Starting /dee2/code/volunteer_pipeline.sh SRR6958349 current disk space = 1549418549248 free memory = 1599867764 SRR6958349 SRAfilesize a8042026982b917af54db8f358fbd323 SRR6958349.sra SRR6958349.sra file validated SRR6958349 is paired end SRR6958349 is conventional basespace SRR6958349 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958349_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.03375 33.0 28.0 33.0 2.0 34.0 2 31.32325 33.0 31.0 33.0 27.0 34.0 3 31.97275 33.0 31.0 34.0 27.0 34.0 4 32.5515 33.0 33.0 33.0 32.0 34.0 5 32.2125 33.0 33.0 34.0 31.0 34.0 6 36.366 38.0 36.0 38.0 33.0 38.0 7 37.36725 38.0 38.0 38.0 36.0 38.0 8 37.494 38.0 38.0 38.0 37.0 38.0 9 37.614 38.0 38.0 38.0 38.0 38.0 10-14 37.54485 38.0 38.0 38.0 37.8 38.0 15-19 37.57940000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.508799999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.28735 38.0 38.0 38.0 37.0 38.0 30-34 37.3121 38.0 38.0 38.0 37.0 38.0 35-39 37.61435 38.0 38.0 38.0 38.0 38.0 40-44 37.61315 38.0 38.0 38.0 38.0 38.0 45-49 37.52745 38.0 38.0 38.0 38.0 38.0 50-54 37.40239999999999 38.0 38.0 38.0 37.4 38.0 55-59 37.42665 38.0 38.0 38.0 37.0 38.0 60-64 37.4541 38.0 38.0 38.0 37.2 38.0 65-69 37.421299999999995 38.0 38.0 38.0 37.2 38.0 70-74 37.455200000000005 38.0 38.0 38.0 37.4 38.0 75-79 36.32834999999999 38.0 37.0 38.0 30.8 38.0 80-84 37.15045 38.0 38.0 38.0 36.0 38.0 85-89 36.866200000000006 38.0 38.0 38.0 35.4 38.0 90-94 36.715450000000004 38.0 38.0 38.0 34.4 38.0 95-99 36.400549999999996 38.0 38.0 38.0 33.8 38.0 100-104 36.2896 38.0 38.0 38.0 33.8 38.0 105-109 36.1982 38.0 38.0 38.0 33.6 38.0 110-114 36.1241 38.0 37.8 38.0 33.2 38.0 115-119 36.5227 38.0 38.0 38.0 34.0 38.0 120-124 36.657349999999994 38.0 38.0 38.0 34.6 38.0 125-129 36.6131 38.0 38.0 38.0 34.0 38.0 130-134 36.416650000000004 38.0 38.0 38.0 34.0 38.0 135-139 35.7746 38.0 36.6 38.0 31.8 38.0 140-144 35.5761 38.0 36.0 38.0 31.0 38.0 145-149 33.62205 38.0 33.0 38.0 22.6 38.0 150-151 29.708875 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 3.0 20 0.0 21 4.0 22 2.0 23 3.0 24 5.0 25 6.0 26 11.0 27 13.0 28 16.0 29 28.0 30 46.0 31 44.0 32 74.0 33 91.0 34 143.0 35 274.0 36 694.0 37 2540.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.69444444444445 10.027777777777777 8.75 37.52777777777778 2 26.674999999999997 12.6 31.05 29.675 3 22.900000000000002 16.675 22.525000000000002 37.9 4 27.224999999999998 22.075 21.925 28.775000000000002 5 26.400000000000002 27.675 23.425 22.5 6 22.6 30.349999999999998 24.7 22.35 7 17.45 24.05 39.525 18.975 8 20.3 25.074999999999996 27.800000000000004 26.825 9 20.150000000000002 22.55 33.45 23.849999999999998 10-14 22.895 25.69 26.284999999999997 25.130000000000003 15-19 23.29 25.15 25.955000000000002 25.605 20-24 23.105 25.215 26.240000000000002 25.44 25-29 23.200000000000003 24.985 25.745 26.07 30-34 22.86 25.064999999999998 26.505000000000003 25.569999999999997 35-39 23.830000000000002 24.935 25.669999999999998 25.564999999999998 40-44 23.68 24.69 25.45 26.179999999999996 45-49 23.400000000000002 25.745 25.474999999999998 25.380000000000003 50-54 23.635 25.535000000000004 24.985 25.845000000000002 55-59 23.494999999999997 24.8 26.19 25.515 60-64 23.585 24.665 25.674999999999997 26.075 65-69 23.595 25.46 25.290000000000003 25.655 70-74 23.575 24.795 25.585 26.045 75-79 23.71 24.75 25.97 25.569999999999997 80-84 23.76 24.72 25.974999999999998 25.545 85-89 24.175 25.040000000000003 24.865000000000002 25.919999999999998 90-94 23.485 25.135 25.619999999999997 25.759999999999998 95-99 23.445 24.615000000000002 26.06 25.88 100-104 23.435 25.285000000000004 25.380000000000003 25.900000000000002 105-109 23.195 24.64 25.790000000000003 26.375 110-114 23.935000000000002 24.805 25.564999999999998 25.695 115-119 24.055 24.68 25.4 25.865 120-124 23.895 24.975 25.445 25.685000000000002 125-129 23.775 25.21 25.15 25.865 130-134 23.724999999999998 25.47 25.31 25.495 135-139 23.97 24.975 24.959999999999997 26.095000000000002 140-144 24.46 25.130000000000003 24.834999999999997 25.575 145-149 23.97 25.16 25.374999999999996 25.495 150-151 24.3625 23.375 26.487500000000004 25.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 0.5 28 3.0 29 5.5 30 6.0 31 7.5 32 13.0 33 14.5 34 19.0 35 35.0 36 45.5 37 51.0 38 75.0 39 105.0 40 127.5 41 146.0 42 168.0 43 192.0 44 198.5 45 202.0 46 213.0 47 218.0 48 212.0 49 191.0 50 169.0 51 145.5 52 125.0 53 113.5 54 105.5 55 93.0 56 79.5 57 71.5 58 67.0 59 73.5 60 82.0 61 78.5 62 67.0 63 61.0 64 58.0 65 58.0 66 53.5 67 45.5 68 44.0 69 43.5 70 35.0 71 25.5 72 18.5 73 11.0 74 6.5 75 6.0 76 5.5 77 3.5 78 1.0 79 1.0 80 1.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06636386575826 98.15 2 0.9336361342417362 1.8499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0125 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.0 0.025 0.0 0.0 0.0 80-81 0.0 0.025 0.0 0.0 0.0 82-83 0.0 0.025 0.0 0.0 0.0 84-85 0.0 0.025 0.0 0.0 0.0 86-87 0.025 0.025 0.0 0.0 0.0 88-89 0.025 0.025 0.0 0.0 0.0 90-91 0.05 0.025 0.0 0.0 0.0 92-93 0.07500000000000001 0.025 0.0 0.0 0.0 94-95 0.1 0.025 0.0 0.0 0.0 96-97 0.1 0.025 0.0 0.0 0.0 98-99 0.125 0.025 0.0 0.0 0.0 100-101 0.2 0.025 0.0 0.0 0.0 102-103 0.2625 0.025 0.0 0.0 0.0 104-105 0.36250000000000004 0.025 0.0 0.0 0.0 106-107 0.4 0.025 0.0 0.0 0.0 108-109 0.55 0.025 0.0 0.0 0.0 110-111 0.7 0.025 0.0 0.0 0.0 112-113 0.8125 0.025 0.0 0.0 0.0 114-115 1.0 0.025 0.0 0.0 0.0 116-117 1.1375 0.025 0.0 0.0 0.0 118-119 1.2625 0.025 0.0 0.0 0.0 120-121 1.4874999999999998 0.025 0.0 0.0 0.0 122-123 1.725 0.025 0.0 0.0 0.0 124-125 2.0250000000000004 0.025 0.0 0.0 0.0 126-127 2.3499999999999996 0.025 0.0 0.0 0.0 128-129 2.625 0.025 0.0 0.0 0.0 130-131 2.9625 0.025 0.0 0.0 0.0 132-133 3.2375 0.025 0.0 0.0 0.0 134-135 3.425 0.025 0.0 0.0 0.0 136-137 3.9000000000000004 0.025 0.0 0.0 0.0 138-139 4.4 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGGCTA 10 0.006841402 144.925 2 CGGCTAT 10 0.006841402 144.925 3 >>END_MODULE SRR6958349 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958349_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0475 33.0 33.0 34.0 32.0 34.0 2 33.119 34.0 33.0 34.0 32.0 34.0 3 33.25825 34.0 33.0 34.0 33.0 34.0 4 33.22125 34.0 33.0 34.0 33.0 34.0 5 33.20225 34.0 33.0 34.0 33.0 34.0 6 37.3025 38.0 38.0 38.0 37.0 38.0 7 37.30125 38.0 38.0 38.0 37.0 38.0 8 37.30875 38.0 38.0 38.0 37.0 38.0 9 37.41725 38.0 38.0 38.0 37.0 38.0 10-14 37.189899999999994 38.0 38.0 38.0 37.2 38.0 15-19 37.11015 38.0 38.0 38.0 37.0 38.0 20-24 37.06055 38.0 38.0 38.0 37.0 38.0 25-29 37.15875 38.0 38.0 38.0 37.0 38.0 30-34 37.32445 38.0 38.0 38.0 38.0 38.0 35-39 37.3853 38.0 38.0 38.0 38.0 38.0 40-44 37.3835 38.0 38.0 38.0 38.0 38.0 45-49 37.2672 38.0 38.0 38.0 37.4 38.0 50-54 37.0227 38.0 38.0 38.0 36.4 38.0 55-59 37.071799999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.07465 38.0 38.0 38.0 36.8 38.0 65-69 37.014700000000005 38.0 38.0 38.0 36.8 38.0 70-74 36.90865 38.0 38.0 38.0 36.2 38.0 75-79 36.727 38.0 38.0 38.0 35.4 38.0 80-84 36.5202 38.0 38.0 38.0 34.4 38.0 85-89 36.25365 38.0 38.0 38.0 33.8 38.0 90-94 36.6793 38.0 38.0 38.0 35.0 38.0 95-99 36.762299999999996 38.0 38.0 38.0 35.0 38.0 100-104 36.73715000000001 38.0 38.0 38.0 35.0 38.0 105-109 36.716150000000006 38.0 38.0 38.0 35.0 38.0 110-114 36.54765 38.0 38.0 38.0 34.8 38.0 115-119 34.275099999999995 37.6 33.0 38.0 26.2 38.0 120-124 32.8483 36.8 28.6 38.0 22.4 38.0 125-129 34.95825 38.0 35.4 38.0 28.2 38.0 130-134 33.9387 38.0 33.2 38.0 23.4 38.0 135-139 30.33295 34.0 24.8 38.0 16.6 38.0 140-144 34.7802 38.0 35.2 38.0 28.8 38.0 145-149 34.142450000000004 38.0 35.2 38.0 25.0 38.0 150-151 28.393 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 3.0 5 1.0 6 0.0 7 0.0 8 1.0 9 1.0 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 0.0 16 3.0 17 1.0 18 5.0 19 2.0 20 2.0 21 4.0 22 4.0 23 9.0 24 11.0 25 13.0 26 15.0 27 20.0 28 31.0 29 36.0 30 33.0 31 66.0 32 72.0 33 118.0 34 199.0 35 377.0 36 958.0 37 1999.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.775 18.95 12.1 33.175 2 29.375 23.799999999999997 27.3 19.525000000000002 3 22.75 25.75 26.724999999999998 24.775 4 26.724999999999998 29.375 20.5 23.400000000000002 5 27.150000000000002 33.275 19.775000000000002 19.8 6 24.45 34.9 19.650000000000002 21.0 7 22.175 20.0 34.1 23.724999999999998 8 24.725 23.549999999999997 23.200000000000003 28.525 9 23.200000000000003 22.725 26.775 27.3 10-14 26.52 25.575 23.32 24.585 15-19 25.724999999999998 25.88 23.990000000000002 24.404999999999998 20-24 25.25 25.61 24.425 24.715 25-29 25.759999999999998 25.6 24.135 24.505 30-34 25.35 26.07 23.625 24.955 35-39 25.525 25.740000000000002 23.815 24.92 40-44 25.665 25.185000000000002 24.22 24.93 45-49 25.75 25.485000000000003 24.315 24.45 50-54 25.865 25.305 24.21 24.62 55-59 25.845000000000002 25.505 23.765 24.884999999999998 60-64 25.555 25.180000000000003 24.455 24.81 65-69 26.41 24.925 24.560000000000002 24.104999999999997 70-74 25.72 25.695 23.82 24.765 75-79 25.564999999999998 25.47 24.415 24.55 80-84 26.21 25.215 23.805 24.77 85-89 25.745 25.09 24.82 24.345 90-94 26.025 25.345000000000002 24.135 24.495 95-99 25.814999999999998 25.31 24.235 24.64 100-104 26.445 25.14 23.805 24.610000000000003 105-109 26.009999999999998 25.34 24.64 24.01 110-114 26.135 25.580000000000002 24.115000000000002 24.169999999999998 115-119 26.75 25.619999999999997 23.995 23.635 120-124 26.400000000000002 25.8 23.97 23.830000000000002 125-129 26.08 25.759999999999998 24.485 23.674999999999997 130-134 26.119999999999997 26.1 24.07 23.71 135-139 26.179999999999996 26.13 24.48 23.21 140-144 27.065 25.75 24.349999999999998 22.835 145-149 26.590000000000003 26.22 24.205 22.985 150-151 27.325 26.325 23.0625 23.2875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.0 25 0.0 26 0.0 27 1.5 28 3.5 29 4.0 30 5.5 31 7.0 32 8.0 33 11.0 34 20.0 35 30.0 36 37.5 37 49.5 38 69.5 39 94.0 40 111.5 41 124.0 42 151.5 43 177.5 44 202.0 45 213.5 46 197.0 47 184.5 48 182.5 49 181.0 50 167.0 51 142.5 52 120.5 53 109.5 54 101.0 55 88.0 56 80.0 57 85.5 58 97.5 59 91.0 60 86.0 61 84.5 62 82.0 63 86.0 64 76.5 65 66.0 66 58.5 67 52.5 68 53.5 69 51.0 70 38.0 71 30.5 72 26.5 73 16.5 74 12.0 75 9.5 76 6.0 77 5.0 78 3.5 79 2.0 80 0.5 81 1.0 82 1.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.475 #Duplication Level Percentage of deduplicated Percentage of total 1 98.65448083269865 97.15 2 1.1678090886011678 2.3 3 0.15232292460015232 0.44999999999999996 4 0.02538715410002539 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.07500000000000001 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.36250000000000004 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.5375 0.0 0.0 0.0 0.0 110-111 0.6625 0.0 0.0 0.0 0.0 112-113 0.7875000000000001 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.1625 0.0 0.0 0.0 0.0 120-121 1.3250000000000002 0.0 0.0 0.0 0.0 122-123 1.575 0.0 0.0 0.0 0.0 124-125 1.8624999999999998 0.0 0.0 0.0 0.0 126-127 2.1375 0.0 0.0 0.0 0.0 128-129 2.3625 0.0 0.0 0.0 0.0 130-131 2.675 0.0 0.0 0.0 0.0 132-133 2.8875 0.0 0.0 0.0 0.0 134-135 3.1500000000000004 0.0 0.0 0.0 0.0 136-137 3.6 0.0 0.0 0.0 0.0 138-139 4.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGGTTT 10 0.006830828 145.0 3 GAAGGTT 10 0.006830828 145.0 2 >>END_MODULE Read 1074514 spots for SRR6958349.sra Written 1074514 spots for SRR6958349.sra Read 1074514 spots for SRR6958349.sra Written 1074514 spots for SRR6958349.sra Read 1074514 spots for SRR6958349.sra Written 1074514 spots for SRR6958349.sra Read 1074514 spots for SRR6958349.sra Written 1074514 spots for SRR6958349.sra Read 1074514 spots for SRR6958349.sra Written 1074514 spots for SRR6958349.sra Read 1074514 spots for SRR6958349.sra Written 1074514 spots for SRR6958349.sra Read 1074514 spots for SRR6958349.sra Written 1074514 spots for SRR6958349.sra Read 1074514 spots for SRR6958349.sra Written 1074514 spots for SRR6958349.sra Read 1074514 spots for SRR6958349.sra Written 1074514 spots for SRR6958349.sra Read 1074514 spots for SRR6958349.sra Written 1074514 spots for SRR6958349.sra Read 1074514 spots for SRR6958349.sra Written 1074514 spots for SRR6958349.sra Read 1074514 spots for SRR6958349.sra Written 1074514 spots for SRR6958349.sra Read 1074514 spots for SRR6958349.sra Written 1074514 spots for SRR6958349.sra Read 1074514 spots for SRR6958349.sra Written 1074514 spots for SRR6958349.sra Read 1074514 spots for SRR6958349.sra Written 1074514 spots for SRR6958349.sra Read 1074514 spots for SRR6958349.sra Written 1074514 spots for SRR6958349.sra Read 1074514 spots for SRR6958349.sra Written 1074514 spots for SRR6958349.sra Read 1074523 spots for SRR6958349.sra Written 1074523 spots for SRR6958349.sra Read 1074514 spots for SRR6958349.sra Written 1074514 spots for SRR6958349.sra Read 1074514 spots for SRR6958349.sra Written 1074514 spots for SRR6958349.sra SRR ids: ['SRR6958349.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7zhgr9m1 SRR6958349.sra spots: 21490289 blocks: [[1, 1074514], [1074515, 2149028], [2149029, 3223542], [3223543, 4298056], [4298057, 5372570], [5372571, 6447084], [6447085, 7521598], [7521599, 8596112], [8596113, 9670626], [9670627, 10745140], [10745141, 11819654], [11819655, 12894168], [12894169, 13968682], [13968683, 15043196], [15043197, 16117710], [16117711, 17192224], [17192225, 18266738], [18266739, 19341252], [19341253, 20415766], [20415767, 21490289]] SRR6958349 file size 7260653 SRR6958349 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958349 SRR6958349_1.fastq SRR6958349_2.fastq Input file: SRR6958349_1.fastq Paired file: SRR6958349_2.fastq trimmed: SRR6958349-trimmed-pair1.fastq, SRR6958349-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:35:40 2024 >> started Fri Dec 6 20:36:06 2024 >> done (25.510s) 21490289 read pairs processed; of these: 15847 ( 0.07%) short read pairs filtered out after trimming by size control 12054 ( 0.06%) empty read pairs filtered out after trimming by size control 21462388 (99.87%) read pairs available; of these: 7091741 (33.04%) trimmed read pairs available after processing 14370647 (66.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 4 0.00% 21 9 0.00% 22 8 0.00% 23 2 0.00% 24 4 0.00% 25 7 0.00% 26 4 0.00% 27 7 0.00% 28 5 0.00% 29 5 0.00% 30 9 0.00% 31 8 0.00% 32 7 0.00% 33 6 0.00% 34 10 0.00% 35 9 0.00% 36 4 0.00% 37 11 0.00% 38 9 0.00% 39 12 0.00% 40 9 0.00% 41 12 0.00% 42 14 0.00% 43 12 0.00% 44 20 0.00% 45 13 0.00% 46 18 0.00% 47 17 0.00% 48 15 0.00% 49 19 0.00% 50 22 0.00% 51 32 0.00% 52 40 0.00% 53 40 0.00% 54 34 0.00% 55 48 0.00% 56 55 0.00% 57 67 0.00% 58 59 0.00% 59 55 0.00% 60 90 0.00% 61 94 0.00% 62 97 0.00% 63 110 0.00% 64 147 0.00% 65 153 0.00% 66 171 0.00% 67 189 0.00% 68 175 0.00% 69 274 0.00% 70 300 0.00% 71 320 0.00% 72 378 0.00% 73 443 0.00% 74 545 0.00% 75 554 0.00% 76 695 0.00% 77 717 0.00% 78 823 0.00% 79 928 0.00% 80 1059 0.00% 81 1171 0.01% 82 1405 0.01% 83 1721 0.01% 84 2483 0.01% 85 3233 0.02% 86 3308 0.02% 87 3658 0.02% 88 3820 0.02% 89 3949 0.02% 90 4164 0.02% 91 4400 0.02% 92 4970 0.02% 93 5383 0.03% 94 6004 0.03% 95 6380 0.03% 96 6745 0.03% 97 7341 0.03% 98 7766 0.04% 99 8268 0.04% 100 8826 0.04% 101 9682 0.05% 102 10355 0.05% 103 11102 0.05% 104 12073 0.06% 105 12659 0.06% 106 13709 0.06% 107 14446 0.07% 108 15138 0.07% 109 16081 0.07% 110 16683 0.08% 111 17874 0.08% 112 19066 0.09% 113 20316 0.09% 114 21471 0.10% 115 23282 0.11% 116 24005 0.11% 117 24923 0.12% 118 25784 0.12% 119 27106 0.13% 120 27821 0.13% 121 28966 0.13% 122 30105 0.14% 123 32420 0.15% 124 33597 0.16% 125 35166 0.16% 126 36702 0.17% 127 38052 0.18% 128 39485 0.18% 129 41066 0.19% 130 42762 0.20% 131 44169 0.21% 132 46593 0.22% 133 48683 0.23% 134 50970 0.24% 135 53568 0.25% 136 56042 0.26% 137 58440 0.27% 138 61437 0.29% 139 64955 0.30% 140 67921 0.32% 141 73101 0.34% 142 79487 0.37% 143 87759 0.41% 144 98936 0.46% 145 112949 0.53% 146 134642 0.63% 147 173741 0.81% 148 255330 1.19% 149 515534 2.40% 150 4181579 19.48% 151 14370647 66.96% 21462388 reads passed initial QC criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=17 prefix-density=0.93 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=47.75 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=8.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=3.70 fanout-score-rank=13 prefix-density=0.61 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=56.84 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=5.7 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958349 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:36:48 Started mapping on | Dec 06 20:36:48 Finished on | Dec 06 20:38:44 Mapping speed, Million of reads per hour | 666.07 Number of input reads | 21462388 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20952813 Uniquely mapped reads % | 97.63% Average mapped length | 297.31 Number of splices: Total | 23769699 Number of splices: Annotated (sjdb) | 22341199 Number of splices: GT/AG | 23468387 Number of splices: GC/AG | 276962 Number of splices: AT/AC | 8830 Number of splices: Non-canonical | 15520 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 124446 % of reads mapped to multiple loci | 0.58% Number of reads mapped to too many loci | 14844 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.29% % of reads unmapped: other | 0.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 396031 396031 396031 N_multimapping 124446 124446 124446 N_noFeature 669107 20334774 844955 N_ambiguous 520948 2744 79937 UnstrandedReadsAssigned:19762758 PositiveStrandReadsAssigned:615295 NegativeStrandReadsAssigned:20027921 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958349 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958349-trimmed-pair1.fastq SRR6958349-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,462,388 reads, 20,028,120 reads pseudoaligned [quant] estimated average fragment length: 266.631 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,235 rounds 52973 SRR6958349.ke.tsv 35125 SRR6958349.se.tsv 88098 total ==> SRR6958349.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 671.013 0 0 PNS24247 1044 778.369 57.5079 5.47899 PNS24249 1928 1662.37 36.5481 1.6304 PNS24246 1044 778.369 57.5079 5.47899 PNS24248 1044 778.369 57.5079 5.47899 PNS24244 1471 1205.37 47.9283 2.9487 PNS24243 293 86.642 0 0 KQK14069 1603 1337.37 6130.49 339.94 KQK14071 474 226.704 110.061 36.0024 ==> SRR6958349.se.tsv <== BRADI_1g14170v3 6916 BRADI_1g53295v3 315 BRADI_1g59795v3 198 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 348 BRADI_1g74790v3 92 BRADI_1g09890v3 0 BRADI_1g77505v3 240 BRADI_1g48960v3 0 SRR6958349 completed mapping pipeline successfully