Starting /dee2/code/volunteer_pipeline.sh SRR6958346 current disk space = 1549419376640 free memory = 1592252408 SRR6958346 SRAfilesize d18b16fecb4faeefb1c530e055625aed SRR6958346.sra SRR6958346.sra file validated SRR6958346 is paired end SRR6958346 is conventional basespace SRR6958346 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958346_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.97625 32.0 30.0 33.0 2.0 33.0 2 28.91975 31.0 27.0 33.0 18.0 33.0 3 29.828 31.0 28.0 33.0 25.0 33.0 4 30.65475 32.0 31.0 33.0 27.0 33.0 5 31.985 33.0 32.0 33.0 31.0 33.0 6 36.481 38.0 36.0 38.0 34.0 38.0 7 36.93525 38.0 37.0 38.0 35.0 38.0 8 37.3695 38.0 38.0 38.0 37.0 38.0 9 37.32675 38.0 38.0 38.0 37.0 38.0 10-14 37.246950000000005 38.0 38.0 38.0 36.6 38.0 15-19 37.26105 38.0 38.0 38.0 36.6 38.0 20-24 36.5599 38.0 37.6 38.0 33.6 38.0 25-29 36.7014 38.0 38.0 38.0 35.0 38.0 30-34 37.0878 38.0 38.0 38.0 36.4 38.0 35-39 37.29135 38.0 38.0 38.0 36.8 38.0 40-44 37.22135 38.0 38.0 38.0 36.8 38.0 45-49 37.14149999999999 38.0 38.0 38.0 36.4 38.0 50-54 36.94175 38.0 38.0 38.0 35.6 38.0 55-59 36.84015000000001 38.0 38.0 38.0 35.2 38.0 60-64 37.0005 38.0 38.0 38.0 35.6 38.0 65-69 37.07415 38.0 38.0 38.0 36.0 38.0 70-74 37.045 38.0 38.0 38.0 36.0 38.0 75-79 37.021049999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.929 38.0 38.0 38.0 35.4 38.0 85-89 36.40135 38.0 37.8 38.0 34.0 38.0 90-94 35.90304999999999 38.0 37.2 38.0 31.8 38.0 95-99 34.92315 38.0 36.0 38.0 24.4 38.0 100-104 34.766600000000004 38.0 35.4 38.0 24.8 38.0 105-109 34.7446 38.0 35.2 38.0 24.8 38.0 110-114 35.0883 38.0 35.8 38.0 27.0 38.0 115-119 35.557449999999996 38.0 36.0 38.0 30.0 38.0 120-124 35.8231 38.0 36.8 38.0 31.4 38.0 125-129 35.81935 38.0 36.4 38.0 32.0 38.0 130-134 35.655699999999996 38.0 36.0 38.0 31.4 38.0 135-139 35.3187 38.0 36.0 38.0 30.6 38.0 140-144 34.14595 38.0 34.2 38.0 24.6 38.0 145-149 32.1123 37.6 31.2 38.0 15.0 38.0 150-151 28.094625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 2.0 19 1.0 20 2.0 21 1.0 22 9.0 23 5.0 24 10.0 25 22.0 26 26.0 27 30.0 28 35.0 29 61.0 30 68.0 31 82.0 32 114.0 33 151.0 34 231.0 35 360.0 36 818.0 37 1965.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.10441094360692 10.831937465103294 8.319374651032943 37.74427694025684 2 25.224999999999998 14.249999999999998 33.725 26.8 3 24.125 18.6 25.1 32.175 4 24.25 26.724999999999998 23.1 25.924999999999997 5 27.35 28.1 23.35 21.2 6 23.400000000000002 32.475 23.150000000000002 20.974999999999998 7 17.549999999999997 23.3 40.775 18.375 8 21.349999999999998 23.05 28.525 27.075 9 20.025000000000002 22.5 32.775 24.7 10-14 23.330000000000002 25.840000000000003 25.755 25.074999999999996 15-19 23.53617680884044 24.961248062403122 25.896294814740738 25.6062803140157 20-24 22.865 25.345000000000002 26.705000000000002 25.085 25-29 22.509999999999998 25.75 26.040000000000003 25.7 30-34 22.955000000000002 25.790000000000003 26.224999999999998 25.03 35-39 23.075000000000003 25.7 25.874999999999996 25.35 40-44 22.955000000000002 25.545 25.995 25.505 45-49 22.95 24.93 25.85 26.27 50-54 23.175 25.224999999999998 25.95 25.650000000000002 55-59 23.375 25.290000000000003 26.085 25.25 60-64 23.799999999999997 24.845 26.46 24.895 65-69 23.294999999999998 25.215 26.115 25.374999999999996 70-74 23.39 25.64 25.575 25.395 75-79 23.225 25.895000000000003 25.5 25.380000000000003 80-84 23.52 25.3 25.735000000000003 25.445 85-89 23.305 24.46 26.810000000000002 25.424999999999997 90-94 23.62 24.94 26.135 25.305 95-99 23.474999999999998 24.84 25.94 25.745 100-104 23.22 25.035 25.985000000000003 25.759999999999998 105-109 23.635 25.195 25.679999999999996 25.490000000000002 110-114 23.095 25.685000000000002 26.029999999999998 25.19 115-119 23.330000000000002 25.365 25.765 25.540000000000003 120-124 23.015 25.195 25.924999999999997 25.865 125-129 23.715 25.355 25.314999999999998 25.615 130-134 23.715 25.495 25.395 25.395 135-139 23.369999999999997 25.480000000000004 25.75 25.4 140-144 23.65 25.119999999999997 25.575 25.655 145-149 23.44 24.715 25.515 26.33 150-151 23.799999999999997 24.6125 25.874999999999996 25.7125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 1.0 27 1.5 28 2.5 29 6.0 30 8.5 31 11.0 32 16.5 33 21.0 34 24.5 35 35.0 36 51.5 37 66.5 38 76.0 39 108.0 40 135.5 41 148.0 42 167.0 43 190.0 44 202.0 45 198.5 46 214.5 47 220.5 48 207.5 49 174.0 50 157.0 51 160.5 52 141.0 53 120.0 54 120.5 55 114.0 56 91.0 57 79.5 58 80.0 59 75.0 60 70.0 61 66.0 62 53.5 63 58.5 64 58.5 65 51.5 66 49.0 67 37.5 68 28.0 69 21.0 70 19.0 71 17.5 72 10.0 73 9.0 74 7.0 75 4.5 76 6.0 77 4.5 78 2.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.45 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32041278630757 98.65 2 0.6795872136924239 1.35 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.025 0.025 0.0 0.0 0.0 70-71 0.025 0.025 0.0 0.0 0.0 72-73 0.025 0.025 0.0 0.0 0.0 74-75 0.025 0.025 0.0 0.0 0.0 76-77 0.037500000000000006 0.025 0.0 0.0 0.0 78-79 0.075 0.025 0.0 0.0 0.0 80-81 0.075 0.025 0.0 0.0 0.0 82-83 0.0875 0.025 0.0 0.0 0.0 84-85 0.125 0.025 0.0 0.0 0.0 86-87 0.175 0.025 0.0 0.0 0.0 88-89 0.1875 0.025 0.0 0.0 0.0 90-91 0.225 0.025 0.0 0.0 0.0 92-93 0.30000000000000004 0.025 0.0 0.0 0.0 94-95 0.3375 0.025 0.0 0.0 0.0 96-97 0.375 0.025 0.0 0.0 0.0 98-99 0.42500000000000004 0.025 0.0 0.0 0.0 100-101 0.525 0.025 0.0 0.0 0.0 102-103 0.5875 0.025 0.0 0.0 0.0 104-105 0.7375 0.025 0.0 0.0 0.0 106-107 0.8125 0.025 0.0 0.0 0.0 108-109 0.925 0.025 0.0 0.0 0.0 110-111 0.975 0.025 0.0 0.0 0.0 112-113 1.0875 0.025 0.0 0.0 0.0 114-115 1.225 0.025 0.0 0.0 0.0 116-117 1.3250000000000002 0.025 0.0 0.0 0.0 118-119 1.425 0.025 0.0 0.0 0.0 120-121 1.675 0.025 0.0 0.0 0.0 122-123 1.8125 0.025 0.0 0.0 0.0 124-125 2.1125 0.025 0.0 0.0 0.0 126-127 2.4375 0.037500000000000006 0.0 0.0 0.0 128-129 2.575 0.05 0.0 0.0 0.0 130-131 2.8375000000000004 0.05 0.0 0.0 0.0 132-133 3.175 0.05 0.0 0.0 0.0 134-135 3.5125 0.05 0.0 0.0 0.0 136-137 3.7875 0.05 0.0 0.0 0.0 138-139 4.1375 0.05 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGACGGT 10 0.006841402 144.925 145 >>END_MODULE SRR6958346 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958346_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6065 33.0 33.0 34.0 32.0 34.0 2 32.82525 33.0 33.0 34.0 32.0 34.0 3 32.83025 33.0 33.0 34.0 32.0 34.0 4 32.7835 33.0 33.0 34.0 32.0 34.0 5 32.85325 34.0 33.0 34.0 32.0 34.0 6 36.8455 38.0 38.0 38.0 35.0 38.0 7 36.864 38.0 38.0 38.0 36.0 38.0 8 36.8255 38.0 38.0 38.0 35.0 38.0 9 36.69 38.0 38.0 38.0 35.0 38.0 10-14 36.495 38.0 38.0 38.0 34.0 38.0 15-19 36.27570000000001 38.0 38.0 38.0 33.4 38.0 20-24 36.39815 38.0 38.0 38.0 34.0 38.0 25-29 36.600849999999994 38.0 38.0 38.0 34.6 38.0 30-34 36.920300000000005 38.0 38.0 38.0 35.8 38.0 35-39 36.969449999999995 38.0 38.0 38.0 36.0 38.0 40-44 36.87845 38.0 38.0 38.0 35.8 38.0 45-49 36.66799999999999 38.0 38.0 38.0 34.8 38.0 50-54 36.25375 38.0 38.0 38.0 33.2 38.0 55-59 36.24125 38.0 38.0 38.0 33.0 38.0 60-64 36.4644 38.0 38.0 38.0 34.2 38.0 65-69 36.06439999999999 38.0 38.0 38.0 32.8 38.0 70-74 35.923700000000004 38.0 37.6 38.0 31.8 38.0 75-79 35.747699999999995 38.0 37.2 38.0 30.8 38.0 80-84 35.288850000000004 38.0 36.6 38.0 28.2 38.0 85-89 35.208000000000006 38.0 36.6 38.0 27.6 38.0 90-94 35.69855 38.0 37.2 38.0 30.6 38.0 95-99 35.9416 38.0 37.6 38.0 32.8 38.0 100-104 35.8748 38.0 37.2 38.0 32.8 38.0 105-109 35.8129 38.0 37.4 38.0 32.0 38.0 110-114 35.4785 38.0 36.8 38.0 30.4 38.0 115-119 35.136100000000006 38.0 36.0 38.0 28.8 38.0 120-124 33.4465 37.6 33.0 38.0 19.6 38.0 125-129 33.0493 38.0 32.6 38.0 18.6 38.0 130-134 27.618249999999996 30.2 18.4 36.6 13.6 38.0 135-139 33.0923 37.8 32.4 38.0 19.2 38.0 140-144 33.467600000000004 38.0 33.0 38.0 21.0 38.0 145-149 32.71425000000001 38.0 33.0 38.0 13.4 38.0 150-151 27.23375 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 1.0 5 2.0 6 0.0 7 2.0 8 0.0 9 1.0 10 1.0 11 2.0 12 3.0 13 2.0 14 4.0 15 3.0 16 5.0 17 5.0 18 9.0 19 9.0 20 12.0 21 10.0 22 14.0 23 19.0 24 18.0 25 24.0 26 32.0 27 53.0 28 51.0 29 74.0 30 71.0 31 103.0 32 137.0 33 161.0 34 212.0 35 373.0 36 854.0 37 1721.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.925000000000004 18.95 12.8 31.324999999999996 2 29.95 23.125 26.75 20.175 3 21.825 25.924999999999997 28.975 23.275000000000002 4 26.55 31.825 20.05 21.575 5 26.85 32.324999999999996 20.0 20.825 6 23.825 35.699999999999996 20.599999999999998 19.875 7 22.225 18.3 36.175000000000004 23.3 8 23.674999999999997 23.325000000000003 23.150000000000002 29.849999999999998 9 23.724999999999998 24.65 27.425 24.2 10-14 25.6 26.345000000000002 23.035 25.019999999999996 15-19 25.22 26.064999999999998 24.435000000000002 24.279999999999998 20-24 25.22 25.974999999999998 24.425 24.38 25-29 26.135 25.435000000000002 24.39 24.04 30-34 25.25 25.619999999999997 24.97 24.16 35-39 24.995 26.22 24.605 24.18 40-44 25.385 25.990000000000002 24.435000000000002 24.19 45-49 25.724999999999998 25.555 24.795 23.925 50-54 25.490000000000002 26.21 24.884999999999998 23.415 55-59 26.445 25.974999999999998 23.825 23.755000000000003 60-64 25.905 25.91 24.884999999999998 23.3 65-69 25.369999999999997 26.565 24.335 23.73 70-74 26.029999999999998 25.415 24.52 24.035 75-79 25.580000000000002 25.185000000000002 25.295 23.94 80-84 25.995 26.029999999999998 24.195 23.78 85-89 26.1 25.445 25.185000000000002 23.27 90-94 25.585 25.96 25.5 22.955000000000002 95-99 25.330000000000002 25.77 25.095 23.805 100-104 25.724999999999998 25.545 25.045 23.685000000000002 105-109 25.869999999999997 25.86 24.740000000000002 23.53 110-114 26.009999999999998 25.955000000000002 24.985 23.05 115-119 25.56 25.679999999999996 24.79 23.97 120-124 25.795 26.025 24.83 23.35 125-129 26.575 25.974999999999998 24.2 23.25 130-134 26.295 25.8 24.67 23.235 135-139 26.455000000000002 25.765 25.025 22.755 140-144 26.125 26.974999999999998 24.0 22.900000000000002 145-149 26.195 26.205000000000002 24.765 22.835 150-151 25.912499999999998 26.400000000000002 24.087500000000002 23.599999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.0 24 0.5 25 0.5 26 2.5 27 5.0 28 7.0 29 5.5 30 7.5 31 12.0 32 17.0 33 17.5 34 21.5 35 28.0 36 41.0 37 59.0 38 74.0 39 99.5 40 121.5 41 140.0 42 161.5 43 173.0 44 185.5 45 204.5 46 203.5 47 187.5 48 188.5 49 191.0 50 184.5 51 158.0 52 128.0 53 111.0 54 88.0 55 98.5 56 96.0 57 89.0 58 99.0 59 92.0 60 86.0 61 70.5 62 63.0 63 65.5 64 60.0 65 49.0 66 45.5 67 48.5 68 48.0 69 43.0 70 33.0 71 25.5 72 16.0 73 9.0 74 10.5 75 7.5 76 7.0 77 6.5 78 1.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2938209331652 98.425 2 0.5548549810844893 1.0999999999999999 3 0.12610340479192939 0.375 4 0.025220680958385876 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.5875 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.35 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.6124999999999998 0.0 0.0 0.0 0.0 122-123 1.675 0.0 0.0 0.0 0.0 124-125 1.8375 0.0 0.0 0.0 0.0 126-127 2.1125 0.0 0.0 0.0 0.0 128-129 2.25 0.0 0.0 0.0 0.0 130-131 2.45 0.0 0.0 0.0 0.0 132-133 2.725 0.0 0.0 0.0 0.0 134-135 3.0625 0.0 0.0 0.0 0.0 136-137 3.3375 0.0 0.0 0.0 0.0 138-139 3.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1241913 spots for SRR6958346.sra Written 1241913 spots for SRR6958346.sra Read 1241913 spots for SRR6958346.sra Written 1241913 spots for SRR6958346.sra Read 1241913 spots for SRR6958346.sra Written 1241913 spots for SRR6958346.sra Read 1241913 spots for SRR6958346.sra Written 1241913 spots for SRR6958346.sra Read 1241913 spots for SRR6958346.sra Written 1241913 spots for SRR6958346.sra Read 1241913 spots for SRR6958346.sra Written 1241913 spots for SRR6958346.sra Read 1241913 spots for SRR6958346.sra Written 1241913 spots for SRR6958346.sra Read 1241913 spots for SRR6958346.sra Written 1241913 spots for SRR6958346.sra Read 1241913 spots for SRR6958346.sra Written 1241913 spots for SRR6958346.sra Read 1241913 spots for SRR6958346.sra Written 1241913 spots for SRR6958346.sra Read 1241913 spots for SRR6958346.sra Written 1241913 spots for SRR6958346.sra Read 1241913 spots for SRR6958346.sra Written 1241913 spots for SRR6958346.sra Read 1241913 spots for SRR6958346.sra Written 1241913 spots for SRR6958346.sra Read 1241917 spots for SRR6958346.sra Written 1241917 spots for SRR6958346.sra Read 1241913 spots for SRR6958346.sra Written 1241913 spots for SRR6958346.sra Read 1241913 spots for SRR6958346.sra Written 1241913 spots for SRR6958346.sra Read 1241913 spots for SRR6958346.sra Written 1241913 spots for SRR6958346.sra Read 1241913 spots for SRR6958346.sra Written 1241913 spots for SRR6958346.sra Read 1241913 spots for SRR6958346.sra Written 1241913 spots for SRR6958346.sra Read 1241913 spots for SRR6958346.sra Written 1241913 spots for SRR6958346.sra SRR ids: ['SRR6958346.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o9drcb3n SRR6958346.sra spots: 24838264 blocks: [[1, 1241913], [1241914, 2483826], [2483827, 3725739], [3725740, 4967652], [4967653, 6209565], [6209566, 7451478], [7451479, 8693391], [8693392, 9935304], [9935305, 11177217], [11177218, 12419130], [12419131, 13661043], [13661044, 14902956], [14902957, 16144869], [16144870, 17386782], [17386783, 18628695], [18628696, 19870608], [19870609, 21112521], [21112522, 22354434], [22354435, 23596347], [23596348, 24838264]] SRR6958346 file size 8395172 SRR6958346 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958346 SRR6958346_1.fastq SRR6958346_2.fastq Input file: SRR6958346_1.fastq Paired file: SRR6958346_2.fastq trimmed: SRR6958346-trimmed-pair1.fastq, SRR6958346-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:34:28 2024 >> started Fri Dec 6 20:34:55 2024 >> done (27.777s) 24838264 read pairs processed; of these: 22663 ( 0.09%) short read pairs filtered out after trimming by size control 19703 ( 0.08%) empty read pairs filtered out after trimming by size control 24795898 (99.83%) read pairs available; of these: 9304136 (37.52%) trimmed read pairs available after processing 15491762 (62.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 4 0.00% 21 6 0.00% 22 6 0.00% 23 3 0.00% 24 13 0.00% 25 5 0.00% 26 6 0.00% 27 11 0.00% 28 11 0.00% 29 7 0.00% 30 5 0.00% 31 15 0.00% 32 11 0.00% 33 5 0.00% 34 12 0.00% 35 7 0.00% 36 14 0.00% 37 8 0.00% 38 11 0.00% 39 18 0.00% 40 9 0.00% 41 18 0.00% 42 22 0.00% 43 20 0.00% 44 11 0.00% 45 28 0.00% 46 21 0.00% 47 27 0.00% 48 33 0.00% 49 42 0.00% 50 53 0.00% 51 51 0.00% 52 55 0.00% 53 74 0.00% 54 77 0.00% 55 78 0.00% 56 86 0.00% 57 92 0.00% 58 133 0.00% 59 134 0.00% 60 152 0.00% 61 196 0.00% 62 207 0.00% 63 271 0.00% 64 256 0.00% 65 287 0.00% 66 311 0.00% 67 423 0.00% 68 433 0.00% 69 483 0.00% 70 590 0.00% 71 652 0.00% 72 760 0.00% 73 917 0.00% 74 992 0.00% 75 1108 0.00% 76 1235 0.00% 77 1401 0.01% 78 1456 0.01% 79 1675 0.01% 80 1882 0.01% 81 2176 0.01% 82 2521 0.01% 83 2897 0.01% 84 3981 0.02% 85 4643 0.02% 86 4976 0.02% 87 5013 0.02% 88 5412 0.02% 89 5487 0.02% 90 6005 0.02% 91 6447 0.03% 92 7120 0.03% 93 7747 0.03% 94 8175 0.03% 95 8754 0.04% 96 9059 0.04% 97 9595 0.04% 98 9802 0.04% 99 10598 0.04% 100 11383 0.05% 101 11927 0.05% 102 12666 0.05% 103 13667 0.06% 104 14900 0.06% 105 15206 0.06% 106 16143 0.07% 107 16677 0.07% 108 17426 0.07% 109 18154 0.07% 110 19010 0.08% 111 20360 0.08% 112 21352 0.09% 113 22251 0.09% 114 23863 0.10% 115 25563 0.10% 116 26350 0.11% 117 27281 0.11% 118 28079 0.11% 119 29141 0.12% 120 29988 0.12% 121 31874 0.13% 122 33035 0.13% 123 35147 0.14% 124 37663 0.15% 125 39138 0.16% 126 41076 0.17% 127 42864 0.17% 128 43766 0.18% 129 45846 0.18% 130 47663 0.19% 131 50216 0.20% 132 53132 0.21% 133 56637 0.23% 134 60139 0.24% 135 64456 0.26% 136 68415 0.28% 137 72047 0.29% 138 76182 0.31% 139 81970 0.33% 140 88403 0.36% 141 96878 0.39% 142 108718 0.44% 143 122897 0.50% 144 142057 0.57% 145 170002 0.69% 146 214019 0.86% 147 292348 1.18% 148 441956 1.78% 149 859196 3.47% 150 5227667 21.08% 151 15491762 62.48% 24795898 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=3.07 fanout-score-rank=19 prefix-density=0.66 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=45.31 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.8 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=21 prefix-density=0.52 prefix-fanout=2.8 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=21.47 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=3.3 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958346 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:35:44 Started mapping on | Dec 06 20:35:45 Finished on | Dec 06 20:38:27 Mapping speed, Million of reads per hour | 551.02 Number of input reads | 24795898 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 23997851 Uniquely mapped reads % | 96.78% Average mapped length | 296.68 Number of splices: Total | 28355381 Number of splices: Annotated (sjdb) | 26749525 Number of splices: GT/AG | 27973388 Number of splices: GC/AG | 335074 Number of splices: AT/AC | 11400 Number of splices: Non-canonical | 35519 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.39 Insertion rate per base | 0.01% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 242482 % of reads mapped to multiple loci | 0.98% Number of reads mapped to too many loci | 23611 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.54% % of reads unmapped: other | 0.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 568775 568775 568775 N_multimapping 242482 242482 242482 N_noFeature 827031 23348595 1000052 N_ambiguous 567596 3055 93390 UnstrandedReadsAssigned:22603224 PositiveStrandReadsAssigned:646201 NegativeStrandReadsAssigned:22904409 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958346 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958346-trimmed-pair1.fastq SRR6958346-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,795,898 reads, 22,922,463 reads pseudoaligned [quant] estimated average fragment length: 268.299 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52973 SRR6958346.ke.tsv 35125 SRR6958346.se.tsv 88098 total ==> SRR6958346.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 669.149 0 0 PNS24247 1044 776.701 80.595 6.75449 PNS24249 1928 1660.7 68.5736 2.68784 PNS24246 1044 776.701 80.595 6.75449 PNS24248 1044 776.701 80.595 6.75449 PNS24244 1471 1203.7 41.6414 2.25188 PNS24243 293 83.201 0 0 KQK14069 1603 1335.7 4406.11 214.726 KQK14071 474 222.879 75.4545 22.0371 ==> SRR6958346.se.tsv <== BRADI_1g14170v3 4998 BRADI_1g53295v3 307 BRADI_1g59795v3 366 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 433 BRADI_1g74790v3 91 BRADI_1g09890v3 0 BRADI_1g77505v3 323 BRADI_1g48960v3 0 SRR6958346 completed mapping pipeline successfully