Starting /dee2/code/volunteer_pipeline.sh SRR6958344 current disk space = 1549530443776 free memory = 1598283512 SRR6958344 SRAfilesize aa70afcbcf6ad73175407acbfc16af71 SRR6958344.sra SRR6958344.sra file validated SRR6958344 is paired end SRR6958344 is conventional basespace SRR6958344 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958344_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.15025 30.0 18.0 32.0 18.0 33.0 2 30.7895 31.0 29.0 33.0 27.0 33.0 3 31.9465 33.0 31.0 33.0 29.0 34.0 4 32.77275 33.0 33.0 34.0 32.0 34.0 5 33.0415 34.0 33.0 34.0 32.0 34.0 6 37.03025 38.0 38.0 38.0 36.0 38.0 7 37.27675 38.0 38.0 38.0 37.0 38.0 8 37.276 38.0 38.0 38.0 37.0 38.0 9 37.327 38.0 38.0 38.0 37.0 38.0 10-14 36.071650000000005 38.0 35.8 38.0 31.2 38.0 15-19 37.4107 38.0 38.0 38.0 37.4 38.0 20-24 37.510149999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.43415 38.0 38.0 38.0 37.8 38.0 30-34 37.162699999999994 38.0 38.0 38.0 36.6 38.0 35-39 37.25005 38.0 38.0 38.0 37.0 38.0 40-44 37.1618 38.0 38.0 38.0 36.6 38.0 45-49 36.663650000000004 38.0 37.4 38.0 34.0 38.0 50-54 37.21325 38.0 38.0 38.0 36.6 38.0 55-59 37.1748 38.0 38.0 38.0 36.8 38.0 60-64 37.1465 38.0 38.0 38.0 36.4 38.0 65-69 37.12665 38.0 38.0 38.0 36.2 38.0 70-74 37.13695 38.0 38.0 38.0 36.4 38.0 75-79 37.115899999999996 38.0 38.0 38.0 36.2 38.0 80-84 37.0801 38.0 38.0 38.0 36.0 38.0 85-89 35.91935 38.0 36.4 38.0 30.0 38.0 90-94 34.90255 37.8 34.6 38.0 25.6 38.0 95-99 36.62205 38.0 37.8 38.0 34.8 38.0 100-104 36.7493 38.0 38.0 38.0 35.0 38.0 105-109 36.66355 38.0 38.0 38.0 34.6 38.0 110-114 36.607299999999995 38.0 38.0 38.0 34.4 38.0 115-119 36.3634 38.0 38.0 38.0 33.8 38.0 120-124 36.1424 38.0 37.8 38.0 33.4 38.0 125-129 36.02695 38.0 37.6 38.0 33.0 38.0 130-134 36.04045 38.0 37.6 38.0 33.0 38.0 135-139 35.80995 38.0 36.6 38.0 32.6 38.0 140-144 35.334799999999994 38.0 36.0 38.0 31.0 38.0 145-149 33.51975 38.0 32.4 38.0 23.8 38.0 150-151 30.607374999999998 35.5 29.0 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 4.0 17 1.0 18 0.0 19 3.0 20 0.0 21 3.0 22 4.0 23 2.0 24 9.0 25 9.0 26 19.0 27 25.0 28 18.0 29 43.0 30 40.0 31 44.0 32 68.0 33 98.0 34 150.0 35 294.0 36 841.0 37 2319.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.443149443149444 10.17871017871018 6.656306656306657 33.72183372183372 2 25.05 12.8 33.375 28.775000000000002 3 20.775 18.675 26.424999999999997 34.125 4 26.156539134783696 25.081270317579396 23.005751437859466 25.756439109777446 5 25.624999999999996 29.125 22.825 22.425 6 21.25 31.75 24.85 22.15 7 16.400000000000002 22.85 41.675000000000004 19.075 8 18.7 23.025000000000002 30.099999999999998 28.175 9 20.549999999999997 21.45 32.175 25.825 10-14 23.49 25.790000000000003 25.855 24.865000000000002 15-19 23.095 25.16 26.26 25.485000000000003 20-24 22.865 25.8 26.14 25.195 25-29 22.994999999999997 25.72 26.245 25.040000000000003 30-34 22.86 25.485000000000003 26.325 25.330000000000002 35-39 22.81 25.624999999999996 25.765 25.8 40-44 23.35 25.46 25.480000000000004 25.71 45-49 23.02 25.72 25.335 25.924999999999997 50-54 22.91 25.16 25.845000000000002 26.085 55-59 23.549999999999997 25.540000000000003 25.82 25.09 60-64 23.3 25.435000000000002 25.535000000000004 25.729999999999997 65-69 23.400000000000002 25.46 25.795 25.345000000000002 70-74 23.345 25.805 25.264999999999997 25.585 75-79 23.43 25.045 25.435000000000002 26.090000000000003 80-84 23.205000000000002 24.615000000000002 26.1 26.08 85-89 23.615 24.785 25.905 25.695 90-94 23.405 25.064999999999998 25.865 25.665 95-99 22.96 25.445 25.995 25.6 100-104 23.69 25.374999999999996 25.319999999999997 25.615 105-109 23.51 24.69 26.279999999999998 25.52 110-114 23.515 25.11 25.615 25.759999999999998 115-119 24.21 25.06 25.569999999999997 25.16 120-124 24.22 25.485000000000003 25.085 25.21 125-129 23.93 25.264999999999997 25.074999999999996 25.729999999999997 130-134 23.549999999999997 25.490000000000002 25.055 25.905 135-139 24.215 25.415 25.11 25.259999999999998 140-144 23.78 25.840000000000003 24.905 25.474999999999998 145-149 23.755000000000003 25.255 25.130000000000003 25.86 150-151 24.275 24.9875 25.7375 25.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.5 26 1.0 27 2.0 28 4.5 29 5.0 30 6.0 31 10.5 32 15.0 33 23.0 34 34.5 35 42.0 36 56.5 37 71.5 38 77.5 39 92.5 40 116.5 41 142.5 42 173.0 43 190.0 44 209.5 45 221.0 46 205.0 47 198.0 48 195.0 49 180.0 50 164.0 51 152.0 52 138.0 53 117.5 54 102.5 55 94.5 56 83.5 57 86.0 58 88.0 59 72.5 60 66.5 61 62.0 62 53.0 63 55.5 64 60.0 65 55.5 66 53.0 67 51.5 68 38.0 69 29.5 70 27.5 71 19.5 72 15.5 73 13.5 74 7.5 75 4.5 76 3.5 77 3.0 78 2.5 79 2.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4750000000000005 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.42767295597484273 0.8500000000000001 3 0.10062893081761005 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.8375 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.7625000000000002 0.0 0.0 0.0 0.0 116-117 1.9875 0.0 0.0 0.0 0.0 118-119 2.3875 0.0 0.0 0.0 0.0 120-121 2.8375000000000004 0.0 0.0 0.0 0.0 122-123 3.175 0.0 0.0 0.0 0.0 124-125 3.4375 0.0 0.0 0.0 0.0 126-127 3.825 0.0 0.0 0.0 0.0 128-129 4.325 0.0 0.0 0.0 0.0 130-131 4.85 0.0 0.0 0.0 0.0 132-133 5.300000000000001 0.0 0.0 0.0 0.0 134-135 5.7875 0.0 0.0 0.0 0.0 136-137 6.075 0.0 0.0 0.0 0.0 138-139 6.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCGCCT 10 0.0060887975 150.61038 1 AGAATCA 10 0.006836113 144.9625 3 GGCCTCC 10 0.006836113 144.9625 3 CAGAATC 10 0.006836113 144.9625 2 >>END_MODULE SRR6958344 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958344_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5535 33.0 33.0 34.0 32.0 34.0 2 32.8645 33.0 33.0 34.0 32.0 34.0 3 32.9475 34.0 33.0 34.0 32.0 34.0 4 32.45975 34.0 33.0 34.0 32.0 34.0 5 32.9125 34.0 33.0 34.0 32.0 34.0 6 37.13275 38.0 38.0 38.0 37.0 38.0 7 37.15225 38.0 38.0 38.0 37.0 38.0 8 37.10375 38.0 38.0 38.0 37.0 38.0 9 37.06525 38.0 38.0 38.0 37.0 38.0 10-14 36.781000000000006 38.0 38.0 38.0 35.4 38.0 15-19 36.99495 38.0 38.0 38.0 36.4 38.0 20-24 37.1194 38.0 38.0 38.0 37.0 38.0 25-29 37.031549999999996 38.0 38.0 38.0 36.8 38.0 30-34 37.0409 38.0 38.0 38.0 37.0 38.0 35-39 36.6914 38.0 38.0 38.0 35.4 38.0 40-44 36.3572 38.0 37.8 38.0 33.8 38.0 45-49 36.72239999999999 38.0 38.0 38.0 35.8 38.0 50-54 36.611599999999996 38.0 38.0 38.0 35.2 38.0 55-59 36.40025000000001 38.0 38.0 38.0 33.8 38.0 60-64 36.533950000000004 38.0 38.0 38.0 34.8 38.0 65-69 36.4434 38.0 38.0 38.0 33.8 38.0 70-74 36.266999999999996 38.0 37.8 38.0 33.4 38.0 75-79 36.707649999999994 38.0 38.0 38.0 35.6 38.0 80-84 36.6875 38.0 38.0 38.0 35.6 38.0 85-89 36.5496 38.0 38.0 38.0 34.6 38.0 90-94 34.4696 37.8 34.4 38.0 26.0 38.0 95-99 36.196299999999994 38.0 37.6 38.0 33.0 38.0 100-104 36.431799999999996 38.0 38.0 38.0 34.2 38.0 105-109 35.570499999999996 38.0 36.8 38.0 29.0 38.0 110-114 36.17685 38.0 38.0 38.0 34.0 38.0 115-119 36.11695 38.0 38.0 38.0 34.0 38.0 120-124 35.80645 38.0 37.4 38.0 32.6 38.0 125-129 35.50855 38.0 37.0 38.0 30.6 38.0 130-134 35.317600000000006 38.0 36.2 38.0 31.0 38.0 135-139 35.136700000000005 38.0 36.0 38.0 31.0 38.0 140-144 34.587450000000004 38.0 36.0 38.0 27.8 38.0 145-149 32.56455000000001 37.6 33.0 38.0 15.2 38.0 150-151 27.516 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 9.0 4 1.0 5 3.0 6 0.0 7 3.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 3.0 14 0.0 15 2.0 16 1.0 17 3.0 18 4.0 19 1.0 20 1.0 21 7.0 22 10.0 23 10.0 24 10.0 25 14.0 26 30.0 27 16.0 28 25.0 29 41.0 30 54.0 31 66.0 32 76.0 33 116.0 34 163.0 35 273.0 36 684.0 37 2356.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.6 21.4 8.375 26.625 2 30.349999999999998 22.900000000000002 27.525 19.225 3 22.625 24.85 28.349999999999998 24.175 4 23.95 32.875 21.55 21.625 5 26.900000000000002 34.599999999999994 19.275000000000002 19.225 6 23.549999999999997 36.475 20.599999999999998 19.375 7 21.525 19.75 35.15 23.575 8 22.45 23.75 24.3 29.5 9 22.525000000000002 23.825 27.575 26.075 10-14 25.645 26.035000000000004 23.630000000000003 24.69 15-19 25.72 26.009999999999998 24.095 24.175 20-24 25.655 25.840000000000003 24.560000000000002 23.945 25-29 26.290000000000003 25.319999999999997 24.125 24.265 30-34 25.380000000000003 26.424999999999997 24.39 23.805 35-39 24.92 25.990000000000002 24.89 24.2 40-44 25.855 25.335 24.8 24.01 45-49 25.509999999999998 25.629999999999995 24.740000000000002 24.12 50-54 25.885 25.074999999999996 24.959999999999997 24.08 55-59 26.090000000000003 25.4 24.325 24.185000000000002 60-64 26.119999999999997 24.8 24.645 24.435000000000002 65-69 25.71 25.795 24.7 23.794999999999998 70-74 26.284999999999997 25.185000000000002 24.195 24.335 75-79 25.34 25.650000000000002 24.695 24.315 80-84 25.290000000000003 25.69 24.97 24.05 85-89 26.19 25.080000000000002 24.85 23.880000000000003 90-94 25.97 25.259999999999998 24.725 24.044999999999998 95-99 25.15 25.705 24.759999999999998 24.385 100-104 25.965 25.85 23.98 24.205 105-109 25.6 25.490000000000002 24.325 24.585 110-114 25.490000000000002 25.94 25.014999999999997 23.555 115-119 26.545 25.64 24.465 23.35 120-124 26.095000000000002 26.32 23.825 23.76 125-129 26.41 25.840000000000003 24.54 23.21 130-134 26.91 25.319999999999997 24.610000000000003 23.16 135-139 26.400000000000002 25.619999999999997 24.69 23.29 140-144 26.939999999999998 25.555 24.834999999999997 22.67 145-149 26.924999999999997 26.645000000000003 23.865 22.564999999999998 150-151 26.200000000000003 27.525 24.05 22.225 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 0.5 26 1.5 27 2.5 28 4.5 29 6.0 30 7.5 31 15.0 32 17.5 33 22.0 34 31.0 35 30.5 36 41.5 37 59.5 38 68.5 39 88.5 40 128.0 41 143.5 42 154.0 43 171.0 44 173.5 45 190.0 46 199.5 47 187.5 48 179.0 49 177.0 50 163.5 51 154.0 52 132.5 53 101.5 54 101.5 55 105.0 56 93.5 57 94.5 58 104.5 59 94.0 60 81.5 61 78.0 62 73.5 63 72.5 64 74.0 65 63.0 66 51.5 67 54.0 68 44.5 69 31.5 70 29.5 71 26.0 72 20.5 73 16.0 74 13.5 75 10.5 76 5.0 77 1.5 78 1.5 79 1.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1672975018925 98.25 2 0.7317688619732526 1.4500000000000002 3 0.10093363613424174 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.575 0.0 0.0 0.0 0.0 114-115 1.7625000000000002 0.0 0.0 0.0 0.0 116-117 1.9875 0.0 0.0 0.0 0.0 118-119 2.3875 0.0 0.0 0.0 0.0 120-121 2.8125 0.0 0.0 0.0 0.0 122-123 3.15 0.0 0.0 0.0 0.0 124-125 3.425 0.0 0.0 0.0 0.0 126-127 3.8375000000000004 0.0 0.0 0.0 0.0 128-129 4.35 0.0 0.0 0.0 0.0 130-131 4.9 0.0 0.0 0.0 0.0 132-133 5.3875 0.0 0.0 0.0 0.0 134-135 5.887499999999999 0.0 0.0 0.0 0.0 136-137 6.175 0.0 0.0 0.0 0.0 138-139 6.574999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1098403 spots for SRR6958344.sra Written 1098403 spots for SRR6958344.sra Read 1098403 spots for SRR6958344.sra Written 1098403 spots for SRR6958344.sra Read 1098403 spots for SRR6958344.sra Written 1098403 spots for SRR6958344.sra Read 1098403 spots for SRR6958344.sra Written 1098403 spots for SRR6958344.sra Read 1098403 spots for SRR6958344.sra Written 1098403 spots for SRR6958344.sra Read 1098403 spots for SRR6958344.sra Written 1098403 spots for SRR6958344.sra Read 1098403 spots for SRR6958344.sra Written 1098403 spots for SRR6958344.sra Read 1098403 spots for SRR6958344.sra Written 1098403 spots for SRR6958344.sra Read 1098409 spots for SRR6958344.sra Written 1098409 spots for SRR6958344.sra Read 1098403 spots for SRR6958344.sra Written 1098403 spots for SRR6958344.sra Read 1098403 spots for SRR6958344.sra Written 1098403 spots for SRR6958344.sra Read 1098403 spots for SRR6958344.sra Written 1098403 spots for SRR6958344.sra Read 1098403 spots for SRR6958344.sra Written 1098403 spots for SRR6958344.sra Read 1098403 spots for SRR6958344.sra Written 1098403 spots for SRR6958344.sra Read 1098403 spots for SRR6958344.sra Written 1098403 spots for SRR6958344.sra Read 1098403 spots for SRR6958344.sra Written 1098403 spots for SRR6958344.sra Read 1098403 spots for SRR6958344.sra Written 1098403 spots for SRR6958344.sra Read 1098403 spots for SRR6958344.sra Written 1098403 spots for SRR6958344.sra Read 1098403 spots for SRR6958344.sra Written 1098403 spots for SRR6958344.sra Read 1098403 spots for SRR6958344.sra Written 1098403 spots for SRR6958344.sra SRR ids: ['SRR6958344.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o5kt0hvd SRR6958344.sra spots: 21968066 blocks: [[1, 1098403], [1098404, 2196806], [2196807, 3295209], [3295210, 4393612], [4393613, 5492015], [5492016, 6590418], [6590419, 7688821], [7688822, 8787224], [8787225, 9885627], [9885628, 10984030], [10984031, 12082433], [12082434, 13180836], [13180837, 14279239], [14279240, 15377642], [15377643, 16476045], [16476046, 17574448], [17574449, 18672851], [18672852, 19771254], [19771255, 20869657], [20869658, 21968066]] SRR6958344 file size 7422556 SRR6958344 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958344 SRR6958344_1.fastq SRR6958344_2.fastq Input file: SRR6958344_1.fastq Paired file: SRR6958344_2.fastq trimmed: SRR6958344-trimmed-pair1.fastq, SRR6958344-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:29:29 2024 >> started Fri Dec 6 20:29:57 2024 >> done (28.012s) 21968066 read pairs processed; of these: 34022 ( 0.15%) short read pairs filtered out after trimming by size control 34261 ( 0.16%) empty read pairs filtered out after trimming by size control 21899783 (99.69%) read pairs available; of these: 8194809 (37.42%) trimmed read pairs available after processing 13704974 (62.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 14 0.00% 20 8 0.00% 21 11 0.00% 22 12 0.00% 23 19 0.00% 24 12 0.00% 25 27 0.00% 26 20 0.00% 27 15 0.00% 28 31 0.00% 29 23 0.00% 30 23 0.00% 31 24 0.00% 32 14 0.00% 33 19 0.00% 34 22 0.00% 35 28 0.00% 36 21 0.00% 37 25 0.00% 38 35 0.00% 39 29 0.00% 40 30 0.00% 41 40 0.00% 42 26 0.00% 43 44 0.00% 44 46 0.00% 45 42 0.00% 46 36 0.00% 47 58 0.00% 48 74 0.00% 49 77 0.00% 50 75 0.00% 51 96 0.00% 52 104 0.00% 53 151 0.00% 54 135 0.00% 55 130 0.00% 56 157 0.00% 57 185 0.00% 58 206 0.00% 59 261 0.00% 60 278 0.00% 61 256 0.00% 62 348 0.00% 63 382 0.00% 64 422 0.00% 65 445 0.00% 66 493 0.00% 67 576 0.00% 68 667 0.00% 69 684 0.00% 70 841 0.00% 71 983 0.00% 72 1101 0.01% 73 1156 0.01% 74 1263 0.01% 75 1414 0.01% 76 1684 0.01% 77 1906 0.01% 78 1968 0.01% 79 2308 0.01% 80 2606 0.01% 81 3011 0.01% 82 3455 0.02% 83 3806 0.02% 84 5646 0.03% 85 6722 0.03% 86 7131 0.03% 87 7603 0.03% 88 8038 0.04% 89 8562 0.04% 90 8985 0.04% 91 9493 0.04% 92 10323 0.05% 93 10816 0.05% 94 11716 0.05% 95 12307 0.06% 96 13132 0.06% 97 13659 0.06% 98 14420 0.07% 99 15363 0.07% 100 16555 0.08% 101 17507 0.08% 102 19044 0.09% 103 19922 0.09% 104 21291 0.10% 105 21790 0.10% 106 23336 0.11% 107 23974 0.11% 108 25293 0.12% 109 26005 0.12% 110 27276 0.12% 111 29058 0.13% 112 30325 0.14% 113 31866 0.15% 114 33351 0.15% 115 35039 0.16% 116 35923 0.16% 117 36974 0.17% 118 38405 0.18% 119 39367 0.18% 120 40821 0.19% 121 41917 0.19% 122 43675 0.20% 123 46115 0.21% 124 47782 0.22% 125 49331 0.23% 126 51187 0.23% 127 52712 0.24% 128 53381 0.24% 129 55288 0.25% 130 56762 0.26% 131 58799 0.27% 132 61589 0.28% 133 64225 0.29% 134 66490 0.30% 135 69882 0.32% 136 71899 0.33% 137 74338 0.34% 138 77397 0.35% 139 81804 0.37% 140 86032 0.39% 141 92111 0.42% 142 99604 0.45% 143 108807 0.50% 144 122808 0.56% 145 143112 0.65% 146 171235 0.78% 147 223365 1.02% 148 323629 1.48% 149 622844 2.84% 150 4285181 19.57% 151 13704974 62.58% 21899783 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=3.17 fanout-score-rank=22 prefix-density=0.61 prefix-fanout=2.9 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=54.09 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.6 sequence=GCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=3.19 fanout-score-rank=23 prefix-density=0.46 prefix-fanout=2.7 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=209.27 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=8.1 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958344 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:30:40 Started mapping on | Dec 06 20:30:40 Finished on | Dec 06 20:32:47 Mapping speed, Million of reads per hour | 620.78 Number of input reads | 21899783 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 21112605 Uniquely mapped reads % | 96.41% Average mapped length | 294.71 Number of splices: Total | 23950620 Number of splices: Annotated (sjdb) | 22479715 Number of splices: GT/AG | 23604611 Number of splices: GC/AG | 285054 Number of splices: AT/AC | 9647 Number of splices: Non-canonical | 51308 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 269628 % of reads mapped to multiple loci | 1.23% Number of reads mapped to too many loci | 13023 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.01% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 542703 542703 542703 N_multimapping 269628 269628 269628 N_noFeature 826109 20487462 1013373 N_ambiguous 519303 2854 82207 UnstrandedReadsAssigned:19767193 PositiveStrandReadsAssigned:622289 NegativeStrandReadsAssigned:20017025 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958344 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958344-trimmed-pair1.fastq SRR6958344-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,899,783 reads, 20,021,236 reads pseudoaligned [quant] estimated average fragment length: 265.579 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52973 SRR6958344.ke.tsv 35125 SRR6958344.se.tsv 88098 total ==> SRR6958344.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 672.18 0 0 PNS24247 1044 779.421 61.7647 5.87692 PNS24249 1928 1663.42 56.6013 2.52352 PNS24246 1044 779.421 61.7647 5.87692 PNS24248 1044 779.421 61.7647 5.87692 PNS24244 1471 1206.42 55.1047 3.38744 PNS24243 293 92.3869 0 0 KQK14069 1603 1338.42 4816.37 266.876 KQK14071 474 231.087 95.3071 30.5866 ==> SRR6958344.se.tsv <== BRADI_1g14170v3 5646 BRADI_1g53295v3 1439 BRADI_1g59795v3 168 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 373 BRADI_1g74790v3 89 BRADI_1g09890v3 2 BRADI_1g77505v3 299 BRADI_1g48960v3 0 SRR6958344 completed mapping pipeline successfully