Starting /dee2/code/volunteer_pipeline.sh SRR6958350 current disk space = 1549386711040 free memory = 1600405980 SRR6958350 SRAfilesize 80bbcd680f2d4da26ab7b3a9219a47e3 SRR6958350.sra SRR6958350.sra file validated SRR6958350 is paired end SRR6958350 is conventional basespace SRR6958350 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958350_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.0415 18.0 18.0 28.0 18.0 32.0 2 22.54125 18.0 18.0 27.0 18.0 31.0 3 28.0065 28.0 27.0 31.0 25.0 33.0 4 30.875 32.0 32.0 33.0 27.0 33.0 5 32.31075 33.0 32.0 33.0 32.0 33.0 6 35.97525 37.0 36.0 38.0 33.0 38.0 7 37.19525 38.0 38.0 38.0 36.0 38.0 8 37.522 38.0 38.0 38.0 37.0 38.0 9 37.47625 38.0 38.0 38.0 37.0 38.0 10-14 37.391000000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.378600000000006 38.0 38.0 38.0 36.8 38.0 20-24 37.38205000000001 38.0 38.0 38.0 37.0 38.0 25-29 36.90845 38.0 38.0 38.0 35.0 38.0 30-34 37.3814 38.0 38.0 38.0 37.0 38.0 35-39 37.352799999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.2594 38.0 38.0 38.0 36.8 38.0 45-49 37.19840000000001 38.0 38.0 38.0 36.6 38.0 50-54 37.18815 38.0 38.0 38.0 36.6 38.0 55-59 37.2685 38.0 38.0 38.0 36.8 38.0 60-64 37.32285 38.0 38.0 38.0 37.0 38.0 65-69 37.30895 38.0 38.0 38.0 36.8 38.0 70-74 37.2273 38.0 38.0 38.0 36.6 38.0 75-79 37.2658 38.0 38.0 38.0 36.6 38.0 80-84 37.1823 38.0 38.0 38.0 36.2 38.0 85-89 36.85435 38.0 38.0 38.0 35.2 38.0 90-94 35.79685 38.0 37.0 38.0 30.8 38.0 95-99 35.85025 38.0 36.8 38.0 31.2 38.0 100-104 35.648849999999996 38.0 36.8 38.0 30.0 38.0 105-109 35.7573 38.0 37.0 38.0 30.8 38.0 110-114 35.73055 38.0 36.8 38.0 31.0 38.0 115-119 36.17975 38.0 37.4 38.0 33.4 38.0 120-124 36.396950000000004 38.0 38.0 38.0 33.8 38.0 125-129 36.4275 38.0 38.0 38.0 34.0 38.0 130-134 36.23845 38.0 37.8 38.0 33.6 38.0 135-139 36.0933 38.0 37.2 38.0 33.2 38.0 140-144 35.02145 38.0 35.0 38.0 28.8 38.0 145-149 34.1489 38.0 34.4 38.0 26.4 38.0 150-151 31.091875 36.5 30.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 2.0 20 1.0 21 1.0 22 2.0 23 1.0 24 4.0 25 8.0 26 11.0 27 15.0 28 32.0 29 40.0 30 48.0 31 61.0 32 85.0 33 138.0 34 197.0 35 323.0 36 831.0 37 2196.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.475405331134926 17.312448474855728 8.573784006595218 43.638362187414124 2 22.525000000000002 15.25 28.825 33.4 3 22.30846269404106 16.54982473710566 23.56034051076615 37.58137205808713 4 25.3 23.75 21.95 28.999999999999996 5 26.35 27.925 22.175 23.549999999999997 6 23.400000000000002 30.7 23.799999999999997 22.1 7 16.3 23.775 39.725 20.200000000000003 8 19.775000000000002 23.375 29.599999999999998 27.250000000000004 9 20.1 22.75 33.525 23.625 10-14 23.015 26.640000000000004 25.540000000000003 24.805 15-19 22.955000000000002 25.040000000000003 26.474999999999998 25.53 20-24 23.338500775116266 24.973746061909285 26.16892533880082 25.518827824173623 25-29 23.244999999999997 25.119999999999997 25.919999999999998 25.715 30-34 22.696134806740336 24.931246562328116 26.351317565878297 26.021301065053255 35-39 23.135 25.09 26.71 25.064999999999998 40-44 22.835 25.650000000000002 25.4 26.115 45-49 23.01 25.545 25.629999999999995 25.814999999999998 50-54 23.31 25.130000000000003 25.445 26.115 55-59 23.27232723272327 24.93249324932493 25.662566256625663 26.13261326132613 60-64 23.169999999999998 24.6 26.14 26.090000000000003 65-69 22.545 25.264999999999997 25.97 26.22 70-74 23.575 25.330000000000002 25.169999999999998 25.924999999999997 75-79 23.630000000000003 25.275 25.53 25.564999999999998 80-84 23.655 24.884999999999998 25.955000000000002 25.505 85-89 23.5 25.005 26.0 25.495 90-94 23.71 24.93 25.695 25.665 95-99 24.38 24.385 25.590000000000003 25.645 100-104 23.505000000000003 25.145 25.674999999999997 25.674999999999997 105-109 24.14 24.605 25.435000000000002 25.82 110-114 23.745 25.064999999999998 25.905 25.285000000000004 115-119 23.25 25.080000000000002 26.135 25.535000000000004 120-124 23.755000000000003 24.55 25.865 25.83 125-129 23.865 25.480000000000004 25.290000000000003 25.365 130-134 24.005000000000003 25.115 25.35 25.53 135-139 24.175 25.53 24.875 25.419999999999998 140-144 24.815 25.174999999999997 24.62 25.39 145-149 23.919999999999998 25.085 25.255 25.740000000000002 150-151 23.674999999999997 24.5 25.7625 26.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 1.5 28 2.0 29 1.5 30 4.5 31 8.0 32 8.5 33 15.5 34 22.0 35 32.5 36 47.0 37 57.0 38 73.5 39 92.5 40 125.0 41 150.5 42 162.5 43 187.5 44 212.0 45 221.0 46 227.0 47 228.5 48 207.0 49 205.0 50 173.0 51 134.0 52 136.0 53 116.5 54 95.5 55 94.5 56 98.0 57 91.5 58 75.5 59 73.0 60 78.0 61 70.0 62 54.5 63 51.0 64 59.0 65 56.5 66 45.5 67 37.0 68 37.5 69 27.5 70 18.0 71 20.5 72 19.5 73 13.0 74 9.5 75 9.0 76 6.0 77 3.0 78 2.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.025 2 0.0 3 0.15 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.015 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.01 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.025 0.0 0.0 40-41 0.0 0.0 0.025 0.0 0.0 42-43 0.0 0.0 0.025 0.0 0.0 44-45 0.0 0.0 0.025 0.0 0.0 46-47 0.0 0.0 0.025 0.0 0.0 48-49 0.0 0.0 0.025 0.0 0.0 50-51 0.0 0.0 0.025 0.0 0.0 52-53 0.0 0.0 0.025 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0 0.0 0.025 0.0 0.0 64-65 0.0 0.0 0.025 0.0 0.0 66-67 0.0 0.0 0.025 0.0 0.0 68-69 0.0 0.0 0.025 0.0 0.0 70-71 0.0 0.0 0.025 0.0 0.0 72-73 0.0 0.0 0.025 0.0 0.0 74-75 0.0 0.0 0.025 0.0 0.0 76-77 0.0 0.0 0.025 0.0 0.0 78-79 0.0 0.0 0.025 0.0 0.0 80-81 0.0 0.0 0.025 0.0 0.0 82-83 0.0 0.0 0.025 0.0 0.0 84-85 0.0 0.0 0.025 0.0 0.0 86-87 0.0 0.0 0.025 0.0 0.0 88-89 0.0 0.0 0.025 0.0 0.0 90-91 0.0125 0.0 0.025 0.0 0.0 92-93 0.037500000000000006 0.0 0.025 0.0 0.0 94-95 0.05 0.0 0.025 0.0 0.0 96-97 0.05 0.0 0.025 0.0 0.0 98-99 0.05 0.0 0.025 0.0 0.0 100-101 0.1 0.0 0.025 0.0 0.0 102-103 0.1 0.0 0.025 0.0 0.0 104-105 0.15 0.0 0.025 0.0 0.0 106-107 0.225 0.0 0.025 0.0 0.0 108-109 0.4 0.0 0.025 0.0 0.0 110-111 0.5 0.0 0.025 0.0 0.0 112-113 0.625 0.0 0.025 0.0 0.0 114-115 0.75 0.0 0.025 0.0 0.0 116-117 0.9125000000000001 0.0 0.025 0.0 0.0 118-119 0.975 0.0 0.025 0.0 0.0 120-121 1.1375 0.0 0.025 0.0 0.0 122-123 1.3875000000000002 0.0 0.025 0.0 0.0 124-125 1.55 0.0 0.025 0.0 0.0 126-127 1.8 0.0 0.025 0.0 0.0 128-129 2.0625 0.0 0.025 0.0 0.0 130-131 2.2750000000000004 0.0 0.025 0.0 0.0 132-133 2.5625 0.0 0.025 0.0 0.0 134-135 2.8499999999999996 0.0 0.025 0.0 0.0 136-137 3.1375 0.0 0.025 0.0 0.0 138-139 3.375 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958350 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958350_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05625 33.0 33.0 34.0 32.0 34.0 2 33.134 34.0 33.0 34.0 33.0 34.0 3 33.0945 34.0 33.0 34.0 32.0 34.0 4 33.11775 34.0 33.0 34.0 32.0 34.0 5 32.9575 34.0 33.0 34.0 32.0 34.0 6 37.153 38.0 38.0 38.0 37.0 38.0 7 37.19175 38.0 38.0 38.0 37.0 38.0 8 37.13725 38.0 38.0 38.0 37.0 38.0 9 37.1825 38.0 38.0 38.0 37.0 38.0 10-14 36.75825 38.0 38.0 38.0 35.0 38.0 15-19 36.72885 38.0 38.0 38.0 35.0 38.0 20-24 36.6374 38.0 38.0 38.0 35.0 38.0 25-29 36.816900000000004 38.0 38.0 38.0 35.4 38.0 30-34 36.7313 38.0 38.0 38.0 34.8 38.0 35-39 37.161950000000004 38.0 38.0 38.0 36.8 38.0 40-44 36.88255 38.0 38.0 38.0 35.2 38.0 45-49 36.344049999999996 38.0 37.6 38.0 32.4 38.0 50-54 36.241699999999994 38.0 37.0 38.0 32.0 38.0 55-59 36.37615 38.0 37.4 38.0 33.4 38.0 60-64 33.866 37.2 30.6 38.0 24.2 38.0 65-69 36.5823 38.0 37.8 38.0 34.4 38.0 70-74 35.69175 38.0 37.0 38.0 29.6 38.0 75-79 36.1028 38.0 37.8 38.0 32.4 38.0 80-84 34.43175000000001 37.8 33.8 38.0 26.0 38.0 85-89 35.72 38.0 37.2 38.0 30.4 38.0 90-94 36.18525 38.0 37.8 38.0 32.8 38.0 95-99 34.35805 37.2 31.6 38.0 28.2 38.0 100-104 36.1801 38.0 37.2 38.0 33.2 38.0 105-109 36.44155 38.0 38.0 38.0 34.4 38.0 110-114 36.01695 38.0 38.0 38.0 33.4 38.0 115-119 35.914649999999995 38.0 37.6 38.0 32.6 38.0 120-124 35.16795 38.0 36.4 38.0 28.6 38.0 125-129 34.24735 38.0 34.8 38.0 23.4 38.0 130-134 34.50595 38.0 34.8 38.0 23.8 38.0 135-139 35.2438 38.0 36.0 38.0 30.4 38.0 140-144 34.4972 38.0 34.8 38.0 25.2 38.0 145-149 34.6949 38.0 35.8 38.0 30.0 38.0 150-151 30.262125 35.5 28.5 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 3.0 5 1.0 6 0.0 7 2.0 8 0.0 9 0.0 10 1.0 11 2.0 12 0.0 13 2.0 14 2.0 15 3.0 16 5.0 17 2.0 18 5.0 19 6.0 20 3.0 21 9.0 22 9.0 23 12.0 24 16.0 25 18.0 26 17.0 27 30.0 28 34.0 29 47.0 30 64.0 31 80.0 32 100.0 33 136.0 34 192.0 35 374.0 36 884.0 37 1934.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.199999999999996 19.625 12.3 32.875 2 30.225 23.125 26.974999999999998 19.675 3 22.35 26.424999999999997 27.35 23.875 4 25.6 31.35 20.974999999999998 22.075 5 27.775 31.35 19.45 21.425 6 23.625 35.6 20.225 20.549999999999997 7 22.6 20.474999999999998 33.650000000000006 23.275000000000002 8 25.15 23.849999999999998 23.150000000000002 27.85 9 22.95 22.925 28.199999999999996 25.924999999999997 10-14 25.36 26.58 23.05 25.009999999999998 15-19 26.085 25.169999999999998 24.57 24.175 20-24 25.8 25.759999999999998 24.095 24.345 25-29 25.55 25.3 24.69 24.46 30-34 25.074999999999996 25.724999999999998 25.215 23.985 35-39 25.22 25.569999999999997 24.709999999999997 24.5 40-44 25.785000000000004 25.46 24.05 24.705 45-49 25.380000000000003 25.845000000000002 24.815 23.96 50-54 25.775 26.105 23.94 24.18 55-59 26.11 25.064999999999998 24.08 24.745 60-64 25.445 25.66 25.240000000000002 23.655 65-69 25.785000000000004 25.285000000000004 24.240000000000002 24.69 70-74 26.255 25.505 24.404999999999998 23.835 75-79 25.495 25.69 24.415 24.4 80-84 25.83 25.805 24.255 24.11 85-89 26.115 25.36 24.725 23.799999999999997 90-94 25.91 25.005 24.765 24.32 95-99 25.990000000000002 25.2 24.490000000000002 24.32 100-104 25.825 25.590000000000003 24.745 23.84 105-109 26.195 25.955000000000002 24.23 23.62 110-114 25.685000000000002 25.445 24.67 24.2 115-119 26.479999999999997 25.174999999999997 24.715 23.630000000000003 120-124 26.450000000000003 25.740000000000002 24.72 23.09 125-129 26.465 25.900000000000002 24.13 23.505000000000003 130-134 26.721336066803342 26.01130056502825 24.001200060003 23.266163308165407 135-139 26.655 25.869999999999997 24.62 22.855 140-144 26.740000000000002 26.19 24.2 22.869999999999997 145-149 26.650000000000002 25.590000000000003 24.39 23.369999999999997 150-151 26.650000000000002 26.0 24.5625 22.787499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.5 25 1.0 26 0.5 27 1.5 28 3.0 29 3.5 30 3.0 31 5.0 32 10.0 33 13.0 34 16.0 35 25.5 36 39.0 37 52.0 38 74.0 39 96.5 40 109.5 41 130.0 42 155.0 43 178.0 44 201.5 45 206.5 46 199.0 47 193.0 48 184.5 49 181.5 50 165.5 51 141.5 52 138.5 53 139.5 54 124.5 55 105.5 56 101.5 57 103.0 58 91.5 59 83.0 60 81.5 61 77.5 62 71.5 63 62.0 64 58.0 65 54.0 66 54.0 67 56.0 68 43.0 69 34.0 70 36.5 71 33.5 72 23.5 73 14.5 74 8.0 75 5.0 76 3.5 77 0.5 78 0.0 79 1.0 80 1.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09021986353298 98.02499999999999 2 0.7834217841799342 1.55 3 0.10108668182966893 0.3 4 0.0 0.0 5 0.025271670457417232 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.9624999999999999 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.4375 0.0 0.0 0.0 0.0 124-125 1.6 0.0 0.0 0.0 0.0 126-127 1.825 0.0 0.0 0.0 0.0 128-129 2.0375 0.0 0.0 0.0 0.0 130-131 2.2249999999999996 0.0 0.0 0.0 0.0 132-133 2.4875 0.0 0.0 0.0 0.0 134-135 2.8 0.0 0.0 0.0 0.0 136-137 3.1 0.0 0.0 0.0 0.0 138-139 3.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1137247 spots for SRR6958350.sra Written 1137247 spots for SRR6958350.sra Read 1137247 spots for SRR6958350.sra Written 1137247 spots for SRR6958350.sra Read 1137247 spots for SRR6958350.sra Written 1137247 spots for SRR6958350.sra Read 1137247 spots for SRR6958350.sra Written 1137247 spots for SRR6958350.sra Read 1137247 spots for SRR6958350.sra Written 1137247 spots for SRR6958350.sra Read 1137247 spots for SRR6958350.sra Written 1137247 spots for SRR6958350.sra Read 1137247 spots for SRR6958350.sra Written 1137247 spots for SRR6958350.sra Read 1137247 spots for SRR6958350.sra Written 1137247 spots for SRR6958350.sra Read 1137247 spots for SRR6958350.sra Written 1137247 spots for SRR6958350.sra Read 1137247 spots for SRR6958350.sra Written 1137247 spots for SRR6958350.sra Read 1137247 spots for SRR6958350.sra Written 1137247 spots for SRR6958350.sra Read 1137247 spots for SRR6958350.sra Written 1137247 spots for SRR6958350.sra Read 1137247 spots for SRR6958350.sra Written 1137247 spots for SRR6958350.sra Read 1137247 spots for SRR6958350.sra Written 1137247 spots for SRR6958350.sra Read 1137255 spots for SRR6958350.sra Written 1137255 spots for SRR6958350.sra Read 1137247 spots for SRR6958350.sra Written 1137247 spots for SRR6958350.sra Read 1137247 spots for SRR6958350.sra Written 1137247 spots for SRR6958350.sra Read 1137247 spots for SRR6958350.sra Written 1137247 spots for SRR6958350.sra Read 1137247 spots for SRR6958350.sra Written 1137247 spots for SRR6958350.sra Read 1137247 spots for SRR6958350.sra Written 1137247 spots for SRR6958350.sra SRR ids: ['SRR6958350.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_917u87df SRR6958350.sra spots: 22744948 blocks: [[1, 1137247], [1137248, 2274494], [2274495, 3411741], [3411742, 4548988], [4548989, 5686235], [5686236, 6823482], [6823483, 7960729], [7960730, 9097976], [9097977, 10235223], [10235224, 11372470], [11372471, 12509717], [12509718, 13646964], [13646965, 14784211], [14784212, 15921458], [15921459, 17058705], [17058706, 18195952], [18195953, 19333199], [19333200, 20470446], [20470447, 21607693], [21607694, 22744948]] SRR6958350 file size 7685816 SRR6958350 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958350 SRR6958350_1.fastq SRR6958350_2.fastq Input file: SRR6958350_1.fastq Paired file: SRR6958350_2.fastq trimmed: SRR6958350-trimmed-pair1.fastq, SRR6958350-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:40:25 2024 >> started Fri Dec 6 20:40:49 2024 >> done (24.488s) 22744948 read pairs processed; of these: 17363 ( 0.08%) short read pairs filtered out after trimming by size control 14296 ( 0.06%) empty read pairs filtered out after trimming by size control 22713289 (99.86%) read pairs available; of these: 7098071 (31.25%) trimmed read pairs available after processing 15615218 (68.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 1 0.00% 21 4 0.00% 22 2 0.00% 23 7 0.00% 24 4 0.00% 25 8 0.00% 26 6 0.00% 27 5 0.00% 28 5 0.00% 29 9 0.00% 30 5 0.00% 31 7 0.00% 32 4 0.00% 33 2 0.00% 34 6 0.00% 35 7 0.00% 36 6 0.00% 37 6 0.00% 38 8 0.00% 39 14 0.00% 40 16 0.00% 41 3 0.00% 42 8 0.00% 43 9 0.00% 44 16 0.00% 45 8 0.00% 46 11 0.00% 47 14 0.00% 48 13 0.00% 49 17 0.00% 50 22 0.00% 51 22 0.00% 52 25 0.00% 53 28 0.00% 54 31 0.00% 55 29 0.00% 56 40 0.00% 57 33 0.00% 58 33 0.00% 59 61 0.00% 60 49 0.00% 61 63 0.00% 62 69 0.00% 63 85 0.00% 64 98 0.00% 65 98 0.00% 66 117 0.00% 67 156 0.00% 68 147 0.00% 69 163 0.00% 70 196 0.00% 71 221 0.00% 72 285 0.00% 73 313 0.00% 74 355 0.00% 75 375 0.00% 76 427 0.00% 77 518 0.00% 78 552 0.00% 79 649 0.00% 80 703 0.00% 81 779 0.00% 82 957 0.00% 83 1097 0.00% 84 1951 0.01% 85 2503 0.01% 86 2588 0.01% 87 2585 0.01% 88 2862 0.01% 89 2965 0.01% 90 3046 0.01% 91 3319 0.01% 92 3451 0.02% 93 3777 0.02% 94 4150 0.02% 95 4411 0.02% 96 4918 0.02% 97 5102 0.02% 98 5758 0.03% 99 5871 0.03% 100 6561 0.03% 101 6821 0.03% 102 7243 0.03% 103 8047 0.04% 104 8564 0.04% 105 8972 0.04% 106 9873 0.04% 107 10355 0.05% 108 11023 0.05% 109 11896 0.05% 110 12271 0.05% 111 12998 0.06% 112 14050 0.06% 113 14510 0.06% 114 15770 0.07% 115 17027 0.07% 116 17933 0.08% 117 18691 0.08% 118 19767 0.09% 119 20462 0.09% 120 21862 0.10% 121 22477 0.10% 122 23451 0.10% 123 25046 0.11% 124 26464 0.12% 125 27592 0.12% 126 29019 0.13% 127 30449 0.13% 128 31976 0.14% 129 33448 0.15% 130 35221 0.16% 131 36984 0.16% 132 39008 0.17% 133 41203 0.18% 134 43322 0.19% 135 45483 0.20% 136 47969 0.21% 137 50812 0.22% 138 53443 0.24% 139 57811 0.25% 140 61873 0.27% 141 67092 0.30% 142 74362 0.33% 143 82941 0.37% 144 94629 0.42% 145 111019 0.49% 146 134977 0.59% 147 180631 0.80% 148 274648 1.21% 149 556057 2.45% 150 4415672 19.44% 151 15615218 68.75% 22713289 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=3.02 fanout-score-rank=26 prefix-density=0.76 prefix-fanout=2.8 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=166.09 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=9.6 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.19 fanout-score-rank=22 prefix-density=0.57 prefix-fanout=2.7 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=56.94 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.6 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958350 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:41:34 Started mapping on | Dec 06 20:41:34 Finished on | Dec 06 20:43:00 Mapping speed, Million of reads per hour | 950.79 Number of input reads | 22713289 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 22297135 Uniquely mapped reads % | 98.17% Average mapped length | 298.28 Number of splices: Total | 26730363 Number of splices: Annotated (sjdb) | 25160376 Number of splices: GT/AG | 26388243 Number of splices: GC/AG | 314946 Number of splices: AT/AC | 10631 Number of splices: Non-canonical | 16543 Mismatch rate per base, % | 0.08% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 162391 % of reads mapped to multiple loci | 0.71% Number of reads mapped to too many loci | 17334 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.57% % of reads unmapped: other | 0.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 264807 264807 264807 N_multimapping 162391 162391 162391 N_noFeature 668756 21677870 834437 N_ambiguous 538569 2878 86553 UnstrandedReadsAssigned:21089810 PositiveStrandReadsAssigned:616387 NegativeStrandReadsAssigned:21376145 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958350 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958350-trimmed-pair1.fastq SRR6958350-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,713,289 reads, 21,413,074 reads pseudoaligned [quant] estimated average fragment length: 275.684 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,201 rounds 52973 SRR6958350.ke.tsv 35125 SRR6958350.se.tsv 88098 total ==> SRR6958350.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 661.759 3.52895e-06 3.68655e-07 PNS24247 1044 769.316 67.4 6.0566 PNS24249 1928 1653.32 47.4401 1.98364 PNS24246 1044 769.316 67.4 6.0566 PNS24248 1044 769.316 67.4 6.0566 PNS24244 1471 1196.32 17.3599 1.00317 PNS24243 293 81.1293 0 0 KQK14069 1603 1328.32 6509.66 338.79 KQK14071 474 218.492 119.926 37.9447 ==> SRR6958350.se.tsv <== BRADI_1g14170v3 7425 BRADI_1g53295v3 240 BRADI_1g59795v3 263 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 300 BRADI_1g74790v3 121 BRADI_1g09890v3 1 BRADI_1g77505v3 252 BRADI_1g48960v3 0 SRR6958350 completed mapping pipeline successfully