Starting /dee2/code/volunteer_pipeline.sh SRR6958341 current disk space = 1549496856576 free memory = 1596686804 SRR6958341 SRAfilesize 4e4b721ec7ddf49f339543f9f19bccf2 SRR6958341.sra SRR6958341.sra file validated SRR6958341 is paired end SRR6958341 is conventional basespace SRR6958341 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958341_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.39125 18.0 18.0 25.0 18.0 32.0 2 24.404 25.0 18.0 29.0 18.0 31.0 3 28.51375 29.0 27.0 31.0 25.0 33.0 4 31.77875 33.0 32.0 33.0 30.0 33.0 5 32.277 33.0 32.0 33.0 32.0 33.0 6 36.19825 38.0 36.0 38.0 33.0 38.0 7 37.2845 38.0 38.0 38.0 36.0 38.0 8 37.45125 38.0 38.0 38.0 37.0 38.0 9 37.16575 38.0 38.0 38.0 36.0 38.0 10-14 37.4317 38.0 38.0 38.0 37.2 38.0 15-19 37.42524999999999 38.0 38.0 38.0 37.2 38.0 20-24 37.2642 38.0 38.0 38.0 36.6 38.0 25-29 36.83505 38.0 38.0 38.0 35.2 38.0 30-34 37.0161 38.0 37.8 38.0 35.2 38.0 35-39 37.2817 38.0 38.0 38.0 36.8 38.0 40-44 37.50789999999999 38.0 38.0 38.0 37.8 38.0 45-49 37.56525 38.0 38.0 38.0 38.0 38.0 50-54 37.5303 38.0 38.0 38.0 38.0 38.0 55-59 37.13715 38.0 38.0 38.0 36.2 38.0 60-64 36.983 38.0 38.0 38.0 35.2 38.0 65-69 37.42295 38.0 38.0 38.0 37.2 38.0 70-74 37.41145 38.0 38.0 38.0 37.2 38.0 75-79 36.2205 38.0 37.2 38.0 32.0 38.0 80-84 36.71595 38.0 37.4 38.0 34.4 38.0 85-89 37.2567 38.0 38.0 38.0 36.8 38.0 90-94 37.296899999999994 38.0 38.0 38.0 36.4 38.0 95-99 37.17805 38.0 38.0 38.0 36.0 38.0 100-104 37.090650000000004 38.0 38.0 38.0 36.0 38.0 105-109 36.9994 38.0 38.0 38.0 35.4 38.0 110-114 37.05695 38.0 38.0 38.0 35.8 38.0 115-119 36.8367 38.0 38.0 38.0 35.0 38.0 120-124 36.56245 38.0 38.0 38.0 34.4 38.0 125-129 36.552049999999994 38.0 38.0 38.0 34.2 38.0 130-134 35.8201 38.0 36.8 38.0 30.8 38.0 135-139 34.964099999999995 38.0 35.4 38.0 26.6 38.0 140-144 35.590799999999994 38.0 36.0 38.0 30.2 38.0 145-149 35.835750000000004 38.0 36.4 38.0 33.0 38.0 150-151 32.442875 36.0 32.5 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 2.0 14 1.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 1.0 24 1.0 25 3.0 26 9.0 27 5.0 28 15.0 29 34.0 30 28.0 31 36.0 32 58.0 33 106.0 34 159.0 35 258.0 36 858.0 37 2420.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.219376109561246 15.013948769972101 5.959928988080142 33.80674613238651 2 22.575 14.549999999999999 30.8 32.074999999999996 3 20.9 18.775 26.1 34.225 4 26.05 25.224999999999998 21.9 26.825 5 24.275 30.775000000000002 22.05 22.900000000000002 6 21.85 33.375 23.200000000000003 21.575 7 16.0 24.025 40.175 19.8 8 18.875 23.125 30.049999999999997 27.950000000000003 9 19.725 21.175 32.975 26.125 10-14 23.085 26.255 26.075 24.585 15-19 23.485 25.165 25.96 25.39 20-24 23.02 26.029999999999998 25.82 25.130000000000003 25-29 22.941147057352868 25.576278813940696 25.85129256462823 25.631281564078208 30-34 22.884999999999998 25.96 26.14 25.014999999999997 35-39 23.044999999999998 25.355 26.645000000000003 24.955 40-44 22.545 25.415 26.55 25.490000000000002 45-49 22.985 25.55 25.825 25.64 50-54 22.935 25.14 25.990000000000002 25.935000000000002 55-59 22.975 25.509999999999998 25.95 25.564999999999998 60-64 23.165 25.685000000000002 25.25 25.900000000000002 65-69 23.321166058302914 25.426271313565678 25.93629681484074 25.316265813290666 70-74 23.51 24.93 25.91 25.650000000000002 75-79 23.064999999999998 25.445 25.990000000000002 25.5 80-84 23.355 25.505 25.445 25.695 85-89 22.564999999999998 25.069999999999997 25.865 26.5 90-94 23.52 25.095 25.650000000000002 25.735000000000003 95-99 23.405 25.119999999999997 25.72 25.755 100-104 23.51 25.2 25.855 25.435000000000002 105-109 23.26 24.85 25.86 26.029999999999998 110-114 23.595 24.945 25.805 25.655 115-119 23.474999999999998 24.68 25.755 26.090000000000003 120-124 23.215 24.79 26.125 25.869999999999997 125-129 23.445 25.040000000000003 25.835 25.679999999999996 130-134 23.115 25.495 25.424999999999997 25.965 135-139 23.04 25.345000000000002 25.77 25.845000000000002 140-144 23.76 24.92 25.14 26.179999999999996 145-149 23.66 25.505 25.419999999999998 25.415 150-151 23.525 25.087500000000002 25.687500000000004 25.7 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 3.0 28 3.0 29 4.0 30 10.5 31 11.5 32 12.5 33 21.5 34 34.0 35 40.5 36 46.5 37 59.0 38 81.5 39 107.5 40 125.0 41 142.5 42 180.0 43 209.0 44 209.5 45 201.0 46 209.0 47 210.5 48 189.5 49 172.5 50 169.5 51 155.0 52 124.5 53 120.0 54 116.5 55 105.0 56 91.5 57 80.0 58 77.5 59 74.0 60 71.0 61 68.0 62 63.0 63 55.0 64 51.0 65 48.5 66 46.5 67 37.5 68 34.5 69 35.0 70 24.5 71 22.0 72 19.0 73 10.0 74 4.5 75 4.5 76 3.5 77 2.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37059415911381 98.675 2 0.5790533736153072 1.15 3 0.025176233635448138 0.075 4 0.025176233635448138 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.7749999999999999 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.725 0.0 0.0 0.0 0.0 120-121 1.9375 0.0 0.0 0.0 0.0 122-123 2.1125 0.0 0.0 0.0 0.0 124-125 2.325 0.0 0.0 0.0 0.0 126-127 2.5375 0.0 0.0 0.0 0.0 128-129 2.8375 0.0 0.0 0.0 0.0 130-131 3.0375 0.0 0.0 0.0 0.0 132-133 3.3875 0.0 0.0 0.0 0.0 134-135 3.725 0.0 0.0 0.0 0.0 136-137 4.1375 0.0 0.0 0.0 0.0 138-139 4.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTCTTT 10 0.0068343505 144.975 2 >>END_MODULE SRR6958341 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958341_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0165 33.0 33.0 34.0 32.0 34.0 2 33.15975 34.0 33.0 34.0 33.0 34.0 3 33.20275 34.0 33.0 34.0 33.0 34.0 4 33.09175 34.0 33.0 34.0 33.0 34.0 5 33.02225 34.0 33.0 34.0 33.0 34.0 6 37.24825 38.0 38.0 38.0 37.0 38.0 7 37.31825 38.0 38.0 38.0 37.0 38.0 8 37.30625 38.0 38.0 38.0 37.0 38.0 9 37.2825 38.0 38.0 38.0 37.0 38.0 10-14 37.229949999999995 38.0 38.0 38.0 37.2 38.0 15-19 37.253750000000004 38.0 38.0 38.0 37.4 38.0 20-24 37.27985 38.0 38.0 38.0 37.4 38.0 25-29 37.22375 38.0 38.0 38.0 37.2 38.0 30-34 37.27925 38.0 38.0 38.0 37.8 38.0 35-39 37.16945 38.0 38.0 38.0 37.2 38.0 40-44 36.771950000000004 38.0 38.0 38.0 35.8 38.0 45-49 36.8223 38.0 38.0 38.0 36.0 38.0 50-54 36.955549999999995 38.0 38.0 38.0 36.6 38.0 55-59 37.1755 38.0 38.0 38.0 37.0 38.0 60-64 37.14725 38.0 38.0 38.0 37.0 38.0 65-69 37.1003 38.0 38.0 38.0 37.0 38.0 70-74 37.08485 38.0 38.0 38.0 37.0 38.0 75-79 37.072199999999995 38.0 38.0 38.0 36.8 38.0 80-84 36.93005 38.0 38.0 38.0 36.0 38.0 85-89 36.77239999999999 38.0 38.0 38.0 35.6 38.0 90-94 36.71005 38.0 38.0 38.0 35.4 38.0 95-99 36.59795 38.0 38.0 38.0 35.0 38.0 100-104 36.55875 38.0 38.0 38.0 34.8 38.0 105-109 36.72234999999999 38.0 38.0 38.0 35.0 38.0 110-114 36.54805 38.0 38.0 38.0 34.8 38.0 115-119 36.4534 38.0 38.0 38.0 34.0 38.0 120-124 36.21475 38.0 38.0 38.0 34.0 38.0 125-129 36.04395 38.0 37.8 38.0 33.4 38.0 130-134 36.0215 38.0 38.0 38.0 33.2 38.0 135-139 35.69725 38.0 37.2 38.0 32.2 38.0 140-144 35.31345 38.0 36.0 38.0 31.0 38.0 145-149 35.0118 38.0 36.0 38.0 31.0 38.0 150-151 30.951500000000003 35.5 30.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 9.0 4 0.0 5 2.0 6 2.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 3.0 13 1.0 14 0.0 15 1.0 16 0.0 17 3.0 18 2.0 19 4.0 20 1.0 21 3.0 22 3.0 23 7.0 24 8.0 25 8.0 26 7.0 27 14.0 28 23.0 29 24.0 30 30.0 31 54.0 32 57.0 33 66.0 34 120.0 35 199.0 36 474.0 37 2864.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.25 21.6 8.200000000000001 24.95 2 30.4 23.425 26.1 20.075000000000003 3 23.575 25.025 28.375 23.025000000000002 4 27.325 31.624999999999996 20.575 20.474999999999998 5 26.825 33.650000000000006 19.1 20.424999999999997 6 23.799999999999997 36.1 19.55 20.549999999999997 7 22.825 20.025000000000002 34.150000000000006 23.0 8 22.925 25.224999999999998 22.525000000000002 29.325000000000003 9 23.625 24.4 25.825 26.150000000000002 10-14 26.215 26.13 23.605 24.05 15-19 25.776288814440722 25.26626331316566 24.91624581229061 24.041202060103007 20-24 25.380000000000003 25.82 25.05 23.75 25-29 25.985000000000003 25.27 24.535 24.21 30-34 25.495 25.88 24.75 23.875 35-39 25.455 25.840000000000003 24.23 24.474999999999998 40-44 25.88 25.965 23.9 24.255 45-49 25.424999999999997 25.619999999999997 24.529999999999998 24.425 50-54 26.13 25.869999999999997 24.104999999999997 23.895 55-59 26.045 25.419999999999998 24.75 23.785 60-64 25.82 25.729999999999997 24.535 23.915 65-69 26.025 26.145000000000003 24.285 23.544999999999998 70-74 25.96 25.624999999999996 24.38 24.035 75-79 25.965 25.91 24.575 23.549999999999997 80-84 25.985000000000003 25.759999999999998 24.13 24.125 85-89 26.11 25.295 24.59 24.005000000000003 90-94 26.351317565878297 25.716285814290714 24.351217560878045 23.581179058952948 95-99 26.49264926492649 25.432543254325434 24.602460246024602 23.472347234723472 100-104 25.72 26.040000000000003 24.54 23.7 105-109 26.174999999999997 25.775 24.675 23.375 110-114 25.515 26.135 24.560000000000002 23.79 115-119 26.187618761876188 25.67256725672567 24.432443244324435 23.707370737073706 120-124 26.650000000000002 26.165 24.41 22.775000000000002 125-129 26.02 25.974999999999998 24.975 23.03 130-134 26.740000000000002 25.21 24.955 23.095 135-139 26.950000000000003 26.035000000000004 24.095 22.919999999999998 140-144 26.351317565878297 26.416320816040802 24.436221811090554 22.796139806990347 145-149 27.065 26.185000000000002 24.044999999999998 22.705000000000002 150-151 26.22827853481685 26.803350418802353 24.428053506688336 22.540317539692463 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 1.0 27 3.0 28 3.0 29 3.0 30 9.5 31 12.5 32 9.5 33 12.0 34 24.0 35 34.0 36 37.0 37 56.0 38 80.5 39 93.5 40 118.5 41 129.0 42 149.0 43 171.0 44 177.5 45 191.5 46 200.0 47 212.0 48 200.0 49 179.0 50 161.0 51 142.0 52 134.0 53 124.0 54 107.0 55 97.0 56 100.5 57 105.0 58 91.5 59 82.0 60 81.5 61 85.0 62 82.5 63 66.0 64 64.5 65 66.0 66 54.0 67 44.5 68 48.0 69 38.0 70 22.5 71 20.5 72 21.5 73 18.0 74 14.0 75 9.5 76 4.0 77 2.0 78 1.5 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.78234398782344 97.35000000000001 2 1.06544901065449 2.1 3 0.076103500761035 0.22499999999999998 4 0.050735667174023336 0.2 5 0.025367833587011668 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.7250000000000001 0.0 0.0 0.0 0.0 108-109 0.8999999999999999 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.1749999999999998 0.0 0.0 0.0 0.0 114-115 1.2625000000000002 0.0 0.0 0.0 0.0 116-117 1.4875 0.0 0.0 0.0 0.0 118-119 1.6875 0.0 0.0 0.0 0.0 120-121 1.9125 0.0 0.0 0.0 0.0 122-123 2.0875 0.0 0.0 0.0 0.0 124-125 2.3 0.0 0.0 0.0 0.0 126-127 2.5125 0.0 0.0 0.0 0.0 128-129 2.8625 0.0 0.0 0.0 0.0 130-131 3.1625 0.0 0.0 0.0 0.0 132-133 3.5625 0.0 0.0 0.0 0.0 134-135 3.9124999999999996 0.0 0.0 0.0 0.0 136-137 4.375 0.0 0.0 0.0 0.0 138-139 4.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1097349 spots for SRR6958341.sra Written 1097349 spots for SRR6958341.sra Read 1097349 spots for SRR6958341.sra Written 1097349 spots for SRR6958341.sra Read 1097349 spots for SRR6958341.sra Written 1097349 spots for SRR6958341.sra Read 1097349 spots for SRR6958341.sra Written 1097349 spots for SRR6958341.sra Read 1097349 spots for SRR6958341.sra Written 1097349 spots for SRR6958341.sra Read 1097349 spots for SRR6958341.sra Written 1097349 spots for SRR6958341.sra Read 1097349 spots for SRR6958341.sra Written 1097349 spots for SRR6958341.sra Read 1097349 spots for SRR6958341.sra Written 1097349 spots for SRR6958341.sra Read 1097349 spots for SRR6958341.sra Written 1097349 spots for SRR6958341.sra Read 1097349 spots for SRR6958341.sra Written 1097349 spots for SRR6958341.sra Read 1097349 spots for SRR6958341.sra Written 1097349 spots for SRR6958341.sra Read 1097349 spots for SRR6958341.sra Written 1097349 spots for SRR6958341.sra Read 1097362 spots for SRR6958341.sra Written 1097362 spots for SRR6958341.sra Read 1097349 spots for SRR6958341.sra Written 1097349 spots for SRR6958341.sra Read 1097349 spots for SRR6958341.sra Written 1097349 spots for SRR6958341.sra Read 1097349 spots for SRR6958341.sra Written 1097349 spots for SRR6958341.sra Read 1097349 spots for SRR6958341.sra Written 1097349 spots for SRR6958341.sra Read 1097349 spots for SRR6958341.sra Written 1097349 spots for SRR6958341.sra Read 1097349 spots for SRR6958341.sra Written 1097349 spots for SRR6958341.sra Read 1097349 spots for SRR6958341.sra Written 1097349 spots for SRR6958341.sra SRR ids: ['SRR6958341.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t28thasy SRR6958341.sra spots: 21946993 blocks: [[1, 1097349], [1097350, 2194698], [2194699, 3292047], [3292048, 4389396], [4389397, 5486745], [5486746, 6584094], [6584095, 7681443], [7681444, 8778792], [8778793, 9876141], [9876142, 10973490], [10973491, 12070839], [12070840, 13168188], [13168189, 14265537], [14265538, 15362886], [15362887, 16460235], [16460236, 17557584], [17557585, 18654933], [18654934, 19752282], [19752283, 20849631], [20849632, 21946993]] SRR6958341 file size 7415415 SRR6958341 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958341 SRR6958341_1.fastq SRR6958341_2.fastq Input file: SRR6958341_1.fastq Paired file: SRR6958341_2.fastq trimmed: SRR6958341-trimmed-pair1.fastq, SRR6958341-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:28:07 2024 >> started Fri Dec 6 20:28:29 2024 >> done (22.488s) 21946993 read pairs processed; of these: 21570 ( 0.10%) short read pairs filtered out after trimming by size control 18391 ( 0.08%) empty read pairs filtered out after trimming by size control 21907032 (99.82%) read pairs available; of these: 7538840 (34.41%) trimmed read pairs available after processing 14368192 (65.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 5 0.00% 20 5 0.00% 21 10 0.00% 22 14 0.00% 23 9 0.00% 24 9 0.00% 25 18 0.00% 26 10 0.00% 27 15 0.00% 28 15 0.00% 29 14 0.00% 30 14 0.00% 31 14 0.00% 32 18 0.00% 33 17 0.00% 34 14 0.00% 35 15 0.00% 36 22 0.00% 37 26 0.00% 38 21 0.00% 39 21 0.00% 40 25 0.00% 41 33 0.00% 42 26 0.00% 43 35 0.00% 44 42 0.00% 45 34 0.00% 46 35 0.00% 47 42 0.00% 48 46 0.00% 49 53 0.00% 50 67 0.00% 51 66 0.00% 52 66 0.00% 53 77 0.00% 54 79 0.00% 55 98 0.00% 56 105 0.00% 57 115 0.00% 58 140 0.00% 59 158 0.00% 60 190 0.00% 61 182 0.00% 62 207 0.00% 63 222 0.00% 64 245 0.00% 65 275 0.00% 66 265 0.00% 67 320 0.00% 68 360 0.00% 69 452 0.00% 70 495 0.00% 71 579 0.00% 72 652 0.00% 73 736 0.00% 74 803 0.00% 75 863 0.00% 76 1002 0.00% 77 1139 0.01% 78 1230 0.01% 79 1392 0.01% 80 1583 0.01% 81 1872 0.01% 82 2170 0.01% 83 2325 0.01% 84 3539 0.02% 85 4300 0.02% 86 4531 0.02% 87 4962 0.02% 88 5154 0.02% 89 5452 0.02% 90 5872 0.03% 91 6278 0.03% 92 6836 0.03% 93 7130 0.03% 94 7729 0.04% 95 8207 0.04% 96 8581 0.04% 97 9211 0.04% 98 9587 0.04% 99 10438 0.05% 100 11205 0.05% 101 12227 0.06% 102 12943 0.06% 103 13707 0.06% 104 14720 0.07% 105 15581 0.07% 106 16581 0.08% 107 17030 0.08% 108 18189 0.08% 109 19087 0.09% 110 19846 0.09% 111 21276 0.10% 112 22363 0.10% 113 23960 0.11% 114 25450 0.12% 115 26658 0.12% 116 27538 0.13% 117 28570 0.13% 118 29255 0.13% 119 30338 0.14% 120 31742 0.14% 121 32977 0.15% 122 34471 0.16% 123 36929 0.17% 124 38296 0.17% 125 40014 0.18% 126 41424 0.19% 127 42452 0.19% 128 43570 0.20% 129 45209 0.21% 130 47178 0.22% 131 48971 0.22% 132 50895 0.23% 133 53146 0.24% 134 56034 0.26% 135 59076 0.27% 136 61046 0.28% 137 63906 0.29% 138 66896 0.31% 139 70681 0.32% 140 74026 0.34% 141 78868 0.36% 142 87907 0.40% 143 105912 0.48% 144 106884 0.49% 145 124890 0.57% 146 155665 0.71% 147 209722 0.96% 148 315565 1.44% 149 587041 2.68% 150 4191899 19.13% 151 14368192 65.59% 21907032 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=22 prefix-density=0.92 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=41.87 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.1 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.69 fanout-score-rank=16 prefix-density=0.54 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=104.61 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=6.6 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCCCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCAC SRR6958341 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:29:42 Started mapping on | Dec 06 20:29:43 Finished on | Dec 06 20:31:57 Mapping speed, Million of reads per hour | 588.55 Number of input reads | 21907032 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 19826113 Uniquely mapped reads % | 90.50% Average mapped length | 288.51 Number of splices: Total | 22663482 Number of splices: Annotated (sjdb) | 21311770 Number of splices: GT/AG | 22346823 Number of splices: GC/AG | 263772 Number of splices: AT/AC | 7698 Number of splices: Non-canonical | 45189 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.02% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 231188 % of reads mapped to multiple loci | 1.06% Number of reads mapped to too many loci | 17149 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.05% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1863089 1863089 1863089 N_multimapping 231188 231188 231188 N_noFeature 678123 19229406 841845 N_ambiguous 522891 3015 90831 UnstrandedReadsAssigned:18625099 PositiveStrandReadsAssigned:593692 NegativeStrandReadsAssigned:18893437 Dataset is classified negative stranded MeadianReadLen=143 20thPercentileLength=142 echo kmer=137 SRR6958341 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958341-trimmed-pair1.fastq SRR6958341-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,907,032 reads, 20,159,764 reads pseudoaligned [quant] estimated average fragment length: 261.461 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,204 rounds 52973 SRR6958341.ke.tsv 35125 SRR6958341.se.tsv 88098 total ==> SRR6958341.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 675.992 0 0 PNS24247 1044 783.539 57.851 5.47559 PNS24249 1928 1667.54 48.4257 2.15368 PNS24246 1044 783.539 57.851 5.47559 PNS24248 1044 783.539 57.851 5.47559 PNS24244 1471 1210.54 47.0213 2.88069 PNS24243 293 93.6294 0 0 KQK14069 1603 1342.54 6290.28 347.475 KQK14071 474 233.29 97.7454 31.0729 ==> SRR6958341.se.tsv <== BRADI_1g14170v3 6492 BRADI_1g53295v3 892 BRADI_1g59795v3 104 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 319 BRADI_1g74790v3 90 BRADI_1g09890v3 0 BRADI_1g77505v3 225 BRADI_1g48960v3 0 SRR6958341 completed mapping pipeline successfully