Starting /dee2/code/volunteer_pipeline.sh SRR6958347 current disk space = 1549411696640 free memory = 1597180360 SRR6958347 SRAfilesize f3b2c3dc26bf774019fba58f79c335dd SRR6958347.sra SRR6958347.sra file validated SRR6958347 is paired end SRR6958347 is conventional basespace SRR6958347 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958347_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.399 18.0 18.0 28.0 18.0 32.0 2 25.1675 27.0 18.0 29.0 18.0 33.0 3 26.1995 28.0 18.0 31.0 18.0 33.0 4 30.74475 32.0 32.0 33.0 27.0 33.0 5 32.28125 33.0 32.0 33.0 32.0 33.0 6 36.58875 37.0 36.0 38.0 34.0 38.0 7 37.29625 38.0 38.0 38.0 36.0 38.0 8 37.47775 38.0 38.0 38.0 37.0 38.0 9 37.0735 38.0 38.0 38.0 36.0 38.0 10-14 37.32475 38.0 38.0 38.0 36.4 38.0 15-19 37.48095 38.0 38.0 38.0 37.0 38.0 20-24 37.36255 38.0 38.0 38.0 36.8 38.0 25-29 37.368649999999995 38.0 38.0 38.0 36.8 38.0 30-34 37.503400000000006 38.0 38.0 38.0 37.6 38.0 35-39 37.484950000000005 38.0 38.0 38.0 37.4 38.0 40-44 37.480599999999995 38.0 38.0 38.0 37.4 38.0 45-49 37.25345 38.0 38.0 38.0 36.6 38.0 50-54 37.077999999999996 38.0 38.0 38.0 36.2 38.0 55-59 36.97245 38.0 38.0 38.0 35.6 38.0 60-64 36.93814999999999 38.0 38.0 38.0 35.4 38.0 65-69 36.81845 38.0 38.0 38.0 34.8 38.0 70-74 36.78665 38.0 38.0 38.0 35.0 38.0 75-79 36.961349999999996 38.0 38.0 38.0 35.6 38.0 80-84 36.831500000000005 38.0 38.0 38.0 35.0 38.0 85-89 36.77845 38.0 38.0 38.0 35.0 38.0 90-94 36.8161 38.0 38.0 38.0 35.0 38.0 95-99 36.72595 38.0 38.0 38.0 34.6 38.0 100-104 36.4768 38.0 37.8 38.0 34.0 38.0 105-109 36.44635000000001 38.0 37.6 38.0 34.0 38.0 110-114 36.185700000000004 38.0 37.0 38.0 33.6 38.0 115-119 36.03255 38.0 37.0 38.0 33.2 38.0 120-124 35.8932 38.0 36.6 38.0 32.0 38.0 125-129 35.63425 38.0 36.0 38.0 31.4 38.0 130-134 35.37735 38.0 35.8 38.0 30.0 38.0 135-139 35.2393 38.0 35.8 38.0 29.4 38.0 140-144 34.7923 38.0 35.0 38.0 27.8 38.0 145-149 34.276500000000006 38.0 35.0 38.0 25.8 38.0 150-151 30.82875 35.5 29.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 3.0 17 1.0 18 1.0 19 5.0 20 1.0 21 1.0 22 2.0 23 4.0 24 7.0 25 6.0 26 8.0 27 21.0 28 20.0 29 26.0 30 36.0 31 52.0 32 87.0 33 111.0 34 204.0 35 372.0 36 1022.0 37 2009.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.08322824716267 7.742749054224464 16.01513240857503 38.15889029003783 2 20.225 10.475 41.699999999999996 27.6 3 20.655163790947736 14.553638409602401 27.38184546136534 37.409352338084524 4 26.05 21.125 23.974999999999998 28.849999999999998 5 25.974999999999998 27.575 24.55 21.9 6 22.825 33.225 22.975 20.974999999999998 7 16.875 27.175 38.15 17.8 8 19.475 26.724999999999998 29.599999999999998 24.2 9 19.45 23.75 34.225 22.575 10-14 21.67 28.785 26.779999999999998 22.765 15-19 21.485000000000003 27.79 26.505000000000003 24.22 20-24 21.82 28.799999999999997 26.39 22.99 25-29 21.43 28.4 26.295 23.875 30-34 21.709999999999997 27.900000000000002 26.529999999999998 23.86 35-39 21.19 28.115000000000002 26.419999999999998 24.275 40-44 21.759999999999998 27.634999999999998 26.424999999999997 24.18 45-49 21.78 27.860000000000003 26.1 24.26 50-54 22.14832224833725 28.174226133920087 26.393959093864076 23.283492523878582 55-59 21.85609280464023 28.431421571078552 26.381319065953296 23.33116655832792 60-64 21.996099804990248 27.546377318865943 26.846342317115855 23.611180559027954 65-69 21.82 28.105000000000004 26.490000000000002 23.585 70-74 21.54 28.22 26.495 23.745 75-79 21.63 27.639999999999997 26.834999999999997 23.895 80-84 21.8 27.224999999999998 26.619999999999997 24.355 85-89 21.955 27.55 26.46 24.035 90-94 21.654999999999998 27.115000000000002 26.729999999999997 24.5 95-99 21.495 27.63 26.345000000000002 24.529999999999998 100-104 21.996099804990248 28.096404820241013 26.176308815440773 23.731186559327966 105-109 22.17110855542777 27.716385819290963 26.33131656582829 23.781189059452974 110-114 22.223334000400243 28.216930158094854 26.36581949169502 23.193916349809886 115-119 22.61904761904762 28.84653861544618 25.49519807923169 23.03921568627451 120-124 22.81 28.02 25.785000000000004 23.385 125-129 21.72541558181454 28.0242339274985 26.507109953935508 23.743240536751454 130-134 22.52851711026616 27.336401841104664 26.285771462877726 23.849309585751453 135-139 22.005 27.47 26.275 24.25 140-144 21.95 27.705000000000002 26.035000000000004 24.310000000000002 145-149 22.095000000000002 27.595 25.474999999999998 24.834999999999997 150-151 22.2 27.8125 25.8625 24.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 0.5 27 1.0 28 3.5 29 9.0 30 9.5 31 8.0 32 11.5 33 18.0 34 28.0 35 45.5 36 74.0 37 95.5 38 112.0 39 136.5 40 170.0 41 226.5 42 241.5 43 257.5 44 272.5 45 236.5 46 231.5 47 241.5 48 234.5 49 214.0 50 177.0 51 130.5 52 104.5 53 98.5 54 93.0 55 82.5 56 65.0 57 61.5 58 54.5 59 37.5 60 38.5 61 32.0 62 25.5 63 27.5 64 22.0 65 16.0 66 12.5 67 10.5 68 6.5 69 6.0 70 6.5 71 2.5 72 2.0 73 1.5 74 0.5 75 1.0 76 1.0 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8750000000000001 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.015 55-59 0.005 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.005 110-114 0.06 115-119 0.04 120-124 0.0 125-129 0.13999999999999999 130-134 0.06 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0125 0.0 0.0 22-23 0.0 0.0 0.025 0.0 0.0 24-25 0.0 0.0 0.025 0.0 0.0 26-27 0.0 0.0 0.025 0.0 0.0 28-29 0.0 0.0 0.025 0.0 0.0 30-31 0.0 0.0 0.025 0.0 0.0 32-33 0.0 0.0 0.025 0.0 0.0 34-35 0.0 0.0 0.025 0.0 0.0 36-37 0.0 0.0 0.025 0.0 0.0 38-39 0.0 0.0 0.025 0.0 0.0 40-41 0.0 0.0 0.025 0.0 0.0 42-43 0.0 0.0 0.025 0.0 0.0 44-45 0.0 0.0 0.025 0.0 0.0 46-47 0.0 0.0 0.025 0.0 0.0 48-49 0.0 0.0 0.025 0.0 0.0 50-51 0.0 0.0 0.025 0.0 0.0 52-53 0.0 0.0 0.025 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0 0.0 0.025 0.0 0.0 64-65 0.0 0.0 0.025 0.0 0.0 66-67 0.0 0.0 0.025 0.0 0.0 68-69 0.0 0.0 0.025 0.0 0.0 70-71 0.0 0.0 0.025 0.0 0.0 72-73 0.0 0.0 0.025 0.0 0.0 74-75 0.0 0.0 0.025 0.0 0.0 76-77 0.0 0.0 0.025 0.0 0.0 78-79 0.0 0.0 0.025 0.0 0.0 80-81 0.0125 0.0 0.025 0.0 0.0 82-83 0.025 0.0 0.025 0.0 0.0 84-85 0.025 0.0 0.025 0.0 0.0 86-87 0.0625 0.0 0.025 0.0 0.0 88-89 0.1125 0.0 0.025 0.0 0.0 90-91 0.2 0.0 0.025 0.0 0.0 92-93 0.2625 0.0 0.025 0.0 0.0 94-95 0.30000000000000004 0.0 0.025 0.0 0.0 96-97 0.35 0.0 0.025 0.0 0.0 98-99 0.48750000000000004 0.0 0.025 0.0 0.0 100-101 0.5625 0.0 0.025 0.0 0.0 102-103 0.675 0.0 0.025 0.0 0.0 104-105 0.8625 0.0 0.025 0.0 0.0 106-107 1.1124999999999998 0.0 0.025 0.0 0.0 108-109 1.4125 0.0 0.025 0.0 0.0 110-111 1.5750000000000002 0.0 0.025 0.0 0.0 112-113 1.8125 0.0 0.025 0.0 0.0 114-115 2.0250000000000004 0.0 0.025 0.0 0.0 116-117 2.3 0.0 0.025 0.0 0.0 118-119 2.7625 0.0 0.025 0.0 0.0 120-121 3.1375 0.0 0.025 0.0 0.0 122-123 3.425 0.0 0.025 0.0 0.0 124-125 3.7125 0.0 0.025 0.0 0.0 126-127 4.1875 0.0 0.025 0.0 0.0 128-129 4.675000000000001 0.0 0.025 0.0 0.0 130-131 4.95 0.0 0.025 0.0 0.0 132-133 5.2875 0.0 0.025 0.0 0.0 134-135 5.675 0.0 0.025 0.0 0.0 136-137 6.2625 0.0 0.025 0.0 0.0 138-139 6.7625 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATCCA 10 0.006830828 145.0 4 TTATGTG 10 0.006830828 145.0 9 >>END_MODULE SRR6958347 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958347_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1635 33.0 33.0 34.0 33.0 34.0 2 33.2485 34.0 33.0 34.0 33.0 34.0 3 33.30625 34.0 33.0 34.0 33.0 34.0 4 33.25475 34.0 33.0 34.0 33.0 34.0 5 33.2955 34.0 33.0 34.0 33.0 34.0 6 37.54775 38.0 38.0 38.0 38.0 38.0 7 37.52975 38.0 38.0 38.0 38.0 38.0 8 37.491 38.0 38.0 38.0 38.0 38.0 9 36.7285 38.0 38.0 38.0 36.0 38.0 10-14 37.0832 38.0 38.0 38.0 36.4 38.0 15-19 36.95055 38.0 38.0 38.0 35.8 38.0 20-24 37.239000000000004 38.0 38.0 38.0 37.2 38.0 25-29 37.43235 38.0 38.0 38.0 38.0 38.0 30-34 37.51675 38.0 38.0 38.0 38.0 38.0 35-39 37.19775 38.0 38.0 38.0 36.8 38.0 40-44 37.056200000000004 38.0 38.0 38.0 36.8 38.0 45-49 36.9286 38.0 38.0 38.0 36.0 38.0 50-54 36.71295 38.0 38.0 38.0 34.4 38.0 55-59 37.08105 38.0 38.0 38.0 36.6 38.0 60-64 37.328050000000005 38.0 38.0 38.0 37.6 38.0 65-69 37.37325 38.0 38.0 38.0 37.6 38.0 70-74 37.38615 38.0 38.0 38.0 38.0 38.0 75-79 37.13925 38.0 38.0 38.0 36.6 38.0 80-84 37.12585 38.0 38.0 38.0 36.8 38.0 85-89 36.892450000000004 38.0 38.0 38.0 36.0 38.0 90-94 36.61715 38.0 38.0 38.0 34.8 38.0 95-99 36.81885 38.0 38.0 38.0 35.6 38.0 100-104 35.950849999999996 38.0 37.4 38.0 31.2 38.0 105-109 36.9136 38.0 38.0 38.0 35.6 38.0 110-114 35.220150000000004 38.0 36.2 38.0 28.0 38.0 115-119 36.33165 38.0 37.8 38.0 33.6 38.0 120-124 35.6937 38.0 37.2 38.0 30.6 38.0 125-129 36.38535 38.0 38.0 38.0 34.0 38.0 130-134 34.0793 38.0 34.6 38.0 21.6 38.0 135-139 33.3038 38.0 33.6 38.0 17.8 38.0 140-144 34.00885 38.0 34.2 38.0 22.8 38.0 145-149 35.17405 38.0 36.0 38.0 31.0 38.0 150-151 31.83925 35.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 2.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 3.0 14 0.0 15 0.0 16 1.0 17 2.0 18 2.0 19 2.0 20 8.0 21 3.0 22 3.0 23 6.0 24 4.0 25 8.0 26 6.0 27 16.0 28 16.0 29 25.0 30 37.0 31 35.0 32 63.0 33 93.0 34 134.0 35 283.0 36 1036.0 37 2203.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.724999999999998 20.05 14.299999999999999 33.925 2 27.875 24.224999999999998 29.125 18.775 3 22.925 25.974999999999998 29.575000000000003 21.525 4 24.05 32.425 22.25 21.275 5 26.474999999999998 33.75 22.55 17.224999999999998 6 22.325 37.425000000000004 22.1 18.15 7 22.5 20.549999999999997 36.1 20.849999999999998 8 23.375 23.875 26.075 26.674999999999997 9 22.75 24.0 31.374999999999996 21.875 10-14 24.235 27.794999999999998 25.695 22.275 15-19 24.154999999999998 27.165 26.745 21.935 20-24 24.65 27.515 26.240000000000002 21.595 25-29 23.974999999999998 27.55 26.279999999999998 22.195 30-34 24.425 27.034999999999997 26.724999999999998 21.815 35-39 24.115000000000002 27.155 26.455000000000002 22.275 40-44 24.79 26.235000000000003 26.855 22.12 45-49 24.295 27.060000000000002 26.424999999999997 22.220000000000002 50-54 23.84 27.169999999999998 26.919999999999998 22.07 55-59 24.845 27.439999999999998 26.040000000000003 21.675 60-64 23.97 27.18 26.5 22.35 65-69 24.165 27.48 26.39 21.965 70-74 24.245 26.365 27.229999999999997 22.16 75-79 24.04 26.685 27.245 22.03 80-84 24.385 26.905 26.76 21.95 85-89 23.71 26.419999999999998 27.325 22.545 90-94 23.65 27.169999999999998 27.195000000000004 21.985 95-99 24.115000000000002 27.16 27.22 21.505 100-104 24.505 26.179999999999996 27.595 21.72 105-109 24.09 27.084999999999997 27.425 21.4 110-114 24.224999999999998 26.950000000000003 27.055 21.77 115-119 24.26 27.089999999999996 27.139999999999997 21.51 120-124 24.795 26.39 27.13 21.685 125-129 25.009999999999998 27.095000000000002 26.77 21.125 130-134 25.474999999999998 26.46 27.01 21.055 135-139 25.330000000000002 26.955000000000002 26.974999999999998 20.74 140-144 25.509999999999998 26.845000000000002 26.745 20.9 145-149 25.540000000000003 26.845000000000002 26.924999999999997 20.69 150-151 25.1 26.75 26.787499999999998 21.3625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 1.5 25 2.5 26 2.0 27 1.0 28 4.0 29 6.0 30 7.0 31 12.0 32 13.0 33 23.0 34 38.5 35 41.5 36 53.0 37 83.0 38 110.5 39 142.0 40 175.5 41 201.5 42 219.0 43 227.0 44 244.5 45 259.5 46 254.5 47 237.5 48 221.5 49 194.0 50 165.5 51 158.0 52 132.5 53 97.5 54 86.0 55 91.5 56 77.5 57 56.5 58 53.0 59 48.0 60 43.5 61 36.5 62 35.5 63 30.5 64 22.0 65 18.0 66 12.0 67 12.5 68 12.0 69 8.0 70 8.0 71 7.5 72 3.5 73 2.5 74 2.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.2508780732563974 0.5 3 0.050175614651279475 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.38749999999999996 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.4249999999999998 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.825 0.0 0.0 0.0 0.0 116-117 2.1125 0.0 0.0 0.0 0.0 118-119 2.6 0.0 0.0 0.0 0.0 120-121 2.9375 0.0 0.0 0.0 0.0 122-123 3.2249999999999996 0.0 0.0 0.0 0.0 124-125 3.5 0.0 0.0 0.0 0.0 126-127 3.9375 0.0 0.0 0.0 0.0 128-129 4.324999999999999 0.0 0.0 0.0 0.0 130-131 4.5625 0.0 0.0 0.0 0.0 132-133 4.8 0.0 0.0 0.0 0.0 134-135 5.2 0.0 0.0 0.0 0.0 136-137 5.6875 0.0 0.0 0.0 0.0 138-139 6.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAG 10 0.006830828 145.0 2 >>END_MODULE Read 451880 spots for SRR6958347.sra Written 451880 spots for SRR6958347.sra Read 451880 spots for SRR6958347.sra Written 451880 spots for SRR6958347.sra Read 451880 spots for SRR6958347.sra Written 451880 spots for SRR6958347.sra Read 451880 spots for SRR6958347.sra Written 451880 spots for SRR6958347.sra Read 451880 spots for SRR6958347.sra Written 451880 spots for SRR6958347.sra Read 451880 spots for SRR6958347.sra Written 451880 spots for SRR6958347.sra Read 451880 spots for SRR6958347.sra Written 451880 spots for SRR6958347.sra Read 451880 spots for SRR6958347.sra Written 451880 spots for SRR6958347.sra Read 451885 spots for SRR6958347.sra Written 451885 spots for SRR6958347.sra Read 451880 spots for SRR6958347.sra Written 451880 spots for SRR6958347.sra Read 451880 spots for SRR6958347.sra Written 451880 spots for SRR6958347.sra Read 451880 spots for SRR6958347.sra Written 451880 spots for SRR6958347.sra Read 451880 spots for SRR6958347.sra Written 451880 spots for SRR6958347.sra Read 451880 spots for SRR6958347.sra Written 451880 spots for SRR6958347.sra Read 451880 spots for SRR6958347.sra Written 451880 spots for SRR6958347.sra Read 451880 spots for SRR6958347.sra Written 451880 spots for SRR6958347.sra Read 451880 spots for SRR6958347.sra Written 451880 spots for SRR6958347.sra Read 451880 spots for SRR6958347.sra Written 451880 spots for SRR6958347.sra Read 451880 spots for SRR6958347.sra Written 451880 spots for SRR6958347.sra Read 451880 spots for SRR6958347.sra Written 451880 spots for SRR6958347.sra SRR ids: ['SRR6958347.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e8tn6r6p SRR6958347.sra spots: 9037605 blocks: [[1, 451880], [451881, 903760], [903761, 1355640], [1355641, 1807520], [1807521, 2259400], [2259401, 2711280], [2711281, 3163160], [3163161, 3615040], [3615041, 4066920], [4066921, 4518800], [4518801, 4970680], [4970681, 5422560], [5422561, 5874440], [5874441, 6326320], [6326321, 6778200], [6778201, 7230080], [7230081, 7681960], [7681961, 8133840], [8133841, 8585720], [8585721, 9037605]] SRR6958347 file size 3042727 SRR6958347 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958347 SRR6958347_1.fastq SRR6958347_2.fastq Input file: SRR6958347_1.fastq Paired file: SRR6958347_2.fastq trimmed: SRR6958347-trimmed-pair1.fastq, SRR6958347-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:32:36 2024 >> started Fri Dec 6 20:32:47 2024 >> done (10.624s) 9037605 read pairs processed; of these: 4081 ( 0.05%) short read pairs filtered out after trimming by size control 4070 ( 0.05%) empty read pairs filtered out after trimming by size control 9029454 (99.91%) read pairs available; of these: 3838104 (42.51%) trimmed read pairs available after processing 5191350 (57.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 3 0.00% 21 1 0.00% 22 2 0.00% 23 5 0.00% 24 1 0.00% 25 2 0.00% 26 0 0.00% 27 1 0.00% 28 2 0.00% 29 6 0.00% 30 3 0.00% 31 2 0.00% 32 2 0.00% 33 4 0.00% 34 5 0.00% 35 5 0.00% 36 4 0.00% 37 2 0.00% 38 2 0.00% 39 1 0.00% 40 5 0.00% 41 5 0.00% 42 6 0.00% 43 13 0.00% 44 9 0.00% 45 9 0.00% 46 2 0.00% 47 7 0.00% 48 9 0.00% 49 8 0.00% 50 12 0.00% 51 13 0.00% 52 18 0.00% 53 17 0.00% 54 22 0.00% 55 23 0.00% 56 19 0.00% 57 21 0.00% 58 33 0.00% 59 35 0.00% 60 40 0.00% 61 52 0.00% 62 44 0.00% 63 49 0.00% 64 63 0.00% 65 51 0.00% 66 77 0.00% 67 116 0.00% 68 97 0.00% 69 120 0.00% 70 140 0.00% 71 155 0.00% 72 192 0.00% 73 192 0.00% 74 243 0.00% 75 253 0.00% 76 364 0.00% 77 370 0.00% 78 365 0.00% 79 451 0.00% 80 461 0.01% 81 519 0.01% 82 602 0.01% 83 768 0.01% 84 903 0.01% 85 1093 0.01% 86 1128 0.01% 87 1311 0.01% 88 1338 0.01% 89 1444 0.02% 90 1617 0.02% 91 1811 0.02% 92 1893 0.02% 93 2169 0.02% 94 2324 0.03% 95 2469 0.03% 96 2755 0.03% 97 3011 0.03% 98 3241 0.04% 99 3820 0.04% 100 4032 0.04% 101 4401 0.05% 102 3895 0.04% 103 4212 0.05% 104 4647 0.05% 105 4912 0.05% 106 5239 0.06% 107 5592 0.06% 108 5874 0.07% 109 6139 0.07% 110 6393 0.07% 111 6699 0.07% 112 7266 0.08% 113 7465 0.08% 114 7868 0.09% 115 8450 0.09% 116 8978 0.10% 117 9453 0.10% 118 10183 0.11% 119 10425 0.12% 120 11009 0.12% 121 11465 0.13% 122 11867 0.13% 123 12338 0.14% 124 13093 0.15% 125 13772 0.15% 126 14544 0.16% 127 15633 0.17% 128 16232 0.18% 129 17052 0.19% 130 18099 0.20% 131 18931 0.21% 132 20066 0.22% 133 21493 0.24% 134 22965 0.25% 135 24293 0.27% 136 26163 0.29% 137 28004 0.31% 138 29814 0.33% 139 32917 0.36% 140 35691 0.40% 141 38633 0.43% 142 43835 0.49% 143 48991 0.54% 144 58385 0.65% 145 71164 0.79% 146 90587 1.00% 147 126173 1.40% 148 199966 2.21% 149 407654 4.51% 150 2166699 24.00% 151 5191350 57.49% 9029454 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.48 fanout-score-rank=20 prefix-density=0.48 prefix-fanout=3.2 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=92.25 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=12.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=3.57 fanout-score-rank=25 prefix-density=0.41 prefix-fanout=2.9 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=67.93 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=8.7 sequence=AGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAGAAGAAGGTGCAGACCGAGTGCGCCTCCATGCCTTTCGATGACCAATGCGCCGTCTTGGAAAAGGAGGCCGTGAACGTGTCCCTCGAGAACCTCAAGACCTACCCGTTCGTCAAGGAAGGCGTCGCCAACGGAACCCT SRR6958347 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:33:37 Started mapping on | Dec 06 20:33:38 Finished on | Dec 06 20:34:24 Mapping speed, Million of reads per hour | 706.65 Number of input reads | 9029454 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 8891628 Uniquely mapped reads % | 98.47% Average mapped length | 297.04 Number of splices: Total | 10548574 Number of splices: Annotated (sjdb) | 9927981 Number of splices: GT/AG | 10416278 Number of splices: GC/AG | 122211 Number of splices: AT/AC | 4143 Number of splices: Non-canonical | 5942 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.34 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 70110 % of reads mapped to multiple loci | 0.78% Number of reads mapped to too many loci | 6209 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.22% % of reads unmapped: other | 0.46% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 70373 70373 70373 N_multimapping 70110 70110 70110 N_noFeature 316593 8641075 388626 N_ambiguous 210505 1045 32561 UnstrandedReadsAssigned:8364530 PositiveStrandReadsAssigned:249508 NegativeStrandReadsAssigned:8470441 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958347 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958347-trimmed-pair1.fastq SRR6958347-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,029,454 reads, 8,490,650 reads pseudoaligned [quant] estimated average fragment length: 225.745 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52973 SRR6958347.ke.tsv 35125 SRR6958347.se.tsv 88098 total ==> SRR6958347.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 711.715 0 0 PNS24247 1044 819.255 39.1791 8.78851 PNS24249 1928 1703.25 11.9957 1.29427 PNS24246 1044 819.255 39.1791 8.78851 PNS24248 1044 819.255 39.1791 8.78851 PNS24244 1471 1246.25 9.46686 1.39598 PNS24243 293 90.1031 0 0 KQK14069 1603 1378.25 2051.66 273.562 KQK14071 474 252.595 42.1608 30.6735 ==> SRR6958347.se.tsv <== BRADI_1g14170v3 2408 BRADI_1g53295v3 154 BRADI_1g59795v3 180 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 165 BRADI_1g74790v3 51 BRADI_1g09890v3 0 BRADI_1g77505v3 158 BRADI_1g48960v3 0 SRR6958347 completed mapping pipeline successfully