Starting /dee2/code/volunteer_pipeline.sh SRR6958345 current disk space = 1549512372224 free memory = 1603576696 SRR6958345 SRAfilesize 5b9807a3c5b137f31a4bc4b1a0cd99a3 SRR6958345.sra SRR6958345.sra file validated SRR6958345 is paired end SRR6958345 is conventional basespace SRR6958345 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958345_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.59175 27.0 18.0 33.0 18.0 33.0 2 23.86125 25.0 18.0 29.0 18.0 31.0 3 30.27875 31.0 28.0 33.0 27.0 33.0 4 31.0675 33.0 31.0 33.0 29.0 33.0 5 31.75575 33.0 31.0 33.0 29.0 33.0 6 36.00625 37.0 36.0 38.0 33.0 38.0 7 36.93625 38.0 37.0 38.0 35.0 38.0 8 37.267 38.0 38.0 38.0 36.0 38.0 9 37.188 38.0 38.0 38.0 36.0 38.0 10-14 37.02755 38.0 38.0 38.0 35.6 38.0 15-19 37.4721 38.0 38.0 38.0 37.2 38.0 20-24 37.4242 38.0 38.0 38.0 37.0 38.0 25-29 37.5139 38.0 38.0 38.0 37.4 38.0 30-34 37.4617 38.0 38.0 38.0 37.4 38.0 35-39 37.535199999999996 38.0 38.0 38.0 37.6 38.0 40-44 37.52575 38.0 38.0 38.0 37.4 38.0 45-49 37.442150000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.2606 38.0 38.0 38.0 36.6 38.0 55-59 36.918099999999995 38.0 37.8 38.0 35.0 38.0 60-64 37.2208 38.0 38.0 38.0 36.0 38.0 65-69 37.17155 38.0 38.0 38.0 36.2 38.0 70-74 37.082100000000004 38.0 38.0 38.0 35.8 38.0 75-79 37.042100000000005 38.0 38.0 38.0 35.6 38.0 80-84 36.94500000000001 38.0 38.0 38.0 35.4 38.0 85-89 36.9271 38.0 38.0 38.0 35.0 38.0 90-94 36.686449999999994 38.0 38.0 38.0 34.2 38.0 95-99 36.6747 38.0 38.0 38.0 34.0 38.0 100-104 36.35815 38.0 37.4 38.0 34.0 38.0 105-109 36.15405 38.0 37.0 38.0 33.2 38.0 110-114 35.87505000000001 38.0 36.8 38.0 32.0 38.0 115-119 35.6287 38.0 36.2 38.0 31.0 38.0 120-124 35.640249999999995 38.0 36.2 38.0 31.0 38.0 125-129 35.15575 38.0 35.6 38.0 29.4 38.0 130-134 34.9626 38.0 34.8 38.0 28.2 38.0 135-139 34.82475 38.0 34.4 38.0 28.6 38.0 140-144 34.244150000000005 38.0 33.4 38.0 26.4 38.0 145-149 32.83240000000001 38.0 33.2 38.0 17.8 38.0 150-151 26.747875 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 0.0 15 0.0 16 1.0 17 0.0 18 1.0 19 1.0 20 1.0 21 2.0 22 2.0 23 3.0 24 3.0 25 10.0 26 7.0 27 19.0 28 28.0 29 35.0 30 40.0 31 75.0 32 101.0 33 148.0 34 234.0 35 398.0 36 1072.0 37 1817.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.24226533822758 12.165705296276874 9.07184058730991 44.520188778185634 2 20.4 13.750000000000002 34.949999999999996 30.9 3 18.7 16.6 25.0 39.7 4 22.825 23.575 21.425 32.175 5 23.925 29.049999999999997 24.65 22.375 6 23.3 32.125 23.599999999999998 20.974999999999998 7 17.175 26.35 37.875 18.6 8 19.35 24.725 30.95 24.975 9 17.75 22.975 33.85 25.424999999999997 10-14 21.64 27.685 26.325 24.349999999999998 15-19 21.72 26.1 26.939999999999998 25.240000000000002 20-24 22.748412261839277 26.018902835425312 26.744011601740258 24.48867330099515 25-29 21.69 26.450000000000003 26.974999999999998 24.884999999999998 30-34 21.895 27.08 26.465 24.560000000000002 35-39 22.27 26.325 26.400000000000002 25.005 40-44 22.16 26.52 26.61 24.709999999999997 45-49 22.58 26.365 26.41 24.645 50-54 22.17 26.08 26.545 25.205 55-59 22.220000000000002 26.32 26.729999999999997 24.73 60-64 21.54 26.035000000000004 26.834999999999997 25.590000000000003 65-69 22.06 25.95 26.915 25.074999999999996 70-74 22.564999999999998 25.71 26.265 25.46 75-79 22.575 26.279999999999998 26.505000000000003 24.64 80-84 22.355 25.979999999999997 26.615 25.05 85-89 22.165000000000003 25.895000000000003 26.44 25.5 90-94 22.465 25.665 26.924999999999997 24.945 95-99 22.439999999999998 26.240000000000002 26.415 24.905 100-104 22.25278847596659 25.388886110138547 27.094483069074176 25.263842344820688 105-109 22.485 26.305 26.665 24.545 110-114 22.657580919931856 26.074756989678328 26.41547249223369 24.852189598156126 115-119 22.27784730913642 25.847309136420527 27.013767209011263 24.86107634543179 120-124 22.77752764020211 25.58407123918155 26.13937665716144 25.4990244634549 125-129 22.355889724310778 25.894736842105264 26.360902255639097 25.38847117794486 130-134 22.2972972972973 25.775775775775777 26.546546546546544 25.38038038038038 135-139 22.6 25.46 26.900000000000002 25.040000000000003 140-144 23.145 25.905 25.650000000000002 25.3 145-149 22.945 26.169999999999998 25.790000000000003 25.095 150-151 22.6125 25.624999999999996 25.937500000000004 25.825 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 2.5 28 3.5 29 4.5 30 6.5 31 6.0 32 9.5 33 17.5 34 24.5 35 36.0 36 58.0 37 78.0 38 86.0 39 111.5 40 143.5 41 177.5 42 205.5 43 228.5 44 248.5 45 247.0 46 241.5 47 227.0 48 211.0 49 200.0 50 173.0 51 142.5 52 128.5 53 122.0 54 114.0 55 97.5 56 89.0 57 79.0 58 66.5 59 61.0 60 52.5 61 47.5 62 46.5 63 36.5 64 31.0 65 25.5 66 21.5 67 22.5 68 18.5 69 17.5 70 10.5 71 6.5 72 6.0 73 4.5 74 3.0 75 1.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.015 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.034999999999999996 105-109 0.0 110-114 0.21 115-119 0.125 120-124 0.055 125-129 0.25 130-134 0.1 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.48750000000000004 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.8999999999999999 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.2 0.0 0.0 0.0 0.0 118-119 1.35 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.65 0.0 0.0 0.0 0.0 124-125 1.8625 0.0 0.0 0.0 0.0 126-127 2.0250000000000004 0.0 0.0 0.0 0.0 128-129 2.2874999999999996 0.0 0.0 0.0 0.0 130-131 2.6 0.0 0.0 0.0 0.0 132-133 2.9125 0.0 0.0 0.0 0.0 134-135 3.2125 0.0 0.0 0.0 0.0 136-137 3.6 0.0 0.0 0.0 0.0 138-139 3.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958345 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958345_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.14175 33.0 32.0 34.0 27.0 34.0 2 30.94225 33.0 32.0 34.0 18.0 34.0 3 32.29825 33.0 32.0 34.0 28.0 34.0 4 30.68925 33.0 32.0 34.0 15.0 34.0 5 32.33725 33.0 32.0 34.0 28.0 34.0 6 36.8495 38.0 38.0 38.0 35.0 38.0 7 37.254 38.0 38.0 38.0 37.0 38.0 8 37.352 38.0 38.0 38.0 37.0 38.0 9 37.391 38.0 38.0 38.0 38.0 38.0 10-14 37.447900000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.40685 38.0 38.0 38.0 37.8 38.0 20-24 37.42055 38.0 38.0 38.0 38.0 38.0 25-29 37.4305 38.0 38.0 38.0 38.0 38.0 30-34 37.45075 38.0 38.0 38.0 38.0 38.0 35-39 37.3215 38.0 38.0 38.0 37.2 38.0 40-44 37.34425 38.0 38.0 38.0 37.8 38.0 45-49 36.646550000000005 38.0 37.6 38.0 34.4 38.0 50-54 36.15015 38.0 36.0 38.0 31.2 38.0 55-59 37.217299999999994 38.0 38.0 38.0 36.8 38.0 60-64 37.33645 38.0 38.0 38.0 37.6 38.0 65-69 37.235699999999994 38.0 38.0 38.0 37.0 38.0 70-74 36.79085 38.0 38.0 38.0 35.4 38.0 75-79 36.99175 38.0 38.0 38.0 36.4 38.0 80-84 36.454899999999995 38.0 38.0 38.0 34.0 38.0 85-89 37.03035 38.0 38.0 38.0 36.0 38.0 90-94 36.98425 38.0 38.0 38.0 36.0 38.0 95-99 36.88235 38.0 38.0 38.0 35.4 38.0 100-104 36.74679999999999 38.0 38.0 38.0 35.0 38.0 105-109 36.5083 38.0 38.0 38.0 34.4 38.0 110-114 36.520599999999995 38.0 38.0 38.0 34.6 38.0 115-119 36.60425 38.0 38.0 38.0 34.4 38.0 120-124 36.36305 38.0 38.0 38.0 33.6 38.0 125-129 36.01155 38.0 37.8 38.0 32.6 38.0 130-134 35.740700000000004 38.0 37.2 38.0 31.6 38.0 135-139 34.61355 38.0 35.6 38.0 26.0 38.0 140-144 33.564949999999996 38.0 33.0 38.0 21.0 38.0 145-149 32.9071 38.0 33.0 38.0 15.8 38.0 150-151 27.9595 34.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 1.0 10 2.0 11 0.0 12 0.0 13 2.0 14 1.0 15 0.0 16 0.0 17 3.0 18 3.0 19 1.0 20 3.0 21 4.0 22 7.0 23 7.0 24 7.0 25 12.0 26 15.0 27 12.0 28 28.0 29 26.0 30 36.0 31 51.0 32 67.0 33 108.0 34 158.0 35 292.0 36 745.0 37 2402.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.4 18.45 14.799999999999999 34.35 2 27.150000000000002 25.724999999999998 28.325 18.8 3 20.825 26.6 29.15 23.425 4 23.549999999999997 32.574999999999996 21.3 22.575 5 28.9 31.0 21.625 18.475 6 23.1 36.725 21.25 18.925 7 22.275 20.549999999999997 35.525 21.65 8 23.275000000000002 23.625 26.200000000000003 26.900000000000002 9 22.900000000000002 23.075000000000003 29.099999999999998 24.925 10-14 25.19 26.924999999999997 24.705 23.18 15-19 25.380000000000003 25.985000000000003 25.7 22.935 20-24 24.635 26.795 25.775 22.795 25-29 25.295 26.400000000000002 25.080000000000002 23.225 30-34 24.490000000000002 26.450000000000003 25.66 23.400000000000002 35-39 24.91 26.395000000000003 24.92 23.775 40-44 24.97 26.625 25.235000000000003 23.169999999999998 45-49 24.785 26.884999999999998 25.235000000000003 23.095 50-54 25.509999999999998 27.295 24.64 22.555 55-59 25.945 26.009999999999998 25.275 22.770000000000003 60-64 25.055 26.009999999999998 25.75 23.185 65-69 25.430000000000003 26.52 25.195 22.855 70-74 26.075 26.3 25.435000000000002 22.189999999999998 75-79 25.005 26.484999999999996 25.615 22.895 80-84 25.56 26.195 25.755 22.49 85-89 25.515 26.52 24.959999999999997 23.005 90-94 25.135 27.105 25.430000000000003 22.33 95-99 25.009999999999998 27.08 25.455 22.455 100-104 25.86 25.785000000000004 25.94 22.415 105-109 25.040000000000003 26.900000000000002 25.785000000000004 22.275 110-114 25.03 27.185 25.255 22.53 115-119 25.305 26.455000000000002 25.555 22.685 120-124 25.6 26.8 25.495 22.105 125-129 25.435000000000002 27.38 25.36 21.825 130-134 25.615 26.97 25.405 22.009999999999998 135-139 26.19 27.115000000000002 25.155 21.54 140-144 25.85 26.650000000000002 25.86 21.64 145-149 26.015 26.540000000000003 25.895000000000003 21.55 150-151 26.2625 26.724999999999998 25.7375 21.275 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 1.5 27 2.5 28 3.0 29 4.0 30 6.0 31 8.5 32 10.5 33 16.5 34 25.0 35 34.5 36 52.5 37 71.0 38 88.5 39 107.0 40 145.0 41 170.5 42 193.0 43 218.0 44 210.5 45 212.0 46 216.0 47 205.5 48 205.0 49 201.0 50 175.5 51 153.0 52 143.0 53 130.5 54 111.5 55 100.0 56 85.5 57 79.0 58 78.0 59 72.5 60 66.0 61 59.0 62 51.5 63 45.0 64 43.0 65 40.0 66 38.0 67 31.5 68 24.0 69 16.5 70 10.5 71 9.0 72 9.0 73 6.5 74 4.5 75 4.0 76 2.5 77 1.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42094662638469 98.725 2 0.5287009063444109 1.05 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025176233635448138 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.48750000000000004 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.8999999999999999 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.1 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.375 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.7 0.0 0.0 0.0 0.0 124-125 1.9125 0.0 0.0 0.0 0.0 126-127 2.075 0.0 0.0 0.0 0.0 128-129 2.3375000000000004 0.0 0.0 0.0 0.0 130-131 2.675 0.0 0.0 0.0 0.0 132-133 3.0 0.0 0.0 0.0 0.0 134-135 3.2375 0.0 0.0 0.0 0.0 136-137 3.575 0.0 0.0 0.0 0.0 138-139 3.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1052175 spots for SRR6958345.sra Written 1052175 spots for SRR6958345.sra Read 1052175 spots for SRR6958345.sra Written 1052175 spots for SRR6958345.sra Read 1052175 spots for SRR6958345.sra Written 1052175 spots for SRR6958345.sra Read 1052175 spots for SRR6958345.sra Written 1052175 spots for SRR6958345.sra Read 1052175 spots for SRR6958345.sra Written 1052175 spots for SRR6958345.sra Read 1052175 spots for SRR6958345.sra Written 1052175 spots for SRR6958345.sra Read 1052177 spots for SRR6958345.sra Written 1052177 spots for SRR6958345.sra Read 1052175 spots for SRR6958345.sra Written 1052175 spots for SRR6958345.sra Read 1052175 spots for SRR6958345.sra Written 1052175 spots for SRR6958345.sra Read 1052175 spots for SRR6958345.sra Written 1052175 spots for SRR6958345.sra Read 1052175 spots for SRR6958345.sra Written 1052175 spots for SRR6958345.sra Read 1052175 spots for SRR6958345.sra Written 1052175 spots for SRR6958345.sra Read 1052175 spots for SRR6958345.sra Written 1052175 spots for SRR6958345.sra Read 1052175 spots for SRR6958345.sra Written 1052175 spots for SRR6958345.sra Read 1052175 spots for SRR6958345.sra Written 1052175 spots for SRR6958345.sra Read 1052175 spots for SRR6958345.sra Written 1052175 spots for SRR6958345.sra Read 1052175 spots for SRR6958345.sra Written 1052175 spots for SRR6958345.sra Read 1052175 spots for SRR6958345.sra Written 1052175 spots for SRR6958345.sra Read 1052175 spots for SRR6958345.sra Written 1052175 spots for SRR6958345.sra Read 1052175 spots for SRR6958345.sra Written 1052175 spots for SRR6958345.sra SRR ids: ['SRR6958345.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fxlw896h SRR6958345.sra spots: 21043502 blocks: [[1, 1052175], [1052176, 2104350], [2104351, 3156525], [3156526, 4208700], [4208701, 5260875], [5260876, 6313050], [6313051, 7365225], [7365226, 8417400], [8417401, 9469575], [9469576, 10521750], [10521751, 11573925], [11573926, 12626100], [12626101, 13678275], [13678276, 14730450], [14730451, 15782625], [15782626, 16834800], [16834801, 17886975], [17886976, 18939150], [18939151, 19991325], [19991326, 21043502]] SRR6958345 file size 7109251 SRR6958345 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958345 SRR6958345_1.fastq SRR6958345_2.fastq Input file: SRR6958345_1.fastq Paired file: SRR6958345_2.fastq trimmed: SRR6958345-trimmed-pair1.fastq, SRR6958345-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:33:17 2024 >> started Fri Dec 6 20:33:42 2024 >> done (24.848s) 21043502 read pairs processed; of these: 10086 ( 0.05%) short read pairs filtered out after trimming by size control 10863 ( 0.05%) empty read pairs filtered out after trimming by size control 21022553 (99.90%) read pairs available; of these: 9168232 (43.61%) trimmed read pairs available after processing 11854321 (56.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 3 0.00% 21 2 0.00% 22 7 0.00% 23 5 0.00% 24 5 0.00% 25 5 0.00% 26 1 0.00% 27 4 0.00% 28 5 0.00% 29 8 0.00% 30 2 0.00% 31 9 0.00% 32 5 0.00% 33 6 0.00% 34 8 0.00% 35 4 0.00% 36 6 0.00% 37 2 0.00% 38 4 0.00% 39 16 0.00% 40 8 0.00% 41 11 0.00% 42 9 0.00% 43 12 0.00% 44 17 0.00% 45 15 0.00% 46 14 0.00% 47 13 0.00% 48 26 0.00% 49 26 0.00% 50 23 0.00% 51 30 0.00% 52 24 0.00% 53 31 0.00% 54 40 0.00% 55 40 0.00% 56 40 0.00% 57 46 0.00% 58 53 0.00% 59 70 0.00% 60 87 0.00% 61 95 0.00% 62 85 0.00% 63 110 0.00% 64 136 0.00% 65 139 0.00% 66 174 0.00% 67 190 0.00% 68 186 0.00% 69 253 0.00% 70 265 0.00% 71 304 0.00% 72 359 0.00% 73 429 0.00% 74 465 0.00% 75 499 0.00% 76 618 0.00% 77 677 0.00% 78 717 0.00% 79 829 0.00% 80 986 0.00% 81 1007 0.00% 82 1297 0.01% 83 1357 0.01% 84 1917 0.01% 85 2215 0.01% 86 2420 0.01% 87 2580 0.01% 88 2974 0.01% 89 3058 0.01% 90 3322 0.02% 91 3546 0.02% 92 3881 0.02% 93 4185 0.02% 94 4759 0.02% 95 5140 0.02% 96 5545 0.03% 97 5833 0.03% 98 6251 0.03% 99 6830 0.03% 100 7228 0.03% 101 7757 0.04% 102 8014 0.04% 103 8770 0.04% 104 9414 0.04% 105 10139 0.05% 106 10870 0.05% 107 11527 0.05% 108 12045 0.06% 109 13132 0.06% 110 13590 0.06% 111 14200 0.07% 112 14960 0.07% 113 15610 0.07% 114 16886 0.08% 115 17889 0.09% 116 19017 0.09% 117 19860 0.09% 118 20946 0.10% 119 21828 0.10% 120 22788 0.11% 121 24145 0.11% 122 25201 0.12% 123 26808 0.13% 124 27830 0.13% 125 29472 0.14% 126 31168 0.15% 127 33233 0.16% 128 34770 0.17% 129 37108 0.18% 130 40601 0.19% 131 41220 0.20% 132 43501 0.21% 133 46207 0.22% 134 48862 0.23% 135 52733 0.25% 136 57158 0.27% 137 60904 0.29% 138 64707 0.31% 139 71303 0.34% 140 78317 0.37% 141 86618 0.41% 142 97349 0.46% 143 110837 0.53% 144 131548 0.63% 145 162169 0.77% 146 206079 0.98% 147 285478 1.36% 148 455252 2.17% 149 953678 4.54% 150 5431124 25.83% 151 11854321 56.39% 21022553 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=3.04 fanout-score-rank=18 prefix-density=0.75 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=39.03 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=1.4 sequence=AAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCGACGAAG criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.74 fanout-score-rank=18 prefix-density=0.55 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=422.90 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=17.4 sequence=AGCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958345 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:34:28 Started mapping on | Dec 06 20:34:28 Finished on | Dec 06 20:35:57 Mapping speed, Million of reads per hour | 850.35 Number of input reads | 21022553 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20259456 Uniquely mapped reads % | 96.37% Average mapped length | 297.39 Number of splices: Total | 24166008 Number of splices: Annotated (sjdb) | 22742801 Number of splices: GT/AG | 23862031 Number of splices: GC/AG | 280170 Number of splices: AT/AC | 9315 Number of splices: Non-canonical | 14492 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 273519 % of reads mapped to multiple loci | 1.30% Number of reads mapped to too many loci | 59042 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.25% % of reads unmapped: other | 1.80% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 494135 494135 494135 N_multimapping 273519 273519 273519 N_noFeature 787794 19692065 948270 N_ambiguous 480512 2551 74634 UnstrandedReadsAssigned:18991150 PositiveStrandReadsAssigned:564840 NegativeStrandReadsAssigned:19236552 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958345 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958345-trimmed-pair1.fastq SRR6958345-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,022,553 reads, 19,318,402 reads pseudoaligned [quant] estimated average fragment length: 245.233 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,306 rounds 52973 SRR6958345.ke.tsv 35125 SRR6958345.se.tsv 88098 total ==> SRR6958345.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 692.054 0 0 PNS24247 1044 799.767 67.2896 6.62827 PNS24249 1928 1683.77 23.8455 1.11568 PNS24246 1044 799.767 67.2896 6.62827 PNS24248 1044 799.767 67.2896 6.62827 PNS24244 1471 1226.77 28.2855 1.81642 PNS24243 293 83.1799 0 0 KQK14069 1603 1358.77 5750.83 333.427 KQK14071 474 234.775 46.8482 15.7202 ==> SRR6958345.se.tsv <== BRADI_1g14170v3 6412 BRADI_1g53295v3 318 BRADI_1g59795v3 219 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 198 BRADI_1g74790v3 76 BRADI_1g09890v3 0 BRADI_1g77505v3 243 BRADI_1g48960v3 0 SRR6958345 completed mapping pipeline successfully