Starting /dee2/code/volunteer_pipeline.sh SRR6958342 current disk space = 1549466689536 free memory = 1597594932 SRR6958342 SRAfilesize 87837ce4e8a03dea395987b57848eaf7 SRR6958342.sra SRR6958342.sra file validated SRR6958342 is paired end SRR6958342 is conventional basespace SRR6958342 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958342_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.34325 33.0 33.0 34.0 25.0 34.0 2 32.24925 33.0 33.0 34.0 28.0 34.0 3 32.57325 33.0 33.0 34.0 29.0 34.0 4 32.89825 33.0 33.0 34.0 32.0 34.0 5 33.26825 34.0 33.0 34.0 33.0 34.0 6 37.39275 38.0 38.0 38.0 37.0 38.0 7 37.5315 38.0 38.0 38.0 37.0 38.0 8 37.50375 38.0 38.0 38.0 38.0 38.0 9 37.6395 38.0 38.0 38.0 38.0 38.0 10-14 37.622400000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.58265 38.0 38.0 38.0 38.0 38.0 20-24 37.678650000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.69565 38.0 38.0 38.0 38.0 38.0 30-34 37.60615 38.0 38.0 38.0 38.0 38.0 35-39 37.6012 38.0 38.0 38.0 38.0 38.0 40-44 37.5854 38.0 38.0 38.0 38.0 38.0 45-49 37.641749999999995 38.0 38.0 38.0 38.0 38.0 50-54 37.59459999999999 38.0 38.0 38.0 38.0 38.0 55-59 37.5244 38.0 38.0 38.0 38.0 38.0 60-64 37.378 38.0 38.0 38.0 37.4 38.0 65-69 37.4919 38.0 38.0 38.0 38.0 38.0 70-74 37.46125 38.0 38.0 38.0 37.8 38.0 75-79 37.3813 38.0 38.0 38.0 37.0 38.0 80-84 37.3858 38.0 38.0 38.0 37.0 38.0 85-89 36.242450000000005 38.0 36.8 38.0 31.0 38.0 90-94 37.1652 38.0 38.0 38.0 36.2 38.0 95-99 37.19715 38.0 38.0 38.0 36.2 38.0 100-104 37.09665 38.0 38.0 38.0 36.0 38.0 105-109 36.9787 38.0 38.0 38.0 35.6 38.0 110-114 36.60215 38.0 37.8 38.0 34.2 38.0 115-119 36.833800000000004 38.0 38.0 38.0 35.0 38.0 120-124 36.70385 38.0 38.0 38.0 34.8 38.0 125-129 36.567750000000004 38.0 38.0 38.0 34.2 38.0 130-134 36.4901 38.0 38.0 38.0 34.0 38.0 135-139 36.32425 38.0 38.0 38.0 33.4 38.0 140-144 35.573 38.0 37.0 38.0 29.4 38.0 145-149 33.93595 37.6 33.4 38.0 24.4 38.0 150-151 31.90725 35.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 2.0 19 0.0 20 2.0 21 4.0 22 1.0 23 2.0 24 3.0 25 8.0 26 4.0 27 9.0 28 10.0 29 16.0 30 29.0 31 27.0 32 58.0 33 73.0 34 116.0 35 205.0 36 556.0 37 2874.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.53887543718052 9.066451439332795 6.860371267150928 42.53430185633575 2 23.95 12.525 34.925 28.599999999999998 3 21.85 15.425 24.575 38.15 4 26.650000000000002 24.275 21.05 28.025 5 27.725 27.900000000000002 22.375 22.0 6 21.725 31.974999999999998 23.825 22.475 7 18.6 23.799999999999997 38.625 18.975 8 20.0 23.65 30.599999999999998 25.75 9 20.875 21.075 32.5 25.55 10-14 23.080000000000002 25.679999999999996 25.75 25.490000000000002 15-19 23.955000000000002 24.36 25.790000000000003 25.895000000000003 20-24 23.255 24.815 25.7 26.229999999999997 25-29 23.89 25.35 25.09 25.669999999999998 30-34 23.705000000000002 25.09 25.4 25.805 35-39 24.23 25.2 25.205 25.365 40-44 23.855 24.695 25.685000000000002 25.765 45-49 23.544999999999998 24.93 25.240000000000002 26.284999999999997 50-54 24.13 25.15 24.995 25.724999999999998 55-59 24.169999999999998 24.65 25.014999999999997 26.165 60-64 24.349999999999998 24.65 24.85 26.150000000000002 65-69 24.365000000000002 24.765 25.155 25.715 70-74 23.955000000000002 25.06 25.119999999999997 25.865 75-79 23.605 24.975 25.124999999999996 26.295 80-84 23.955000000000002 24.695 25.5 25.85 85-89 23.995 24.82 25.56 25.624999999999996 90-94 24.425 24.05 25.590000000000003 25.935000000000002 95-99 23.794999999999998 24.36 25.259999999999998 26.584999999999997 100-104 24.175 24.93 25.180000000000003 25.715 105-109 24.645 24.525 24.66 26.169999999999998 110-114 24.585 25.16 24.959999999999997 25.295 115-119 23.895 24.845 25.330000000000002 25.929999999999996 120-124 25.045 24.37 24.845 25.740000000000002 125-129 24.595 24.2 25.264999999999997 25.94 130-134 24.73 25.009999999999998 24.505 25.755 135-139 24.765 24.575 25.005 25.655 140-144 24.7 24.88 24.635 25.785000000000004 145-149 24.625 24.725 24.39 26.26 150-151 23.53014761070803 24.655991993995496 25.50662997247936 26.307230422817113 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 2.0 28 5.0 29 6.0 30 8.0 31 11.0 32 12.5 33 18.0 34 20.5 35 28.5 36 45.5 37 53.5 38 65.5 39 95.5 40 120.0 41 144.5 42 158.5 43 157.5 44 169.5 45 200.0 46 202.5 47 198.0 48 196.0 49 164.5 50 148.5 51 153.0 52 142.5 53 128.0 54 123.5 55 100.5 56 83.5 57 86.0 58 92.5 59 96.0 60 90.0 61 82.0 62 78.0 63 73.0 64 61.0 65 57.5 66 60.5 67 50.5 68 37.5 69 32.0 70 34.0 71 32.5 72 23.0 73 14.5 74 11.5 75 8.0 76 6.0 77 3.5 78 1.0 79 1.5 80 1.5 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.074999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19293820933164 98.32499999999999 2 0.7566204287515763 1.5 3 0.025220680958385876 0.075 4 0.025220680958385876 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1625 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.7124999999999999 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.475 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.8875000000000002 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.2249999999999996 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.825 0.0 0.0 0.0 0.0 118-119 3.0625 0.0 0.0 0.0 0.0 120-121 3.6125 0.0 0.0 0.0 0.0 122-123 3.9375 0.0 0.0 0.0 0.0 124-125 4.275 0.0 0.0 0.0 0.0 126-127 4.65 0.0 0.0 0.0 0.0 128-129 5.05 0.0 0.0 0.0 0.0 130-131 5.575 0.0 0.0 0.0 0.0 132-133 6.1 0.0 0.0 0.0 0.0 134-135 6.65 0.0 0.0 0.0 0.0 136-137 7.074999999999999 0.0 0.0 0.0 0.0 138-139 7.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATTCT 10 0.0068396386 144.9375 3 CAAATAA 10 0.0068396386 144.9375 4 >>END_MODULE SRR6958342 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958342_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4705 33.0 33.0 34.0 32.0 34.0 2 33.0285 34.0 33.0 34.0 32.0 34.0 3 33.138 34.0 33.0 34.0 32.0 34.0 4 33.25525 34.0 33.0 34.0 33.0 34.0 5 32.985 34.0 33.0 34.0 32.0 34.0 6 37.33725 38.0 38.0 38.0 37.0 38.0 7 37.45425 38.0 38.0 38.0 38.0 38.0 8 37.4305 38.0 38.0 38.0 38.0 38.0 9 37.40425 38.0 38.0 38.0 38.0 38.0 10-14 37.179700000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.3609 38.0 38.0 38.0 37.4 38.0 20-24 37.4249 38.0 38.0 38.0 38.0 38.0 25-29 37.0421 38.0 38.0 38.0 36.0 38.0 30-34 37.37765 38.0 38.0 38.0 37.6 38.0 35-39 37.25625 38.0 38.0 38.0 37.4 38.0 40-44 36.9534 38.0 38.0 38.0 36.4 38.0 45-49 37.05395 38.0 38.0 38.0 36.6 38.0 50-54 37.08815 38.0 38.0 38.0 36.4 38.0 55-59 37.28805 38.0 38.0 38.0 37.2 38.0 60-64 37.249050000000004 38.0 38.0 38.0 37.0 38.0 65-69 36.48864999999999 38.0 37.8 38.0 33.6 38.0 70-74 37.02335000000001 38.0 38.0 38.0 36.2 38.0 75-79 37.14835 38.0 38.0 38.0 37.0 38.0 80-84 37.04825 38.0 38.0 38.0 36.4 38.0 85-89 36.93470000000001 38.0 38.0 38.0 36.0 38.0 90-94 36.756350000000005 38.0 38.0 38.0 35.6 38.0 95-99 35.3851 38.0 36.4 38.0 28.0 38.0 100-104 36.6592 38.0 38.0 38.0 34.8 38.0 105-109 36.14025 38.0 37.8 38.0 32.8 38.0 110-114 36.642900000000004 38.0 38.0 38.0 35.0 38.0 115-119 36.4671 38.0 38.0 38.0 34.6 38.0 120-124 35.38055 38.0 36.6 38.0 28.0 38.0 125-129 35.917449999999995 38.0 37.4 38.0 32.6 38.0 130-134 35.947799999999994 38.0 38.0 38.0 32.8 38.0 135-139 34.53285 38.0 34.6 38.0 25.6 38.0 140-144 35.0235 38.0 36.0 38.0 29.8 38.0 145-149 33.73295 38.0 34.4 38.0 22.8 38.0 150-151 29.436625 35.5 26.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 2.0 5 1.0 6 0.0 7 0.0 8 0.0 9 2.0 10 2.0 11 1.0 12 1.0 13 0.0 14 4.0 15 0.0 16 1.0 17 1.0 18 4.0 19 1.0 20 4.0 21 6.0 22 5.0 23 4.0 24 9.0 25 17.0 26 22.0 27 13.0 28 26.0 29 41.0 30 31.0 31 51.0 32 62.0 33 91.0 34 146.0 35 239.0 36 585.0 37 2624.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.05 17.224999999999998 10.25 36.475 2 29.825000000000003 23.35 28.275 18.55 3 22.325 24.625 27.450000000000003 25.6 4 26.575 31.0 18.325 24.099999999999998 5 27.6 31.474999999999998 20.075000000000003 20.849999999999998 6 22.0 35.825 20.025000000000002 22.15 7 22.425 19.15 33.75 24.675 8 22.975 25.05 23.925 28.050000000000004 9 23.400000000000002 23.150000000000002 27.05 26.400000000000002 10-14 26.39 25.580000000000002 22.75 25.28 15-19 25.575 25.124999999999996 23.880000000000003 25.419999999999998 20-24 25.775 25.31 24.104999999999997 24.81 25-29 25.77 25.259999999999998 23.865 25.105 30-34 25.945 25.009999999999998 23.635 25.41 35-39 25.945 24.915000000000003 23.985 25.155 40-44 26.05 24.575 23.825 25.55 45-49 25.985000000000003 24.87 24.19 24.955 50-54 25.900000000000002 25.014999999999997 24.08 25.005 55-59 26.169999999999998 24.83 23.865 25.135 60-64 26.169999999999998 25.295 23.580000000000002 24.955 65-69 26.8 24.83 23.61 24.759999999999998 70-74 26.61 24.575 23.94 24.875 75-79 25.935000000000002 24.490000000000002 24.48 25.095 80-84 26.534999999999997 25.324999999999996 23.735 24.404999999999998 85-89 26.005 25.019999999999996 23.71 25.264999999999997 90-94 26.3 24.654999999999998 24.485 24.560000000000002 95-99 26.06 25.155 24.275 24.51 100-104 26.455000000000002 24.375 24.03 25.14 105-109 26.240000000000002 25.34 24.175 24.245 110-114 26.265 25.679999999999996 23.755000000000003 24.3 115-119 27.165 25.095 23.244999999999997 24.495 120-124 26.534999999999997 25.445 23.935000000000002 24.085 125-129 26.735 26.035000000000004 23.685000000000002 23.544999999999998 130-134 27.045 25.585 23.474999999999998 23.895 135-139 27.455000000000002 25.005 23.945 23.595 140-144 27.665 25.615 23.345 23.375 145-149 27.765 25.555 23.150000000000002 23.53 150-151 27.097661623108664 26.04726772539702 23.75890959109666 23.096161060397648 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 1.0 26 1.5 27 1.0 28 2.5 29 5.0 30 7.0 31 7.0 32 7.0 33 14.0 34 19.5 35 25.0 36 35.0 37 47.5 38 68.0 39 86.0 40 111.0 41 139.0 42 137.0 43 143.0 44 166.5 45 174.5 46 188.0 47 181.5 48 161.0 49 159.0 50 147.0 51 132.5 52 125.0 53 122.5 54 121.0 55 119.0 56 111.5 57 106.5 58 109.0 59 98.0 60 94.0 61 90.0 62 92.5 63 91.0 64 86.0 65 80.0 66 66.0 67 61.0 68 54.5 69 46.0 70 40.5 71 33.5 72 24.5 73 22.0 74 14.0 75 6.5 76 5.0 77 5.5 78 3.5 79 1.0 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.75476493011436 97.15 2 1.0927573062261755 2.15 3 0.07623888182973317 0.22499999999999998 4 0.0 0.0 5 0.025412960609911054 0.125 6 0.025412960609911054 0.15 7 0.0 0.0 8 0.025412960609911054 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 8 0.2 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 6 0.15 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1625 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.025 88-89 0.32499999999999996 0.0 0.0 0.0 0.025 90-91 0.375 0.0 0.0 0.0 0.025 92-93 0.5 0.0 0.0 0.0 0.025 94-95 0.625 0.0 0.0 0.0 0.025 96-97 0.7375 0.0 0.0 0.0 0.025 98-99 0.8375 0.0 0.0 0.0 0.025 100-101 1.05 0.0 0.0 0.0 0.025 102-103 1.275 0.0 0.0 0.0 0.025 104-105 1.5 0.0 0.0 0.0 0.025 106-107 1.7375 0.0 0.0 0.0 0.025 108-109 1.9125 0.0 0.0 0.0 0.025 110-111 2.1 0.0 0.0 0.0 0.025 112-113 2.25 0.0 0.0 0.0 0.025 114-115 2.5125 0.0 0.0 0.0 0.025 116-117 2.8625 0.0 0.0 0.0 0.025 118-119 3.0875000000000004 0.0 0.0 0.0 0.025 120-121 3.6125 0.0 0.0 0.0 0.025 122-123 3.9250000000000003 0.0 0.0 0.0 0.025 124-125 4.25 0.0 0.0 0.0 0.025 126-127 4.625 0.0 0.0 0.0 0.025 128-129 5.025 0.0 0.0 0.0 0.025 130-131 5.525 0.0 0.0 0.0 0.025 132-133 6.074999999999999 0.0 0.0 0.0 0.025 134-135 6.6375 0.0 0.0 0.0 0.025 136-137 7.075 0.0 0.0 0.0 0.025 138-139 7.6375 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1322691 spots for SRR6958342.sra Written 1322691 spots for SRR6958342.sra Read 1322691 spots for SRR6958342.sra Written 1322691 spots for SRR6958342.sra Read 1322691 spots for SRR6958342.sra Written 1322691 spots for SRR6958342.sra Read 1322691 spots for SRR6958342.sra Written 1322691 spots for SRR6958342.sra Read 1322691 spots for SRR6958342.sra Written 1322691 spots for SRR6958342.sra Read 1322691 spots for SRR6958342.sra Written 1322691 spots for SRR6958342.sra Read 1322704 spots for SRR6958342.sra Written 1322704 spots for SRR6958342.sra Read 1322691 spots for SRR6958342.sra Written 1322691 spots for SRR6958342.sra Read 1322691 spots for SRR6958342.sra Written 1322691 spots for SRR6958342.sra Read 1322691 spots for SRR6958342.sra Written 1322691 spots for SRR6958342.sra Read 1322691 spots for SRR6958342.sra Written 1322691 spots for SRR6958342.sra Read 1322691 spots for SRR6958342.sra Written 1322691 spots for SRR6958342.sra Read 1322691 spots for SRR6958342.sra Written 1322691 spots for SRR6958342.sra Read 1322691 spots for SRR6958342.sra Written 1322691 spots for SRR6958342.sra Read 1322691 spots for SRR6958342.sra Written 1322691 spots for SRR6958342.sra Read 1322691 spots for SRR6958342.sra Written 1322691 spots for SRR6958342.sra Read 1322691 spots for SRR6958342.sra Written 1322691 spots for SRR6958342.sra Read 1322691 spots for SRR6958342.sra Written 1322691 spots for SRR6958342.sra Read 1322691 spots for SRR6958342.sra Written 1322691 spots for SRR6958342.sra Read 1322691 spots for SRR6958342.sra Written 1322691 spots for SRR6958342.sra SRR ids: ['SRR6958342.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_516u0mpo SRR6958342.sra spots: 26453833 blocks: [[1, 1322691], [1322692, 2645382], [2645383, 3968073], [3968074, 5290764], [5290765, 6613455], [6613456, 7936146], [7936147, 9258837], [9258838, 10581528], [10581529, 11904219], [11904220, 13226910], [13226911, 14549601], [14549602, 15872292], [15872293, 17194983], [17194984, 18517674], [18517675, 19840365], [19840366, 21163056], [21163057, 22485747], [22485748, 23808438], [23808439, 25131129], [25131130, 26453833]] SRR6958342 file size 8942635 SRR6958342 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958342 SRR6958342_1.fastq SRR6958342_2.fastq Input file: SRR6958342_1.fastq Paired file: SRR6958342_2.fastq trimmed: SRR6958342-trimmed-pair1.fastq, SRR6958342-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:25:05 2024 >> started Fri Dec 6 20:25:36 2024 >> done (31.521s) 26453833 read pairs processed; of these: 13265 ( 0.05%) short read pairs filtered out after trimming by size control 21335 ( 0.08%) empty read pairs filtered out after trimming by size control 26419233 (99.87%) read pairs available; of these: 9798772 (37.09%) trimmed read pairs available after processing 16620461 (62.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 8 0.00% 20 6 0.00% 21 8 0.00% 22 10 0.00% 23 10 0.00% 24 10 0.00% 25 8 0.00% 26 18 0.00% 27 13 0.00% 28 14 0.00% 29 17 0.00% 30 16 0.00% 31 16 0.00% 32 21 0.00% 33 23 0.00% 34 17 0.00% 35 14 0.00% 36 25 0.00% 37 30 0.00% 38 38 0.00% 39 31 0.00% 40 33 0.00% 41 34 0.00% 42 40 0.00% 43 38 0.00% 44 41 0.00% 45 51 0.00% 46 67 0.00% 47 71 0.00% 48 80 0.00% 49 92 0.00% 50 109 0.00% 51 109 0.00% 52 125 0.00% 53 135 0.00% 54 148 0.00% 55 182 0.00% 56 202 0.00% 57 237 0.00% 58 273 0.00% 59 286 0.00% 60 364 0.00% 61 359 0.00% 62 448 0.00% 63 450 0.00% 64 554 0.00% 65 612 0.00% 66 696 0.00% 67 745 0.00% 68 886 0.00% 69 966 0.00% 70 1205 0.00% 71 1296 0.00% 72 1529 0.01% 73 1713 0.01% 74 1878 0.01% 75 2162 0.01% 76 2531 0.01% 77 2832 0.01% 78 3062 0.01% 79 3302 0.01% 80 3774 0.01% 81 4324 0.02% 82 5048 0.02% 83 5395 0.02% 84 6739 0.03% 85 7713 0.03% 86 8410 0.03% 87 9199 0.03% 88 9989 0.04% 89 10796 0.04% 90 11446 0.04% 91 12434 0.05% 92 13689 0.05% 93 14417 0.05% 94 15913 0.06% 95 16901 0.06% 96 17994 0.07% 97 19469 0.07% 98 20467 0.08% 99 22008 0.08% 100 23806 0.09% 101 24745 0.09% 102 26451 0.10% 103 28285 0.11% 104 29640 0.11% 105 30937 0.12% 106 32942 0.12% 107 34541 0.13% 108 36104 0.14% 109 38135 0.14% 110 39086 0.15% 111 40708 0.15% 112 43323 0.16% 113 45072 0.17% 114 46482 0.18% 115 49258 0.19% 116 50562 0.19% 117 51901 0.20% 118 54191 0.21% 119 55169 0.21% 120 57034 0.22% 121 58171 0.22% 122 60416 0.23% 123 62246 0.24% 124 64985 0.25% 125 67344 0.25% 126 69139 0.26% 127 71240 0.27% 128 72446 0.27% 129 73810 0.28% 130 76379 0.29% 131 78146 0.30% 132 81516 0.31% 133 84125 0.32% 134 86682 0.33% 135 88516 0.34% 136 92542 0.35% 137 94879 0.36% 138 97486 0.37% 139 102859 0.39% 140 106272 0.40% 141 112496 0.43% 142 121258 0.46% 143 129691 0.49% 144 142490 0.54% 145 161834 0.61% 146 187817 0.71% 147 237916 0.90% 148 341517 1.29% 149 718948 2.72% 150 4950798 18.74% 151 16620461 62.91% 26419233 reads passed initial QC criterion=sequence-density sequence-density=0.99 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=19 prefix-density=1.04 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=31.07 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=3.65 fanout-score-rank=21 prefix-density=0.67 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=74.09 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=3.9 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR6958342 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:26:16 Started mapping on | Dec 06 20:26:16 Finished on | Dec 06 20:29:02 Mapping speed, Million of reads per hour | 572.95 Number of input reads | 26419233 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 25815806 Uniquely mapped reads % | 97.72% Average mapped length | 294.48 Number of splices: Total | 29520683 Number of splices: Annotated (sjdb) | 27733915 Number of splices: GT/AG | 29129738 Number of splices: GC/AG | 340841 Number of splices: AT/AC | 11025 Number of splices: Non-canonical | 39079 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 2.52 Insertion rate per base | 0.01% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 216782 % of reads mapped to multiple loci | 0.82% Number of reads mapped to too many loci | 26225 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.87% % of reads unmapped: other | 0.49% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 396508 396508 396508 N_multimapping 216782 216782 216782 N_noFeature 832179 25073932 1055149 N_ambiguous 619920 3615 102657 UnstrandedReadsAssigned:24363707 PositiveStrandReadsAssigned:738259 NegativeStrandReadsAssigned:24658000 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958342 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958342-trimmed-pair1.fastq SRR6958342-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,419,233 reads, 24,670,794 reads pseudoaligned [quant] estimated average fragment length: 257.256 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,227 rounds 52973 SRR6958342.ke.tsv 35125 SRR6958342.se.tsv 88098 total ==> SRR6958342.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 680.441 0 0 PNS24247 1044 787.744 60.2222 4.56106 PNS24249 1928 1671.74 40.3046 1.4384 PNS24246 1044 787.744 60.2222 4.56106 PNS24248 1044 787.744 60.2222 4.56106 PNS24244 1471 1214.74 44.0289 2.16246 PNS24243 293 95.0363 0 0 KQK14069 1603 1346.74 6048.96 267.973 KQK14071 474 236.926 88.7002 22.336 ==> SRR6958342.se.tsv <== BRADI_1g14170v3 6709 BRADI_1g53295v3 236 BRADI_1g59795v3 284 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 281 BRADI_1g74790v3 120 BRADI_1g09890v3 0 BRADI_1g77505v3 296 BRADI_1g48960v3 0 SRR6958342 completed mapping pipeline successfully