Starting /dee2/code/volunteer_pipeline.sh SRR6958351 current disk space = 1549383036928 free memory = 1597092280 SRR6958351 SRAfilesize 099bb4ef3a9fc1c20370b35ac69addec SRR6958351.sra SRR6958351.sra file validated SRR6958351 is paired end SRR6958351 is conventional basespace SRR6958351 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958351_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.7135 18.0 18.0 30.0 18.0 32.0 2 29.67925 30.0 27.0 33.0 27.0 33.0 3 30.0695 31.0 29.0 33.0 25.0 33.0 4 31.325 33.0 31.0 33.0 29.0 33.0 5 32.0835 33.0 32.0 33.0 31.0 33.0 6 36.602 38.0 37.0 38.0 34.0 38.0 7 37.06275 38.0 38.0 38.0 35.0 38.0 8 37.34675 38.0 38.0 38.0 37.0 38.0 9 37.266 38.0 38.0 38.0 36.0 38.0 10-14 37.4019 38.0 38.0 38.0 37.0 38.0 15-19 37.406099999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.44515 38.0 38.0 38.0 37.0 38.0 25-29 37.37405 38.0 38.0 38.0 37.0 38.0 30-34 37.3214 38.0 38.0 38.0 37.0 38.0 35-39 37.239700000000006 38.0 38.0 38.0 36.8 38.0 40-44 37.1518 38.0 38.0 38.0 36.4 38.0 45-49 37.15135 38.0 38.0 38.0 36.4 38.0 50-54 37.133449999999996 38.0 38.0 38.0 36.0 38.0 55-59 37.013250000000006 38.0 38.0 38.0 35.8 38.0 60-64 36.931349999999995 38.0 38.0 38.0 36.0 38.0 65-69 37.0238 38.0 38.0 38.0 35.8 38.0 70-74 37.027849999999994 38.0 38.0 38.0 35.8 38.0 75-79 36.938100000000006 38.0 38.0 38.0 35.2 38.0 80-84 36.588 38.0 38.0 38.0 34.4 38.0 85-89 36.52085 38.0 38.0 38.0 33.8 38.0 90-94 36.5147 38.0 38.0 38.0 34.0 38.0 95-99 36.4793 38.0 38.0 38.0 34.0 38.0 100-104 36.27435 38.0 37.2 38.0 33.6 38.0 105-109 36.142399999999995 38.0 37.0 38.0 33.2 38.0 110-114 35.9449 38.0 37.0 38.0 32.4 38.0 115-119 35.853300000000004 38.0 36.8 38.0 31.8 38.0 120-124 35.64565 38.0 36.0 38.0 31.0 38.0 125-129 35.44595 38.0 36.0 38.0 30.6 38.0 130-134 35.2659 38.0 35.4 38.0 29.0 38.0 135-139 34.964349999999996 38.0 35.0 38.0 27.8 38.0 140-144 34.51715 38.0 35.0 38.0 26.8 38.0 145-149 33.7987 38.0 34.2 38.0 23.4 38.0 150-151 29.501 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 2.0 14 0.0 15 0.0 16 1.0 17 0.0 18 2.0 19 1.0 20 0.0 21 10.0 22 4.0 23 3.0 24 6.0 25 10.0 26 18.0 27 15.0 28 30.0 29 37.0 30 44.0 31 52.0 32 73.0 33 141.0 34 214.0 35 390.0 36 897.0 37 2048.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.9974140160331 17.584690974915958 7.08559606930437 45.33229893974657 2 18.357124968695217 12.847483095416981 36.764337590783875 32.03105434510393 3 16.8 15.625 27.875 39.7 4 22.55 25.75 22.425 29.275000000000002 5 23.692769577182887 28.946710032524393 24.143107330497873 23.217413059794847 6 24.349999999999998 31.6 22.925 21.125 7 17.549999999999997 25.525 38.1 18.825 8 19.925 24.025 30.725 25.324999999999996 9 19.8 21.925 33.550000000000004 24.725 10-14 21.884999999999998 26.68 26.655 24.779999999999998 15-19 21.92 25.869999999999997 26.375 25.835 20-24 22.55 25.974999999999998 26.185000000000002 25.290000000000003 25-29 22.125 26.145000000000003 26.179999999999996 25.55 30-34 22.03 25.935000000000002 26.490000000000002 25.545 35-39 21.86 26.05 26.345000000000002 25.745 40-44 22.005 25.715 27.32 24.959999999999997 45-49 22.509999999999998 25.405 26.255 25.83 50-54 22.52 25.919999999999998 26.43 25.130000000000003 55-59 22.97 26.145000000000003 25.979999999999997 24.905 60-64 22.955000000000002 25.85 26.165 25.03 65-69 22.06 25.929999999999996 26.305 25.705 70-74 23.005 26.235000000000003 25.865 24.895 75-79 22.455 25.455 25.995 26.095000000000002 80-84 22.6 25.374999999999996 26.745 25.28 85-89 21.955 26.255 26.119999999999997 25.669999999999998 90-94 22.85 25.695 25.505 25.95 95-99 22.96 25.515 25.985000000000003 25.540000000000003 100-104 23.44 25.635 25.995 24.93 105-109 23.21 25.64 25.935000000000002 25.215 110-114 23.035 26.035000000000004 26.3 24.63 115-119 22.18 26.450000000000003 25.650000000000002 25.72 120-124 23.465 25.814999999999998 25.814999999999998 24.905 125-129 22.81 25.53 26.47 25.19 130-134 22.98 25.685000000000002 25.895000000000003 25.44 135-139 23.119999999999997 25.540000000000003 25.44 25.900000000000002 140-144 23.24 25.924999999999997 26.1 24.735 145-149 23.315 25.44 25.8 25.445 150-151 23.49555861378706 25.234580257725508 25.84761666458151 25.42224446390592 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 1.0 28 2.5 29 5.5 30 6.5 31 10.0 32 15.0 33 19.5 34 28.0 35 42.5 36 59.0 37 66.0 38 85.5 39 112.5 40 137.5 41 174.5 42 205.0 43 213.5 44 222.0 45 241.5 46 225.0 47 206.0 48 202.5 49 182.5 50 167.0 51 153.0 52 133.0 53 114.5 54 98.5 55 89.0 56 80.5 57 80.5 58 77.0 59 67.0 60 63.5 61 49.5 62 42.0 63 44.0 64 41.0 65 40.5 66 39.0 67 34.0 68 28.0 69 20.0 70 16.5 71 14.5 72 10.5 73 7.0 74 8.5 75 5.5 76 1.0 77 1.5 78 3.0 79 3.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.325 2 0.17500000000000002 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.7875000000000001 0.0 0.0 0.0 0.0 120-121 0.9375 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.2875 0.0 0.0 0.0 0.0 126-127 1.3875 0.0 0.0 0.0 0.0 128-129 1.525 0.0 0.0 0.0 0.0 130-131 1.6875 0.0 0.0 0.0 0.0 132-133 1.8875000000000002 0.0 0.0 0.0 0.0 134-135 2.0875 0.0 0.0 0.0 0.0 136-137 2.35 0.0 0.0 0.0 0.0 138-139 2.5875000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958351 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958351_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97225 33.0 33.0 34.0 32.0 34.0 2 32.87575 34.0 33.0 34.0 32.0 34.0 3 33.0085 34.0 33.0 34.0 32.0 34.0 4 33.053 34.0 33.0 34.0 32.0 34.0 5 32.9975 34.0 33.0 34.0 32.0 34.0 6 37.1045 38.0 38.0 38.0 36.0 38.0 7 37.07825 38.0 38.0 38.0 36.0 38.0 8 37.13725 38.0 38.0 38.0 37.0 38.0 9 37.13675 38.0 38.0 38.0 37.0 38.0 10-14 37.063100000000006 38.0 38.0 38.0 36.4 38.0 15-19 36.876099999999994 38.0 38.0 38.0 35.6 38.0 20-24 37.013250000000006 38.0 38.0 38.0 36.2 38.0 25-29 37.1077 38.0 38.0 38.0 36.4 38.0 30-34 37.07355 38.0 38.0 38.0 36.2 38.0 35-39 37.1097 38.0 38.0 38.0 36.6 38.0 40-44 37.032349999999994 38.0 38.0 38.0 36.2 38.0 45-49 37.0038 38.0 38.0 38.0 36.0 38.0 50-54 36.88175 38.0 38.0 38.0 35.8 38.0 55-59 36.9172 38.0 38.0 38.0 36.0 38.0 60-64 36.83565 38.0 38.0 38.0 35.6 38.0 65-69 36.7605 38.0 38.0 38.0 35.2 38.0 70-74 36.66035000000001 38.0 38.0 38.0 34.8 38.0 75-79 36.41645 38.0 38.0 38.0 34.0 38.0 80-84 36.401300000000006 38.0 38.0 38.0 33.8 38.0 85-89 36.25885 38.0 38.0 38.0 33.6 38.0 90-94 36.26555 38.0 38.0 38.0 33.6 38.0 95-99 36.1708 38.0 37.8 38.0 33.4 38.0 100-104 35.989549999999994 38.0 37.2 38.0 33.0 38.0 105-109 35.894800000000004 38.0 37.2 38.0 32.4 38.0 110-114 35.530150000000006 38.0 36.4 38.0 30.2 38.0 115-119 35.426249999999996 38.0 36.0 38.0 30.6 38.0 120-124 35.2364 38.0 36.0 38.0 29.0 38.0 125-129 35.1659 38.0 36.0 38.0 29.2 38.0 130-134 34.731700000000004 38.0 35.2 38.0 26.6 38.0 135-139 34.3905 38.0 35.0 38.0 25.8 38.0 140-144 33.9457 38.0 34.2 38.0 23.0 38.0 145-149 33.43335 38.0 33.6 38.0 20.2 38.0 150-151 28.222375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 2.0 5 0.0 6 1.0 7 1.0 8 0.0 9 1.0 10 1.0 11 0.0 12 1.0 13 2.0 14 3.0 15 1.0 16 4.0 17 5.0 18 2.0 19 2.0 20 7.0 21 5.0 22 6.0 23 8.0 24 17.0 25 17.0 26 28.0 27 21.0 28 27.0 29 38.0 30 65.0 31 72.0 32 77.0 33 129.0 34 171.0 35 303.0 36 720.0 37 2257.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.06703351675838 16.858429214607305 13.131565782891446 35.942971485742866 2 29.15728932233058 24.006001500375092 28.532133033258315 18.30457614403601 3 21.43035758939735 27.731932983245812 27.45686421605401 23.380845211302827 4 27.45686421605401 30.057514378594647 19.904976244061015 22.58064516129032 5 28.28207051762941 32.883220805201304 19.754938734683673 19.079769942485623 6 22.95 35.975 20.95 20.125 7 22.025 19.825 35.5 22.650000000000002 8 24.875 23.825 25.3 26.0 9 22.7 23.425 28.875 25.0 10-14 25.759999999999998 25.71 24.295 24.235 15-19 25.285000000000004 26.105 25.165 23.445 20-24 25.825 26.14 24.44 23.595 25-29 25.074999999999996 25.855 24.855 24.215 30-34 24.775 25.895000000000003 25.61 23.72 35-39 25.85 25.540000000000003 24.705 23.905 40-44 25.679999999999996 25.61 25.11 23.599999999999998 45-49 25.09 26.125 25.025 23.76 50-54 25.845000000000002 26.305 24.52 23.330000000000002 55-59 26.0 26.015 24.545 23.44 60-64 25.28 26.029999999999998 24.97 23.72 65-69 25.465 26.200000000000003 25.064999999999998 23.27 70-74 25.5 25.724999999999998 25.47 23.305 75-79 25.405 25.419999999999998 25.75 23.425 80-84 25.569999999999997 25.69 25.4 23.34 85-89 25.745 25.45 25.169999999999998 23.635 90-94 25.069999999999997 26.16 25.235000000000003 23.535 95-99 24.995 26.240000000000002 25.235000000000003 23.53 100-104 25.935000000000002 25.83 25.545 22.689999999999998 105-109 25.014999999999997 25.735000000000003 25.955000000000002 23.294999999999998 110-114 25.34 25.575 25.545 23.54 115-119 25.97 26.325 25.095 22.61 120-124 25.6 26.36 24.97 23.07 125-129 26.179999999999996 25.745 25.235000000000003 22.84 130-134 26.255 26.57 24.834999999999997 22.34 135-139 25.629999999999995 26.529999999999998 25.255 22.585 140-144 26.07 26.275 25.290000000000003 22.365 145-149 26.575 26.06 24.815 22.55 150-151 26.90768076057043 26.394796097072803 24.88116087065299 21.816362271703778 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 2.0 27 3.0 28 5.5 29 8.0 30 7.5 31 8.5 32 12.0 33 17.0 34 24.0 35 31.5 36 44.0 37 59.5 38 83.0 39 105.5 40 131.5 41 153.0 42 159.5 43 190.0 44 202.0 45 212.0 46 222.5 47 209.0 48 195.0 49 177.5 50 159.5 51 144.0 52 134.0 53 124.0 54 120.5 55 102.5 56 88.0 57 93.0 58 82.5 59 72.0 60 75.0 61 74.5 62 59.0 63 49.5 64 55.0 65 44.5 66 36.5 67 37.5 68 38.0 69 34.5 70 29.0 71 22.5 72 16.5 73 14.0 74 8.5 75 5.0 76 3.0 77 2.0 78 2.5 79 3.5 80 3.0 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.025 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24318869828456 98.35000000000001 2 0.6306760847628659 1.25 3 0.10090817356205853 0.3 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 0.9125000000000001 0.0 0.0 0.0 0.0 122-123 0.9874999999999999 0.0 0.0 0.0 0.0 124-125 1.2625 0.0 0.0 0.0 0.0 126-127 1.3625 0.0 0.0 0.0 0.0 128-129 1.5 0.0 0.0 0.0 0.0 130-131 1.65 0.0 0.0 0.0 0.0 132-133 1.8624999999999998 0.0 0.0 0.0 0.0 134-135 2.0625 0.0 0.0 0.0 0.0 136-137 2.325 0.0 0.0 0.0 0.0 138-139 2.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCGATT 10 0.006830828 145.0 1 >>END_MODULE Read 938793 spots for SRR6958351.sra Written 938793 spots for SRR6958351.sra Read 938793 spots for SRR6958351.sra Written 938793 spots for SRR6958351.sra Read 938793 spots for SRR6958351.sra Written 938793 spots for SRR6958351.sra Read 938793 spots for SRR6958351.sra Written 938793 spots for SRR6958351.sra Read 938793 spots for SRR6958351.sra Written 938793 spots for SRR6958351.sra Read 938793 spots for SRR6958351.sra Written 938793 spots for SRR6958351.sra Read 938793 spots for SRR6958351.sra Written 938793 spots for SRR6958351.sra Read 938793 spots for SRR6958351.sra Written 938793 spots for SRR6958351.sra Read 938793 spots for SRR6958351.sra Written 938793 spots for SRR6958351.sra Read 938793 spots for SRR6958351.sra Written 938793 spots for SRR6958351.sra Read 938793 spots for SRR6958351.sra Written 938793 spots for SRR6958351.sra Read 938812 spots for SRR6958351.sra Written 938812 spots for SRR6958351.sra Read 938793 spots for SRR6958351.sra Written 938793 spots for SRR6958351.sra Read 938793 spots for SRR6958351.sra Written 938793 spots for SRR6958351.sra Read 938793 spots for SRR6958351.sra Written 938793 spots for SRR6958351.sra Read 938793 spots for SRR6958351.sra Written 938793 spots for SRR6958351.sra Read 938793 spots for SRR6958351.sra Written 938793 spots for SRR6958351.sra Read 938793 spots for SRR6958351.sra Written 938793 spots for SRR6958351.sra Read 938793 spots for SRR6958351.sra Written 938793 spots for SRR6958351.sra Read 938793 spots for SRR6958351.sra Written 938793 spots for SRR6958351.sra SRR ids: ['SRR6958351.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e9fcbeqm SRR6958351.sra spots: 18775879 blocks: [[1, 938793], [938794, 1877586], [1877587, 2816379], [2816380, 3755172], [3755173, 4693965], [4693966, 5632758], [5632759, 6571551], [6571552, 7510344], [7510345, 8449137], [8449138, 9387930], [9387931, 10326723], [10326724, 11265516], [11265517, 12204309], [12204310, 13143102], [13143103, 14081895], [14081896, 15020688], [15020689, 15959481], [15959482, 16898274], [16898275, 17837067], [17837068, 18775879]] SRR6958351 file size 6340828 SRR6958351 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958351 SRR6958351_1.fastq SRR6958351_2.fastq Input file: SRR6958351_1.fastq Paired file: SRR6958351_2.fastq trimmed: SRR6958351-trimmed-pair1.fastq, SRR6958351-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:41:06 2024 >> started Fri Dec 6 20:41:26 2024 >> done (20.477s) 18775879 read pairs processed; of these: 8613 ( 0.05%) short read pairs filtered out after trimming by size control 6264 ( 0.03%) empty read pairs filtered out after trimming by size control 18761002 (99.92%) read pairs available; of these: 6471931 (34.50%) trimmed read pairs available after processing 12289071 (65.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 1 0.00% 21 4 0.00% 22 4 0.00% 23 5 0.00% 24 1 0.00% 25 4 0.00% 26 6 0.00% 27 2 0.00% 28 6 0.00% 29 4 0.00% 30 3 0.00% 31 7 0.00% 32 5 0.00% 33 6 0.00% 34 5 0.00% 35 5 0.00% 36 10 0.00% 37 5 0.00% 38 4 0.00% 39 7 0.00% 40 8 0.00% 41 10 0.00% 42 8 0.00% 43 13 0.00% 44 14 0.00% 45 16 0.00% 46 15 0.00% 47 22 0.00% 48 18 0.00% 49 20 0.00% 50 22 0.00% 51 23 0.00% 52 31 0.00% 53 35 0.00% 54 29 0.00% 55 35 0.00% 56 35 0.00% 57 43 0.00% 58 43 0.00% 59 57 0.00% 60 79 0.00% 61 71 0.00% 62 86 0.00% 63 75 0.00% 64 91 0.00% 65 120 0.00% 66 137 0.00% 67 162 0.00% 68 137 0.00% 69 170 0.00% 70 169 0.00% 71 219 0.00% 72 230 0.00% 73 266 0.00% 74 306 0.00% 75 391 0.00% 76 403 0.00% 77 462 0.00% 78 462 0.00% 79 525 0.00% 80 606 0.00% 81 701 0.00% 82 802 0.00% 83 927 0.00% 84 1370 0.01% 85 1758 0.01% 86 1774 0.01% 87 1911 0.01% 88 1977 0.01% 89 2217 0.01% 90 2312 0.01% 91 2419 0.01% 92 2693 0.01% 93 2914 0.02% 94 3175 0.02% 95 3514 0.02% 96 3551 0.02% 97 3931 0.02% 98 4130 0.02% 99 4534 0.02% 100 4753 0.03% 101 5027 0.03% 102 5459 0.03% 103 5971 0.03% 104 6190 0.03% 105 6718 0.04% 106 7167 0.04% 107 7678 0.04% 108 8063 0.04% 109 8540 0.05% 110 9054 0.05% 111 9673 0.05% 112 10220 0.05% 113 10707 0.06% 114 11666 0.06% 115 12511 0.07% 116 13466 0.07% 117 13810 0.07% 118 14569 0.08% 119 15433 0.08% 120 16197 0.09% 121 16924 0.09% 122 17881 0.10% 123 19080 0.10% 124 19934 0.11% 125 21141 0.11% 126 22365 0.12% 127 23569 0.13% 128 24682 0.13% 129 26106 0.14% 130 27760 0.15% 131 29742 0.16% 132 31305 0.17% 133 33505 0.18% 134 35222 0.19% 135 37674 0.20% 136 40602 0.22% 137 43173 0.23% 138 45980 0.25% 139 50193 0.27% 140 54559 0.29% 141 60391 0.32% 142 67703 0.36% 143 76660 0.41% 144 89629 0.48% 145 110309 0.59% 146 144254 0.77% 147 193009 1.03% 148 305661 1.63% 149 646488 3.45% 150 3901182 20.79% 151 12289071 65.50% 18761002 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=3.07 fanout-score-rank=27 prefix-density=0.60 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=65.60 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.5 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.31 fanout-score-rank=25 prefix-density=0.49 prefix-fanout=2.8 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=107.57 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.7 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958351 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:42:12 Started mapping on | Dec 06 20:42:12 Finished on | Dec 06 20:43:37 Mapping speed, Million of reads per hour | 794.58 Number of input reads | 18761002 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 18509050 Uniquely mapped reads % | 98.66% Average mapped length | 298.31 Number of splices: Total | 21943933 Number of splices: Annotated (sjdb) | 20680335 Number of splices: GT/AG | 21663769 Number of splices: GC/AG | 255236 Number of splices: AT/AC | 8558 Number of splices: Non-canonical | 16370 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 118603 % of reads mapped to multiple loci | 0.63% Number of reads mapped to too many loci | 12484 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.23% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 138528 138528 138528 N_multimapping 118603 118603 118603 N_noFeature 676415 17980595 827159 N_ambiguous 445243 2395 68676 UnstrandedReadsAssigned:17387392 PositiveStrandReadsAssigned:526060 NegativeStrandReadsAssigned:17613215 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958351 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958351-trimmed-pair1.fastq SRR6958351-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,761,002 reads, 17,619,602 reads pseudoaligned [quant] estimated average fragment length: 274.467 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,181 rounds 52973 SRR6958351.ke.tsv 35125 SRR6958351.se.tsv 88098 total ==> SRR6958351.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 663.087 0 0 PNS24247 1044 770.533 56.9018 6.38866 PNS24249 1928 1654.53 41.2813 2.1585 PNS24246 1044 770.533 56.9018 6.38866 PNS24248 1044 770.533 56.9018 6.38866 PNS24244 1471 1197.53 31.0133 2.24045 PNS24243 293 77.2642 0 0 KQK14069 1603 1329.53 5282.92 343.756 KQK14071 474 215.761 68.2788 27.3771 ==> SRR6958351.se.tsv <== BRADI_1g14170v3 5901 BRADI_1g53295v3 341 BRADI_1g59795v3 217 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 260 BRADI_1g74790v3 98 BRADI_1g09890v3 0 BRADI_1g77505v3 192 BRADI_1g48960v3 0 SRR6958351 completed mapping pipeline successfully