Starting /dee2/code/volunteer_pipeline.sh SRR6958343 current disk space = 1549513584640 free memory = 1600217060 SRR6958343 SRAfilesize d02556859f952cf196dfe20a797df01e SRR6958343.sra SRR6958343.sra file validated SRR6958343 is paired end SRR6958343 is conventional basespace SRR6958343 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958343_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.659 32.0 18.0 33.0 18.0 34.0 2 30.352 31.0 29.0 33.0 27.0 34.0 3 32.1855 33.0 31.0 33.0 29.0 34.0 4 32.7505 33.0 33.0 34.0 31.0 34.0 5 33.0815 33.0 33.0 34.0 33.0 34.0 6 36.6355 38.0 37.0 38.0 34.0 38.0 7 37.34975 38.0 38.0 38.0 37.0 38.0 8 37.5595 38.0 38.0 38.0 37.0 38.0 9 37.297 38.0 38.0 38.0 37.0 38.0 10-14 37.174850000000006 38.0 38.0 38.0 36.2 38.0 15-19 37.5242 38.0 38.0 38.0 37.6 38.0 20-24 37.443999999999996 38.0 38.0 38.0 37.4 38.0 25-29 37.5099 38.0 38.0 38.0 37.2 38.0 30-34 37.570299999999996 38.0 38.0 38.0 37.8 38.0 35-39 37.5168 38.0 38.0 38.0 37.8 38.0 40-44 37.5144 38.0 38.0 38.0 37.6 38.0 45-49 37.3472 38.0 38.0 38.0 37.0 38.0 50-54 37.3446 38.0 38.0 38.0 37.0 38.0 55-59 37.059850000000004 38.0 38.0 38.0 35.8 38.0 60-64 37.208349999999996 38.0 38.0 38.0 36.6 38.0 65-69 37.19255 38.0 38.0 38.0 36.2 38.0 70-74 36.75314999999999 38.0 37.8 38.0 34.8 38.0 75-79 37.128150000000005 38.0 38.0 38.0 36.0 38.0 80-84 37.108900000000006 38.0 38.0 38.0 36.0 38.0 85-89 37.03165 38.0 38.0 38.0 36.0 38.0 90-94 36.930400000000006 38.0 38.0 38.0 35.0 38.0 95-99 36.898 38.0 38.0 38.0 35.0 38.0 100-104 36.73935 38.0 38.0 38.0 34.6 38.0 105-109 36.56965 38.0 38.0 38.0 34.0 38.0 110-114 36.47805 38.0 38.0 38.0 34.0 38.0 115-119 36.277100000000004 38.0 37.6 38.0 33.8 38.0 120-124 36.27524999999999 38.0 37.6 38.0 33.8 38.0 125-129 36.0316 38.0 36.6 38.0 33.2 38.0 130-134 35.8421 38.0 36.2 38.0 32.4 38.0 135-139 35.53315 38.0 36.0 38.0 31.2 38.0 140-144 35.215 38.0 35.4 38.0 29.6 38.0 145-149 34.47925 38.0 35.0 38.0 27.4 38.0 150-151 30.48875 35.5 28.0 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 1.0 18 3.0 19 2.0 20 1.0 21 0.0 22 3.0 23 4.0 24 3.0 25 3.0 26 5.0 27 13.0 28 25.0 29 25.0 30 29.0 31 44.0 32 72.0 33 88.0 34 156.0 35 278.0 36 787.0 37 2455.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.931157572667004 12.213156552779195 9.00050994390617 43.855175930647626 2 20.625 13.875000000000002 36.85 28.65 3 20.41531148361271 15.6617463097323 25.168876657493122 38.75406554916187 4 25.3 22.175 23.549999999999997 28.975 5 26.025 27.425 26.150000000000002 20.4 6 21.55 33.375 23.9 21.175 7 17.474999999999998 28.299999999999997 37.325 16.900000000000002 8 20.025000000000002 26.075 30.775000000000002 23.125 9 18.875 23.025000000000002 34.225 23.875 10-14 21.490000000000002 28.355000000000004 26.935 23.22 15-19 22.25 27.055 26.810000000000002 23.885 20-24 22.14110705535277 26.80134006700335 27.85639281964098 23.201160058002902 25-29 21.565 27.450000000000003 27.405 23.580000000000002 30-34 21.935 27.139999999999997 27.529999999999998 23.395 35-39 21.94 27.62 26.83 23.61 40-44 21.985 27.6 26.82 23.595 45-49 21.825 27.284999999999997 26.674999999999997 24.215 50-54 21.575 27.139999999999997 27.215 24.07 55-59 21.89 26.605 27.62 23.885 60-64 22.245 26.950000000000003 26.525 24.279999999999998 65-69 21.525 27.415 26.77 24.29 70-74 22.805 26.71 26.87 23.615 75-79 21.3 26.625 27.255000000000003 24.82 80-84 21.69 26.974999999999998 26.87 24.465 85-89 21.615000000000002 27.334999999999997 26.840000000000003 24.21 90-94 22.335 27.3 26.47 23.895 95-99 21.884999999999998 27.08 26.700000000000003 24.335 100-104 21.992199219921993 27.477747774777477 26.642664266426642 23.887388738873888 105-109 22.55 27.279999999999998 26.540000000000003 23.630000000000003 110-114 23.046523261630817 27.678839419709856 26.59329664832416 22.681340670335167 115-119 22.560304273846462 27.93013712341107 26.133520168151335 23.37603843459113 120-124 22.085 27.145000000000003 26.314999999999998 24.455 125-129 22.82195073102343 26.852593631083515 26.647306228720208 23.678149409172843 130-134 22.20499224651093 26.621979890950925 27.157220749337203 24.01580711320094 135-139 22.400000000000002 26.755000000000003 26.395000000000003 24.45 140-144 22.28 26.674999999999997 25.990000000000002 25.055 145-149 22.42 26.415 26.435 24.73 150-151 23.1125 25.8625 26.4125 24.6125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 0.5 28 2.0 29 5.0 30 11.5 31 14.0 32 16.0 33 28.5 34 45.5 35 54.0 36 61.5 37 80.0 38 113.5 39 145.5 40 174.5 41 216.0 42 229.0 43 230.0 44 245.0 45 254.0 46 243.0 47 228.5 48 206.0 49 177.5 50 161.5 51 155.5 52 136.5 53 115.0 54 100.0 55 73.5 56 72.5 57 67.5 58 48.5 59 43.0 60 38.5 61 29.0 62 27.5 63 28.0 64 21.5 65 18.5 66 20.0 67 14.0 68 8.0 69 8.5 70 10.0 71 8.5 72 3.0 73 2.5 74 4.0 75 2.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.95 2 0.0 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.01 105-109 0.0 110-114 0.05 115-119 0.09 120-124 0.0 125-129 0.13999999999999999 130-134 0.045 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.025 0.0 0.0 66-67 0.0 0.0 0.025 0.0 0.0 68-69 0.0 0.0 0.025 0.0 0.0 70-71 0.0 0.0 0.025 0.0 0.0 72-73 0.0 0.0 0.025 0.0 0.0 74-75 0.0 0.0 0.025 0.0 0.0 76-77 0.0 0.0 0.025 0.0 0.0 78-79 0.025 0.0 0.025 0.0 0.0 80-81 0.05 0.0 0.025 0.0 0.0 82-83 0.05 0.0 0.025 0.0 0.0 84-85 0.05 0.0 0.025 0.0 0.0 86-87 0.075 0.0 0.025 0.0 0.0 88-89 0.075 0.0 0.025 0.0 0.0 90-91 0.1 0.0 0.025 0.0 0.0 92-93 0.175 0.0 0.025 0.0 0.0 94-95 0.225 0.0 0.025 0.0 0.0 96-97 0.3 0.0 0.025 0.0 0.0 98-99 0.3375 0.0 0.025 0.0 0.0 100-101 0.375 0.0 0.025 0.0 0.0 102-103 0.42500000000000004 0.0 0.025 0.0 0.0 104-105 0.5375 0.0 0.025 0.0 0.0 106-107 0.7125 0.0 0.025 0.0 0.0 108-109 0.825 0.0 0.025 0.0 0.0 110-111 0.9 0.0 0.025 0.0 0.0 112-113 0.9875 0.0 0.025 0.0 0.0 114-115 1.0499999999999998 0.0 0.025 0.0 0.0 116-117 1.225 0.0 0.025 0.0 0.0 118-119 1.3875 0.0 0.025 0.0 0.0 120-121 1.525 0.0 0.025 0.0 0.0 122-123 1.6 0.0 0.025 0.0 0.0 124-125 1.8375 0.0 0.025 0.0 0.0 126-127 2.0625 0.0 0.025 0.0 0.0 128-129 2.3875 0.0 0.025 0.0 0.0 130-131 2.6500000000000004 0.0 0.025 0.0 0.0 132-133 2.925 0.0 0.025 0.0 0.0 134-135 3.2249999999999996 0.0 0.025 0.0 0.0 136-137 3.75 0.0 0.025 0.0 0.0 138-139 4.0625 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACTAC 10 0.006830828 145.0 5 >>END_MODULE SRR6958343 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958343_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.19025 33.0 33.0 34.0 33.0 34.0 2 33.334 34.0 33.0 34.0 33.0 34.0 3 33.341 34.0 33.0 34.0 33.0 34.0 4 33.2875 34.0 33.0 34.0 33.0 34.0 5 33.3695 34.0 33.0 34.0 33.0 34.0 6 37.47925 38.0 38.0 38.0 38.0 38.0 7 37.55575 38.0 38.0 38.0 38.0 38.0 8 37.522 38.0 38.0 38.0 38.0 38.0 9 37.50175 38.0 38.0 38.0 38.0 38.0 10-14 36.82835000000001 38.0 37.8 38.0 34.8 38.0 15-19 37.4243 38.0 38.0 38.0 37.4 38.0 20-24 37.49515 38.0 38.0 38.0 38.0 38.0 25-29 37.531800000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.602850000000004 38.0 38.0 38.0 38.0 38.0 35-39 36.844350000000006 38.0 38.0 38.0 35.2 38.0 40-44 37.5116 38.0 38.0 38.0 37.8 38.0 45-49 37.3688 38.0 38.0 38.0 37.4 38.0 50-54 37.006600000000006 38.0 38.0 38.0 35.6 38.0 55-59 36.841899999999995 38.0 37.8 38.0 34.8 38.0 60-64 37.5077 38.0 38.0 38.0 38.0 38.0 65-69 37.3362 38.0 38.0 38.0 37.6 38.0 70-74 37.4363 38.0 38.0 38.0 37.4 38.0 75-79 37.246449999999996 38.0 38.0 38.0 36.8 38.0 80-84 37.39515 38.0 38.0 38.0 37.6 38.0 85-89 37.324149999999996 38.0 38.0 38.0 37.4 38.0 90-94 37.2616 38.0 38.0 38.0 37.0 38.0 95-99 37.27885 38.0 38.0 38.0 37.0 38.0 100-104 36.6075 38.0 37.8 38.0 33.8 38.0 105-109 36.14135 38.0 37.2 38.0 30.0 38.0 110-114 36.80055 38.0 38.0 38.0 35.0 38.0 115-119 37.01955 38.0 38.0 38.0 35.8 38.0 120-124 36.837599999999995 38.0 38.0 38.0 35.0 38.0 125-129 36.619749999999996 38.0 38.0 38.0 34.8 38.0 130-134 36.494600000000005 38.0 38.0 38.0 34.2 38.0 135-139 36.2637 38.0 38.0 38.0 34.0 38.0 140-144 35.599450000000004 38.0 36.6 38.0 32.2 38.0 145-149 35.20694999999999 38.0 36.6 38.0 31.0 38.0 150-151 30.944 35.5 30.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 1.0 16 0.0 17 2.0 18 2.0 19 1.0 20 2.0 21 0.0 22 1.0 23 2.0 24 6.0 25 9.0 26 9.0 27 16.0 28 17.0 29 15.0 30 34.0 31 25.0 32 44.0 33 68.0 34 114.0 35 207.0 36 514.0 37 2908.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.550000000000004 18.075 14.000000000000002 35.375 2 28.9 23.075000000000003 29.675 18.35 3 21.4 26.474999999999998 29.325000000000003 22.8 4 23.775 32.625 22.25 21.349999999999998 5 26.825 34.425 20.349999999999998 18.4 6 23.075000000000003 38.0 20.3 18.625 7 22.2 21.85 35.725 20.225 8 23.75 24.099999999999998 26.400000000000002 25.75 9 22.925 23.200000000000003 29.475 24.4 10-14 24.575 27.860000000000003 24.445 23.119999999999997 15-19 24.855 26.775 25.8 22.57 20-24 24.34 26.665 26.224999999999998 22.770000000000003 25-29 24.63 27.105 25.82 22.445 30-34 24.279999999999998 27.334999999999997 26.025 22.36 35-39 24.235 27.975 25.569999999999997 22.220000000000002 40-44 24.57 27.02 25.715 22.695 45-49 24.169999999999998 26.945000000000004 25.97 22.915 50-54 24.465 27.325 25.945 22.264999999999997 55-59 24.785 26.935 26.25 22.03 60-64 24.26 26.8 26.815 22.125 65-69 24.515 27.045 26.314999999999998 22.125 70-74 25.155 26.825 25.86 22.16 75-79 24.310000000000002 26.91 26.779999999999998 22.0 80-84 24.32 26.405 26.685 22.59 85-89 24.165 27.375 26.395000000000003 22.065 90-94 24.235 26.965 26.424999999999997 22.375 95-99 24.03 27.055 26.479999999999997 22.435 100-104 25.085 26.450000000000003 27.029999999999998 21.435000000000002 105-109 24.165 27.105 26.900000000000002 21.83 110-114 24.19 27.02 26.44 22.35 115-119 24.54 26.745 26.505000000000003 22.21 120-124 24.240000000000002 27.58 26.009999999999998 22.17 125-129 24.365000000000002 27.08 26.85 21.705 130-134 24.560000000000002 27.41 26.25 21.78 135-139 25.39 27.47 25.979999999999997 21.16 140-144 25.169999999999998 27.145000000000003 26.465 21.22 145-149 25.235000000000003 27.35 26.040000000000003 21.375 150-151 25.662499999999998 26.174999999999997 26.924999999999997 21.2375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 0.5 25 0.0 26 1.0 27 1.5 28 3.0 29 4.5 30 6.0 31 9.0 32 14.0 33 24.5 34 29.0 35 31.5 36 49.5 37 71.0 38 98.0 39 140.5 40 163.0 41 194.0 42 226.5 43 233.5 44 242.5 45 234.5 46 236.0 47 239.0 48 212.0 49 203.0 50 176.0 51 151.5 52 149.0 53 112.0 54 85.0 55 80.5 56 75.5 57 69.0 58 53.0 59 44.0 60 54.5 61 44.0 62 26.5 63 31.5 64 36.0 65 27.0 66 22.0 67 17.5 68 13.5 69 15.5 70 13.0 71 9.0 72 6.0 73 5.0 74 5.0 75 2.5 76 0.0 77 0.5 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42080080584236 98.7 2 0.45328632586250317 0.8999999999999999 3 0.1007302946361118 0.3 4 0.02518257365902795 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.5375 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.2000000000000002 0.0 0.0 0.0 0.0 118-119 1.3625 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.575 0.0 0.0 0.0 0.0 124-125 1.8125 0.0 0.0 0.0 0.0 126-127 2.0375 0.0 0.0 0.0 0.0 128-129 2.3625 0.0 0.0 0.0 0.0 130-131 2.625 0.0 0.0 0.0 0.0 132-133 2.9000000000000004 0.0 0.0 0.0 0.0 134-135 3.1875 0.0 0.0 0.0 0.0 136-137 3.7 0.0 0.0 0.0 0.0 138-139 3.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTGAA 10 0.006830828 145.0 5 AGTTTGA 10 0.006830828 145.0 4 >>END_MODULE Read 600867 spots for SRR6958343.sra Written 600867 spots for SRR6958343.sra Read 600867 spots for SRR6958343.sra Written 600867 spots for SRR6958343.sra Read 600867 spots for SRR6958343.sra Written 600867 spots for SRR6958343.sra Read 600867 spots for SRR6958343.sra Written 600867 spots for SRR6958343.sra Read 600867 spots for SRR6958343.sra Written 600867 spots for SRR6958343.sra Read 600867 spots for SRR6958343.sra Written 600867 spots for SRR6958343.sra Read 600867 spots for SRR6958343.sra Written 600867 spots for SRR6958343.sra Read 600867 spots for SRR6958343.sra Written 600867 spots for SRR6958343.sra Read 600867 spots for SRR6958343.sra Written 600867 spots for SRR6958343.sra Read 600867 spots for SRR6958343.sra Written 600867 spots for SRR6958343.sra Read 600867 spots for SRR6958343.sra Written 600867 spots for SRR6958343.sra Read 600867 spots for SRR6958343.sra Written 600867 spots for SRR6958343.sra Read 600867 spots for SRR6958343.sra Written 600867 spots for SRR6958343.sra Read 600867 spots for SRR6958343.sra Written 600867 spots for SRR6958343.sra Read 600883 spots for SRR6958343.sra Written 600883 spots for SRR6958343.sra Read 600867 spots for SRR6958343.sra Written 600867 spots for SRR6958343.sra Read 600867 spots for SRR6958343.sra Written 600867 spots for SRR6958343.sra Read 600867 spots for SRR6958343.sra Written 600867 spots for SRR6958343.sra Read 600867 spots for SRR6958343.sra Written 600867 spots for SRR6958343.sra Read 600867 spots for SRR6958343.sra Written 600867 spots for SRR6958343.sra SRR ids: ['SRR6958343.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_54ll1n76 SRR6958343.sra spots: 12017356 blocks: [[1, 600867], [600868, 1201734], [1201735, 1802601], [1802602, 2403468], [2403469, 3004335], [3004336, 3605202], [3605203, 4206069], [4206070, 4806936], [4806937, 5407803], [5407804, 6008670], [6008671, 6609537], [6609538, 7210404], [7210405, 7811271], [7811272, 8412138], [8412139, 9013005], [9013006, 9613872], [9613873, 10214739], [10214740, 10815606], [10815607, 11416473], [11416474, 12017356]] SRR6958343 file size 4050587 SRR6958343 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958343 SRR6958343_1.fastq SRR6958343_2.fastq Input file: SRR6958343_1.fastq Paired file: SRR6958343_2.fastq trimmed: SRR6958343-trimmed-pair1.fastq, SRR6958343-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:25:07 2024 >> started Fri Dec 6 20:25:19 2024 >> done (12.214s) 12017356 read pairs processed; of these: 5890 ( 0.05%) short read pairs filtered out after trimming by size control 3143 ( 0.03%) empty read pairs filtered out after trimming by size control 12008323 (99.92%) read pairs available; of these: 4098259 (34.13%) trimmed read pairs available after processing 7910064 (65.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 1 0.00% 21 2 0.00% 22 2 0.00% 23 4 0.00% 24 3 0.00% 25 0 0.00% 26 2 0.00% 27 0 0.00% 28 1 0.00% 29 4 0.00% 30 4 0.00% 31 4 0.00% 32 4 0.00% 33 7 0.00% 34 3 0.00% 35 3 0.00% 36 6 0.00% 37 4 0.00% 38 3 0.00% 39 6 0.00% 40 6 0.00% 41 11 0.00% 42 9 0.00% 43 14 0.00% 44 10 0.00% 45 9 0.00% 46 12 0.00% 47 6 0.00% 48 12 0.00% 49 20 0.00% 50 16 0.00% 51 28 0.00% 52 22 0.00% 53 19 0.00% 54 25 0.00% 55 22 0.00% 56 25 0.00% 57 25 0.00% 58 30 0.00% 59 45 0.00% 60 49 0.00% 61 48 0.00% 62 64 0.00% 63 69 0.00% 64 79 0.00% 65 68 0.00% 66 102 0.00% 67 97 0.00% 68 103 0.00% 69 117 0.00% 70 135 0.00% 71 163 0.00% 72 217 0.00% 73 186 0.00% 74 220 0.00% 75 259 0.00% 76 329 0.00% 77 400 0.00% 78 377 0.00% 79 435 0.00% 80 490 0.00% 81 517 0.00% 82 645 0.01% 83 682 0.01% 84 928 0.01% 85 1048 0.01% 86 1151 0.01% 87 1310 0.01% 88 1581 0.01% 89 1543 0.01% 90 1712 0.01% 91 1847 0.02% 92 2068 0.02% 93 2208 0.02% 94 2451 0.02% 95 2562 0.02% 96 2728 0.02% 97 3070 0.03% 98 3280 0.03% 99 3627 0.03% 100 3955 0.03% 101 4078 0.03% 102 4526 0.04% 103 4768 0.04% 104 5143 0.04% 105 5426 0.05% 106 6002 0.05% 107 6456 0.05% 108 6762 0.06% 109 7275 0.06% 110 7488 0.06% 111 7875 0.07% 112 8175 0.07% 113 8684 0.07% 114 9250 0.08% 115 10316 0.09% 116 10728 0.09% 117 11133 0.09% 118 11748 0.10% 119 11996 0.10% 120 12646 0.11% 121 13429 0.11% 122 14063 0.12% 123 14760 0.12% 124 15623 0.13% 125 16230 0.14% 126 16876 0.14% 127 17695 0.15% 128 18511 0.15% 129 19853 0.17% 130 20758 0.17% 131 21840 0.18% 132 22692 0.19% 133 24104 0.20% 134 25193 0.21% 135 26733 0.22% 136 28237 0.24% 137 29919 0.25% 138 31560 0.26% 139 34401 0.29% 140 36920 0.31% 141 39750 0.33% 142 44631 0.37% 143 48943 0.41% 144 55880 0.47% 145 66582 0.55% 146 83315 0.69% 147 113546 0.95% 148 174594 1.45% 149 366395 3.05% 150 2451398 20.41% 151 7910064 65.87% 12008323 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=24 prefix-density=0.46 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=48.21 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.6 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.39 fanout-score-rank=27 prefix-density=0.41 prefix-fanout=2.8 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=77.48 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=3.9 sequence=AGAAGGTGCAGTACGCCGTGCGCGGGGAGCTCTACCTCCGCGCCTCCGAGCTCCAGAAGGAGGGCAAGCGGATCATCTTCACCAACGTCGGCAACCCGCACGCCCTCGGCCAGAAGCCCCTCACCTTCCCCCGCCAGGTGGTGGCGCTGTGCCAGGCTCCGTTCCTGCTCGATGATCCCAACGTCGGCCTCATCTTCCCCGCCGATGCCATCGCCCGGGCCAAGCACTACCTCTCCATGGCGCCCGGTGGTTTAGGTGCCTACAGTGACTCCCGAGGTATCCCCGGAGTTAGGAAGGAAGTTGCCGAGTTCATTCAGAGGCGTGACGGGTATCCGAGTGATCCGGAGCTTATTTACCTGACTGATGGTGCCAGCAAAGGTGTGATGCAAATGCTCAACGCCATTATCAGAAACGAGAGAGACGGGATTTTGGTCCCTGTTCCACAATACCCGCTTTATTCTGCAGCCATTTCTCTCTTTGGTGGCTCGCTTGTCCCATATTACTTAGAAGA SRR6958343 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:26:03 Started mapping on | Dec 06 20:26:03 Finished on | Dec 06 20:27:11 Mapping speed, Million of reads per hour | 635.73 Number of input reads | 12008323 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 11610510 Uniquely mapped reads % | 96.69% Average mapped length | 297.72 Number of splices: Total | 13926604 Number of splices: Annotated (sjdb) | 13152287 Number of splices: GT/AG | 13742371 Number of splices: GC/AG | 163299 Number of splices: AT/AC | 5785 Number of splices: Non-canonical | 15149 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.22 Insertion rate per base | 0.01% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 152647 % of reads mapped to multiple loci | 1.27% Number of reads mapped to too many loci | 17536 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.85% % of reads unmapped: other | 1.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 247371 247371 247371 N_multimapping 152647 152647 152647 N_noFeature 439718 11305953 532501 N_ambiguous 254668 1419 43529 UnstrandedReadsAssigned:10916124 PositiveStrandReadsAssigned:303138 NegativeStrandReadsAssigned:11034480 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958343 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958343-trimmed-pair1.fastq SRR6958343-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,008,323 reads, 11,057,885 reads pseudoaligned [quant] estimated average fragment length: 237.911 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52973 SRR6958343.ke.tsv 35125 SRR6958343.se.tsv 88098 total ==> SRR6958343.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 699.466 0 0 PNS24247 1044 807.089 34.3524 6.12677 PNS24249 1928 1691.09 27.4361 2.33535 PNS24246 1044 807.089 34.3524 6.12677 PNS24248 1044 807.089 34.3524 6.12677 PNS24244 1471 1234.09 21.5069 2.50857 PNS24243 293 83.642 0 0 KQK14069 1603 1366.09 3522.01 371.114 KQK14071 474 240.743 54.3576 32.5015 ==> SRR6958343.se.tsv <== BRADI_1g14170v3 3998 BRADI_1g53295v3 124 BRADI_1g59795v3 181 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 159 BRADI_1g74790v3 38 BRADI_1g09890v3 0 BRADI_1g77505v3 160 BRADI_1g48960v3 0 SRR6958343 completed mapping pipeline successfully