 23.825 23.3 27.525 25.35 10-14 26.095000000000002 26.93 23.72 23.255 15-19 25.39 25.845000000000002 25.635 23.13 20-24 25.1 26.495 25.124999999999996 23.28 25-29 25.385 26.035000000000004 25.36 23.22 30-34 25.080000000000002 26.455000000000002 25.245 23.22 35-39 24.884999999999998 26.25 25.665 23.200000000000003 40-44 25.105 26.064999999999998 25.31 23.52 45-49 24.77 26.279999999999998 25.88 23.07 50-54 25.180000000000003 25.995 25.89 22.935 55-59 25.14 26.39 25.759999999999998 22.71 60-64 25.55 26.424999999999997 25.435000000000002 22.59 65-69 24.585 26.295 25.945 23.175 70-74 24.94 26.075 26.33 22.655 75-79 24.9 26.655 26.035000000000004 22.41 80-84 24.610000000000003 26.63 26.185000000000002 22.575 85-89 25.025 26.05 25.94 22.985 90-94 25.55 26.63 25.465 22.355 95-99 24.815 26.915 25.564999999999998 22.705000000000002 100-104 25.169999999999998 26.924999999999997 25.755 22.15 105-109 25.605 26.290000000000003 25.759999999999998 22.345000000000002 110-114 25.535000000000004 26.955000000000002 26.015 21.495 115-119 26.275 26.525 25.56 21.64 120-124 26.605 27.1 24.595 21.7 125-129 25.89 27.21 25.27 21.63 130-134 26.07 27.825 24.84 21.265 135-139 26.44 26.255 25.85 21.455 140-144 26.884999999999998 27.325 24.92 20.87 145-149 27.215 27.250000000000004 24.740000000000002 20.794999999999998 150-151 27.375 26.700000000000003 25.124999999999996 20.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 2.0 23 1.5 24 0.0 25 2.0 26 3.0 27 3.5 28 6.0 29 7.0 30 7.0 31 8.5 32 12.5 33 19.0 34 32.5 35 39.5 36 46.0 37 71.0 38 91.5 39 101.5 40 124.5 41 157.0 42 180.0 43 190.5 44 212.0 45 236.0 46 232.5 47 221.0 48 218.5 49 198.5 50 172.0 51 160.5 52 151.0 53 128.5 54 106.5 55 86.5 56 73.5 57 83.0 58 74.0 59 68.0 60 70.5 61 57.0 62 48.5 63 43.5 64 39.5 65 35.0 66 31.5 67 27.5 68 24.0 69 20.0 70 15.0 71 14.0 72 13.5 73 10.5 74 7.5 75 7.0 76 3.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67369477911646 99.275 2 0.2761044176706827 0.5499999999999999 3 0.0251004016064257 0.075 4 0.0251004016064257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.2625000000000002 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.7374999999999998 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 2.1125 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.7750000000000004 0.0 0.0 0.0 0.0 116-117 3.1875 0.0 0.0 0.0 0.0 118-119 3.6875 0.0 0.0 0.0 0.0 120-121 4.0625 0.0 0.0 0.0 0.0 122-123 4.7125 0.0 0.0 0.0 0.0 124-125 5.35 0.0 0.0 0.0 0.0 126-127 5.875 0.0 0.0 0.0 0.0 128-129 6.449999999999999 0.0 0.0 0.0 0.0 130-131 6.925 0.0 0.0 0.0 0.0 132-133 7.625 0.0 0.0 0.0 0.0 134-135 8.3125 0.0 0.0 0.0 0.0 136-137 9.0125 0.0 0.0 0.0 0.0 138-139 9.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATATAC 10 0.006830828 145.0 5 TCTGGGG 10 0.006830828 145.0 7 >>END_MODULE Read 707487 spots for SRR6958340.sra Written 707487 spots for SRR6958340.sra Read 707487 spots for SRR6958340.sra Written 707487 spots for SRR6958340.sra Read 707487 spots for SRR6958340.sra Written 707487 spots for SRR6958340.sra Read 707487 spots for SRR6958340.sra Written 707487 spots for SRR6958340.sra Read 707487 spots for SRR6958340.sra Written 707487 spots for SRR6958340.sra Read 707487 spots for SRR6958340.sra Written 707487 spots for SRR6958340.sra Read 707487 spots for SRR6958340.sra Written 707487 spots for SRR6958340.sra Read 707487 spots for SRR6958340.sra Written 707487 spots for SRR6958340.sra Read 707501 spots for SRR6958340.sra Written 707501 spots for SRR6958340.sra Read 707487 spots for SRR6958340.sra Written 707487 spots for SRR6958340.sra Read 707487 spots for SRR6958340.sra Written 707487 spots for SRR6958340.sra Read 707487 spots for SRR6958340.sra Written 707487 spots for SRR6958340.sra Read 707487 spots for SRR6958340.sra Written 707487 spots for SRR6958340.sra Read 707487 spots for SRR6958340.sra Written 707487 spots for SRR6958340.sra Read 707487 spots for SRR6958340.sra Written 707487 spots for SRR6958340.sra Read 707487 spots for SRR6958340.sra Written 707487 spots for SRR6958340.sra Read 707487 spots for SRR6958340.sra Written 707487 spots for SRR6958340.sra Read 707487 spots for SRR6958340.sra Written 707487 spots for SRR6958340.sra Read 707487 spots for SRR6958340.sra Written 707487 spots for SRR6958340.sra Read 707487 spots for SRR6958340.sra Written 707487 spots for SRR6958340.sra SRR ids: ['SRR6958340.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bxljp89d SRR6958340.sra spots: 14149754 blocks: [[1, 707487], [707488, 1414974], [1414975, 2122461], [2122462, 2829948], [2829949, 3537435], [3537436, 4244922], [4244923, 4952409], [4952410, 5659896], [5659897, 6367383], [6367384, 7074870], [7074871, 7782357], [7782358, 8489844], [8489845, 9197331], [9197332, 9904818], [9904819, 10612305], [10612306, 11319792], [11319793, 12027279], [12027280, 12734766], [12734767, 13442253], [13442254, 14149754]] SRR6958340 file size 4773186 SRR6958340 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958340 SRR6958340_1.fastq SRR6958340_2.fastq Input file: SRR6958340_1.fastq Paired file: SRR6958340_2.fastq trimmed: SRR6958340-trimmed-pair1.fastq, SRR6958340-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:20:27 2024 >> started Fri Dec 6 20:20:43 2024 >> done (16.225s) 14149754 read pairs processed; of these: 12812 ( 0.09%) short read pairs filtered out after trimming by size control 16003 ( 0.11%) empty read pairs filtered out after trimming by size control 14120939 (99.80%) read pairs available; of these: 5423142 (38.40%) trimmed read pairs available after processing 8697797 (61.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 6 0.00% 20 8 0.00% 21 7 0.00% 22 12 0.00% 23 10 0.00% 24 7 0.00% 25 8 0.00% 26 13 0.00% 27 12 0.00% 28 12 0.00% 29 7 0.00% 30 14 0.00% 31 12 0.00% 32 18 0.00% 33 8 0.00% 34 18 0.00% 35 17 0.00% 36 16 0.00% 37 15 0.00% 38 25 0.00% 39 20 0.00% 40 31 0.00% 41 24 0.00% 42 40 0.00% 43 24 0.00% 44 32 0.00% 45 38 0.00% 46 33 0.00% 47 48 0.00% 48 54 0.00% 49 51 0.00% 50 81 0.00% 51 83 0.00% 52 89 0.00% 53 112 0.00% 54 105 0.00% 55 110 0.00% 56 141 0.00% 57 157 0.00% 58 187 0.00% 59 194 0.00% 60 222 0.00% 61 249 0.00% 62 306 0.00% 63 316 0.00% 64 348 0.00% 65 412 0.00% 66 429 0.00% 67 528 0.00% 68 518 0.00% 69 693 0.00% 70 742 0.01% 71 897 0.01% 72 1010 0.01% 73 1079 0.01% 74 1254 0.01% 75 1408 0.01% 76 1855 0.01% 77 1912 0.01% 78 1976 0.01% 79 2272 0.02% 80 2505 0.02% 81 2830 0.02% 82 3310 0.02% 83 3610 0.03% 84 4562 0.03% 85 5093 0.04% 86 5443 0.04% 87 5795 0.04% 88 6282 0.04% 89 6595 0.05% 90 7368 0.05% 91 8033 0.06% 92 8857 0.06% 93 9502 0.07% 94 10314 0.07% 95 10846 0.08% 96 11281 0.08% 97 12121 0.09% 98 12482 0.09% 99 13924 0.10% 100 15543 0.11% 101 16848 0.12% 102 16899 0.12% 103 18222 0.13% 104 19017 0.13% 105 19709 0.14% 106 20594 0.15% 107 21162 0.15% 108 22335 0.16% 109 22885 0.16% 110 23785 0.17% 111 25388 0.18% 112 27123 0.19% 113 28081 0.20% 114 30060 0.21% 115 30908 0.22% 116 31590 0.22% 117 32779 0.23% 118 33055 0.23% 119 33555 0.24% 120 35185 0.25% 121 36367 0.26% 122 37994 0.27% 123 40455 0.29% 124 42167 0.30% 125 43060 0.30% 126 44323 0.31% 127 44556 0.32% 128 45287 0.32% 129 46160 0.33% 130 47416 0.34% 131 49114 0.35% 132 51041 0.36% 133 53101 0.38% 134 54785 0.39% 135 56800 0.40% 136 58455 0.41% 137 59208 0.42% 138 60691 0.43% 139 62556 0.44% 140 64682 0.46% 141 68224 0.48% 142 72575 0.51% 143 77287 0.55% 144 85754 0.61% 145 97109 0.69% 146 114572 0.81% 147 136735 0.97% 148 206592 1.46% 149 394817 2.80% 150 2475450 17.53% 151 8697797 61.60% 14120939 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=25 prefix-density=0.80 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=139.35 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=9.2 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=3.24 fanout-score-rank=21 prefix-density=0.51 prefix-fanout=2.9 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=89.00 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=4.8 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCCCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAA SRR6958340 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:21:31 Started mapping on | Dec 06 20:21:31 Finished on | Dec 06 20:23:07 Mapping speed, Million of reads per hour | 529.54 Number of input reads | 14120939 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13696619 Uniquely mapped reads % | 97.00% Average mapped length | 292.84 Number of splices: Total | 15561503 Number of splices: Annotated (sjdb) | 14618289 Number of splices: GT/AG | 15347432 Number of splices: GC/AG | 177395 Number of splices: AT/AC | 5686 Number of splices: Non-canonical | 30990 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 168040 % of reads mapped to multiple loci | 1.19% Number of reads mapped to too many loci | 6308 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.54% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 265014 265014 265014 N_multimapping 168040 168040 168040 N_noFeature 553661 13254709 677240 N_ambiguous 366921 1806 49499 UnstrandedReadsAssigned:12776037 PositiveStrandReadsAssigned:440104 NegativeStrandReadsAssigned:12969880 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958340 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958340-trimmed-pair1.fastq SRR6958340-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,120,939 reads, 12,983,171 reads pseudoaligned [quant] estimated average fragment length: 232.021 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52973 SRR6958340.ke.tsv 35125 SRR6958340.se.tsv 88098 total ==> SRR6958340.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 705.345 0 0 PNS24247 1044 812.979 29.0888 4.27676 PNS24249 1928 1696.98 28.2447 1.98943 PNS24246 1044 812.979 29.0888 4.27676 PNS24248 1044 812.979 29.0888 4.27676 PNS24244 1471 1239.98 36.489 3.51735 PNS24243 293 99.9623 0 0 KQK14069 1603 1371.98 2615.59 227.872 KQK14071 474 251.331 85.0041 40.4262 ==> SRR6958340.se.tsv <== BRADI_1g14170v3 3273 BRADI_1g53295v3 1003 BRADI_1g59795v3 95 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 268 BRADI_1g74790v3 58 BRADI_1g09890v3 0 BRADI_1g77505v3 181 BRADI_1g48960v3 0 SRR6958340 completed mapping pipeline successfully