Starting /dee2/code/volunteer_pipeline.sh SRR6958348 current disk space = 1549391986688 free memory = 1600292560 SRR6958348 SRAfilesize df2dc7ee59d9d985a2b6e4357867a334 SRR6958348.sra SRR6958348.sra file validated SRR6958348 is paired end SRR6958348 is conventional basespace SRR6958348 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958348_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.05825 18.0 18.0 32.0 18.0 33.0 2 26.5315 28.0 18.0 31.0 18.0 33.0 3 28.12575 29.0 25.0 31.0 18.0 33.0 4 29.84275 31.0 29.0 33.0 27.0 33.0 5 32.12275 33.0 32.0 33.0 32.0 33.0 6 36.514 38.0 36.0 38.0 34.0 38.0 7 37.061 38.0 38.0 38.0 35.0 38.0 8 36.719 38.0 38.0 38.0 34.0 38.0 9 37.33575 38.0 38.0 38.0 37.0 38.0 10-14 37.51875 38.0 38.0 38.0 37.4 38.0 15-19 37.5575 38.0 38.0 38.0 38.0 38.0 20-24 37.514500000000005 38.0 38.0 38.0 37.8 38.0 25-29 37.4448 38.0 38.0 38.0 37.8 38.0 30-34 37.233050000000006 38.0 38.0 38.0 36.6 38.0 35-39 37.6037 38.0 38.0 38.0 38.0 38.0 40-44 37.53225 38.0 38.0 38.0 38.0 38.0 45-49 37.46585 38.0 38.0 38.0 37.8 38.0 50-54 37.29655 38.0 38.0 38.0 36.8 38.0 55-59 37.32485 38.0 38.0 38.0 37.0 38.0 60-64 37.44705 38.0 38.0 38.0 37.0 38.0 65-69 37.11285 38.0 38.0 38.0 36.4 38.0 70-74 36.43275 38.0 37.2 38.0 31.2 38.0 75-79 37.2531 38.0 38.0 38.0 36.8 38.0 80-84 37.3377 38.0 38.0 38.0 37.0 38.0 85-89 36.343599999999995 38.0 37.4 38.0 32.2 38.0 90-94 34.498599999999996 38.0 34.6 38.0 22.8 38.0 95-99 35.97025000000001 38.0 37.0 38.0 32.0 38.0 100-104 35.713049999999996 38.0 37.0 38.0 30.0 38.0 105-109 35.843500000000006 38.0 36.8 38.0 31.4 38.0 110-114 36.11425 38.0 37.6 38.0 33.2 38.0 115-119 36.533100000000005 38.0 38.0 38.0 34.0 38.0 120-124 36.610350000000004 38.0 38.0 38.0 34.0 38.0 125-129 36.50285 38.0 38.0 38.0 34.2 38.0 130-134 36.4439 38.0 38.0 38.0 34.0 38.0 135-139 36.16355 38.0 37.8 38.0 33.6 38.0 140-144 35.59975 38.0 36.0 38.0 31.2 38.0 145-149 34.900549999999996 38.0 35.8 38.0 30.4 38.0 150-151 30.829 35.5 30.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 1.0 18 0.0 19 1.0 20 2.0 21 3.0 22 3.0 23 4.0 24 3.0 25 10.0 26 11.0 27 17.0 28 19.0 29 22.0 30 44.0 31 47.0 32 67.0 33 117.0 34 163.0 35 330.0 36 969.0 37 2163.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.417462482946796 14.843110504774899 8.84038199181446 37.899045020463845 2 22.875 13.350000000000001 33.975 29.799999999999997 3 19.825 19.375 24.4 36.4 4 25.624999999999996 26.025 21.875 26.474999999999998 5 24.85 30.675 23.325000000000003 21.15 6 22.85 30.875000000000004 25.025 21.25 7 17.424999999999997 23.225 39.800000000000004 19.55 8 20.974999999999998 23.9 27.575 27.55 9 19.225 22.1 32.9 25.775 10-14 23.29 26.419999999999998 25.900000000000002 24.39 15-19 23.14 24.615000000000002 26.674999999999997 25.569999999999997 20-24 22.5890356142457 25.240096038415366 26.730692276910766 25.440176070428173 25-29 22.807280728072808 25.48754875487549 25.78757875787579 25.917591759175917 30-34 22.435 25.569999999999997 26.38 25.615 35-39 23.362336233623363 25.192519251925194 25.882588258825884 25.562556255625562 40-44 22.46224622462246 25.942594259425945 26.227622762276226 25.367536753675367 45-49 23.03 25.535000000000004 25.745 25.69 50-54 22.884999999999998 24.915000000000003 26.155 26.045 55-59 23.452345234523452 25.337533753375336 25.50755075507551 25.7025702570257 60-64 22.86 25.28 26.085 25.775 65-69 23.43 25.290000000000003 25.674999999999997 25.605 70-74 23.43617180859043 25.336266813340668 25.406270313515677 25.821291064553225 75-79 22.84 25.064999999999998 26.495 25.6 80-84 23.44 25.259999999999998 25.575 25.724999999999998 85-89 23.925 24.855 25.885 25.335 90-94 23.544999999999998 24.67 26.029999999999998 25.755 95-99 22.814999999999998 24.88 26.009999999999998 26.295 100-104 23.855 25.83 25.15 25.165 105-109 23.79 24.975 25.75 25.485000000000003 110-114 23.485 25.224999999999998 25.840000000000003 25.45 115-119 24.21 24.97 25.575 25.245 120-124 23.95 25.16 25.765 25.124999999999996 125-129 23.655 25.335 25.05 25.96 130-134 24.169999999999998 24.68 25.679999999999996 25.47 135-139 23.785 25.185000000000002 25.09 25.94 140-144 23.75 25.14 25.72 25.39 145-149 24.595 24.455 25.555 25.395 150-151 23.7875 25.35 25.912499999999998 24.95 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 1.5 26 2.0 27 2.5 28 3.0 29 6.5 30 7.5 31 9.5 32 14.5 33 16.0 34 19.5 35 37.5 36 54.5 37 67.0 38 86.5 39 109.0 40 129.5 41 155.5 42 171.5 43 177.0 44 194.5 45 208.0 46 213.0 47 211.0 48 203.5 49 191.0 50 173.5 51 148.0 52 125.0 53 116.0 54 110.5 55 105.0 56 97.0 57 83.0 58 70.0 59 75.5 60 78.5 61 73.0 62 69.0 63 61.0 64 55.5 65 42.5 66 35.0 67 36.5 68 31.5 69 28.0 70 24.5 71 18.0 72 13.0 73 11.5 74 9.5 75 6.0 76 4.5 77 2.5 78 1.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.04 25-29 0.01 30-34 0.0 35-39 0.01 40-44 0.01 45-49 0.0 50-54 0.0 55-59 0.01 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.5249999999999999 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.0625 0.0 0.0 0.0 0.0 122-123 1.275 0.0 0.0 0.0 0.0 124-125 1.575 0.0 0.0 0.0 0.0 126-127 1.7375 0.0 0.0 0.0 0.0 128-129 2.0250000000000004 0.0 0.0 0.0 0.0 130-131 2.2125 0.0 0.0 0.0 0.0 132-133 2.55 0.0 0.0 0.0 0.0 134-135 2.8125 0.0 0.0 0.0 0.0 136-137 3.0999999999999996 0.0 0.0 0.0 0.0 138-139 3.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTAGTA 10 0.0068963906 144.5375 4 CAGTAGT 10 0.0068963906 144.5375 3 AAAGTCC 10 0.0068963906 144.5375 5 >>END_MODULE SRR6958348 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958348_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7955 33.0 33.0 34.0 32.0 34.0 2 33.0705 34.0 33.0 34.0 33.0 34.0 3 32.9855 34.0 33.0 34.0 32.0 34.0 4 32.99 34.0 33.0 34.0 33.0 34.0 5 33.0585 34.0 33.0 34.0 33.0 34.0 6 37.24475 38.0 38.0 38.0 37.0 38.0 7 37.196 38.0 38.0 38.0 37.0 38.0 8 37.16 38.0 38.0 38.0 37.0 38.0 9 37.09275 38.0 38.0 38.0 37.0 38.0 10-14 37.03349999999999 38.0 38.0 38.0 36.6 38.0 15-19 36.9078 38.0 38.0 38.0 36.6 38.0 20-24 36.7235 38.0 38.0 38.0 35.6 38.0 25-29 36.6417 38.0 38.0 38.0 35.2 38.0 30-34 36.9029 38.0 38.0 38.0 36.6 38.0 35-39 36.84525 38.0 38.0 38.0 35.8 38.0 40-44 35.759499999999996 38.0 36.2 38.0 31.6 38.0 45-49 36.5908 38.0 37.4 38.0 34.8 38.0 50-54 36.905649999999994 38.0 38.0 38.0 36.6 38.0 55-59 36.872550000000004 38.0 38.0 38.0 36.4 38.0 60-64 35.4765 38.0 35.4 38.0 30.6 38.0 65-69 35.773450000000004 38.0 36.4 38.0 30.8 38.0 70-74 34.885749999999994 38.0 34.6 38.0 27.8 38.0 75-79 36.32785 38.0 38.0 38.0 34.4 38.0 80-84 36.309 38.0 38.0 38.0 34.2 38.0 85-89 36.14515 38.0 38.0 38.0 33.8 38.0 90-94 36.46965 38.0 38.0 38.0 34.6 38.0 95-99 36.5619 38.0 38.0 38.0 34.8 38.0 100-104 36.54475 38.0 38.0 38.0 35.0 38.0 105-109 36.33355 38.0 38.0 38.0 34.2 38.0 110-114 36.277300000000004 38.0 38.0 38.0 34.0 38.0 115-119 36.056 38.0 38.0 38.0 33.8 38.0 120-124 35.36295 38.0 36.8 38.0 30.2 38.0 125-129 35.35315000000001 38.0 36.2 38.0 29.6 38.0 130-134 35.72855 38.0 37.8 38.0 33.0 38.0 135-139 35.40265 38.0 36.4 38.0 31.0 38.0 140-144 35.18345000000001 38.0 36.0 38.0 31.0 38.0 145-149 34.80985 38.0 36.0 38.0 30.0 38.0 150-151 29.99275 35.5 28.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 5.0 4 5.0 5 2.0 6 2.0 7 2.0 8 0.0 9 0.0 10 2.0 11 3.0 12 3.0 13 4.0 14 1.0 15 2.0 16 1.0 17 1.0 18 2.0 19 2.0 20 3.0 21 4.0 22 10.0 23 2.0 24 15.0 25 12.0 26 15.0 27 21.0 28 31.0 29 32.0 30 44.0 31 56.0 32 81.0 33 86.0 34 130.0 35 271.0 36 659.0 37 2474.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.925 18.4 12.075 30.599999999999998 2 29.4 23.875 25.974999999999998 20.75 3 22.15 25.874999999999996 28.549999999999997 23.425 4 25.724999999999998 32.0 20.349999999999998 21.925 5 27.125 33.85 19.400000000000002 19.625 6 23.425 34.8 21.3 20.474999999999998 7 22.5 19.925 34.0 23.575 8 25.174999999999997 22.625 24.125 28.075 9 22.425 23.075000000000003 27.150000000000002 27.35 10-14 25.115 26.625 23.24 25.019999999999996 15-19 25.145 25.515 24.474999999999998 24.865000000000002 20-24 25.124999999999996 26.61 24.215 24.05 25-29 26.165 25.56 24.11 24.165 30-34 25.35 25.72 25.169999999999998 23.76 35-39 25.69 26.07 23.965 24.275 40-44 25.645 25.345000000000002 24.529999999999998 24.48 45-49 25.2 25.585 24.775 24.44 50-54 25.424999999999997 26.179999999999996 24.325 24.07 55-59 26.1 25.124999999999996 24.62 24.154999999999998 60-64 25.069999999999997 25.915 24.709999999999997 24.305 65-69 26.08 25.564999999999998 24.51 23.845 70-74 25.865 25.39 25.145 23.599999999999998 75-79 25.665 25.615 24.975 23.745 80-84 26.125 25.555 24.735 23.585 85-89 25.35 25.415 25.009999999999998 24.224999999999998 90-94 25.755 25.729999999999997 24.68 23.835 95-99 25.77 25.314999999999998 25.165 23.75 100-104 25.915 25.155 25.185000000000002 23.745 105-109 25.215 25.715 25.124999999999996 23.945 110-114 26.02 25.915 24.925 23.14 115-119 26.41 25.75 24.57 23.27 120-124 26.584999999999997 25.685000000000002 24.21 23.52 125-129 26.245 25.94 25.064999999999998 22.75 130-134 26.224999999999998 25.724999999999998 24.345 23.705000000000002 135-139 26.235000000000003 25.685000000000002 24.58 23.5 140-144 26.314999999999998 26.085 24.34 23.26 145-149 26.595000000000002 26.25 24.224999999999998 22.93 150-151 26.1 26.825 24.375 22.7 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.5 25 0.5 26 0.0 27 3.5 28 6.5 29 7.5 30 8.0 31 7.5 32 10.5 33 11.5 34 18.5 35 32.5 36 37.0 37 48.0 38 86.0 39 114.0 40 134.5 41 143.5 42 144.0 43 171.5 44 187.0 45 180.5 46 189.5 47 203.0 48 198.5 49 182.0 50 174.5 51 162.0 52 133.5 53 120.0 54 105.0 55 90.0 56 86.0 57 88.5 58 90.5 59 91.5 60 87.5 61 83.0 62 79.0 63 62.5 64 57.5 65 55.0 66 53.0 67 49.5 68 37.0 69 34.5 70 26.5 71 22.0 72 26.0 73 19.0 74 10.5 75 8.0 76 6.0 77 2.5 78 2.0 79 3.0 80 1.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11526794742164 98.02499999999999 2 0.6825075834175935 1.35 3 0.1769464105156724 0.525 4 0.02527805864509606 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.5249999999999999 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 1.0125 0.0 0.0 0.0 0.0 120-121 1.0750000000000002 0.0 0.0 0.0 0.0 122-123 1.3125 0.0 0.0 0.0 0.0 124-125 1.625 0.0 0.0 0.0 0.0 126-127 1.7875 0.0 0.0 0.0 0.0 128-129 2.075 0.0 0.0 0.0 0.0 130-131 2.2625 0.0 0.0 0.0 0.0 132-133 2.575 0.0 0.0 0.0 0.0 134-135 2.8625 0.0 0.0 0.0 0.0 136-137 3.1500000000000004 0.0 0.0 0.0 0.0 138-139 3.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 911839 spots for SRR6958348.sra Written 911839 spots for SRR6958348.sra Read 911839 spots for SRR6958348.sra Written 911839 spots for SRR6958348.sra Read 911839 spots for SRR6958348.sra Written 911839 spots for SRR6958348.sra Read 911839 spots for SRR6958348.sra Written 911839 spots for SRR6958348.sra Read 911839 spots for SRR6958348.sra Written 911839 spots for SRR6958348.sra Read 911839 spots for SRR6958348.sra Written 911839 spots for SRR6958348.sra Read 911839 spots for SRR6958348.sra Written 911839 spots for SRR6958348.sra Read 911839 spots for SRR6958348.sra Written 911839 spots for SRR6958348.sra Read 911839 spots for SRR6958348.sra Written 911839 spots for SRR6958348.sra Read 911839 spots for SRR6958348.sra Written 911839 spots for SRR6958348.sra Read 911839 spots for SRR6958348.sra Written 911839 spots for SRR6958348.sra Read 911839 spots for SRR6958348.sra Written 911839 spots for SRR6958348.sra Read 911839 spots for SRR6958348.sra Written 911839 spots for SRR6958348.sra Read 911839 spots for SRR6958348.sra Written 911839 spots for SRR6958348.sra Read 911839 spots for SRR6958348.sra Written 911839 spots for SRR6958348.sra Read 911839 spots for SRR6958348.sra Written 911839 spots for SRR6958348.sra Read 911839 spots for SRR6958348.sra Written 911839 spots for SRR6958348.sra Read 911843 spots for SRR6958348.sra Written 911843 spots for SRR6958348.sra Read 911839 spots for SRR6958348.sra Written 911839 spots for SRR6958348.sra Read 911839 spots for SRR6958348.sra Written 911839 spots for SRR6958348.sra SRR ids: ['SRR6958348.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_65vl6gkd SRR6958348.sra spots: 18236784 blocks: [[1, 911839], [911840, 1823678], [1823679, 2735517], [2735518, 3647356], [3647357, 4559195], [4559196, 5471034], [5471035, 6382873], [6382874, 7294712], [7294713, 8206551], [8206552, 9118390], [9118391, 10030229], [10030230, 10942068], [10942069, 11853907], [11853908, 12765746], [12765747, 13677585], [13677586, 14589424], [14589425, 15501263], [15501264, 16413102], [16413103, 17324941], [17324942, 18236784]] SRR6958348 file size 6158147 SRR6958348 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958348 SRR6958348_1.fastq SRR6958348_2.fastq Input file: SRR6958348_1.fastq Paired file: SRR6958348_2.fastq trimmed: SRR6958348-trimmed-pair1.fastq, SRR6958348-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:34:50 2024 >> started Fri Dec 6 20:35:10 2024 >> done (19.263s) 18236784 read pairs processed; of these: 20152 ( 0.11%) short read pairs filtered out after trimming by size control 17741 ( 0.10%) empty read pairs filtered out after trimming by size control 18198891 (99.79%) read pairs available; of these: 6606717 (36.30%) trimmed read pairs available after processing 11592174 (63.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 0 0.00% 21 5 0.00% 22 3 0.00% 23 3 0.00% 24 7 0.00% 25 2 0.00% 26 6 0.00% 27 3 0.00% 28 3 0.00% 29 5 0.00% 30 4 0.00% 31 3 0.00% 32 3 0.00% 33 7 0.00% 34 5 0.00% 35 6 0.00% 36 10 0.00% 37 4 0.00% 38 4 0.00% 39 6 0.00% 40 6 0.00% 41 6 0.00% 42 8 0.00% 43 6 0.00% 44 3 0.00% 45 7 0.00% 46 13 0.00% 47 17 0.00% 48 19 0.00% 49 20 0.00% 50 14 0.00% 51 25 0.00% 52 19 0.00% 53 26 0.00% 54 23 0.00% 55 22 0.00% 56 37 0.00% 57 48 0.00% 58 42 0.00% 59 42 0.00% 60 50 0.00% 61 70 0.00% 62 68 0.00% 63 63 0.00% 64 84 0.00% 65 85 0.00% 66 120 0.00% 67 140 0.00% 68 128 0.00% 69 170 0.00% 70 202 0.00% 71 202 0.00% 72 258 0.00% 73 294 0.00% 74 317 0.00% 75 363 0.00% 76 421 0.00% 77 501 0.00% 78 499 0.00% 79 575 0.00% 80 661 0.00% 81 804 0.00% 82 882 0.00% 83 1124 0.01% 84 2087 0.01% 85 2659 0.01% 86 2669 0.01% 87 2615 0.01% 88 2831 0.02% 89 2920 0.02% 90 3159 0.02% 91 3260 0.02% 92 3445 0.02% 93 3801 0.02% 94 4000 0.02% 95 4237 0.02% 96 4532 0.02% 97 4712 0.03% 98 4865 0.03% 99 5374 0.03% 100 5820 0.03% 101 6185 0.03% 102 6838 0.04% 103 7421 0.04% 104 7908 0.04% 105 8343 0.05% 106 8854 0.05% 107 9238 0.05% 108 9694 0.05% 109 10388 0.06% 110 10854 0.06% 111 11617 0.06% 112 12372 0.07% 113 13399 0.07% 114 14065 0.08% 115 15064 0.08% 116 15947 0.09% 117 16509 0.09% 118 16912 0.09% 119 17492 0.10% 120 18275 0.10% 121 18892 0.10% 122 20186 0.11% 123 21466 0.12% 124 23137 0.13% 125 24304 0.13% 126 25713 0.14% 127 26396 0.15% 128 26934 0.15% 129 28212 0.16% 130 29296 0.16% 131 30810 0.17% 132 32528 0.18% 133 34950 0.19% 134 36688 0.20% 135 39182 0.22% 136 41754 0.23% 137 43270 0.24% 138 46521 0.26% 139 49954 0.27% 140 52496 0.29% 141 57676 0.32% 142 63216 0.35% 143 71258 0.39% 144 81574 0.45% 145 95751 0.53% 146 118855 0.65% 147 160644 0.88% 148 249737 1.37% 149 528194 2.90% 150 4218185 23.18% 151 11592174 63.70% 18198891 reads passed initial QC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.92 fanout-score-rank=25 prefix-density=0.95 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=56.09 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.3 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=26 prefix-density=0.68 prefix-fanout=2.4 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=98.65 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.6 sequence=CCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAGAAGAAG SRR6958348 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:35:54 Started mapping on | Dec 06 20:35:54 Finished on | Dec 06 20:37:29 Mapping speed, Million of reads per hour | 689.64 Number of input reads | 18198891 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 17660738 Uniquely mapped reads % | 97.04% Average mapped length | 297.85 Number of splices: Total | 21006854 Number of splices: Annotated (sjdb) | 19847173 Number of splices: GT/AG | 20739281 Number of splices: GC/AG | 244691 Number of splices: AT/AC | 7979 Number of splices: Non-canonical | 14903 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 122053 % of reads mapped to multiple loci | 0.67% Number of reads mapped to too many loci | 13891 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.72% % of reads unmapped: other | 0.49% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 429285 429285 429285 N_multimapping 122053 122053 122053 N_noFeature 536449 17186702 661142 N_ambiguous 415740 2364 67770 UnstrandedReadsAssigned:16708549 PositiveStrandReadsAssigned:471672 NegativeStrandReadsAssigned:16931826 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958348 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958348-trimmed-pair1.fastq SRR6958348-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,198,891 reads, 16,962,400 reads pseudoaligned [quant] estimated average fragment length: 274.327 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,159 rounds 52973 SRR6958348.ke.tsv 35125 SRR6958348.se.tsv 88098 total ==> SRR6958348.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 663.054 0 0 PNS24247 1044 770.673 45.053 5.12483 PNS24249 1928 1654.67 41.0473 2.17469 PNS24246 1044 770.673 45.053 5.12483 PNS24248 1044 770.673 45.053 5.12483 PNS24244 1471 1197.67 41.7938 3.05914 PNS24243 293 80.9084 0 0 KQK14069 1603 1329.67 3600.75 237.396 KQK14071 474 218.89 81.5569 32.6634 ==> SRR6958348.se.tsv <== BRADI_1g14170v3 4166 BRADI_1g53295v3 212 BRADI_1g59795v3 164 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 269 BRADI_1g74790v3 101 BRADI_1g09890v3 0 BRADI_1g77505v3 179 BRADI_1g48960v3 0 SRR6958348 completed mapping pipeline successfully