Starting /dee2/code/volunteer_pipeline.sh SRR6958352 current disk space = 1549377277952 free memory = 1599790196 SRR6958352 SRAfilesize f6caa6792d6c50a9b700bc052ae5301c SRR6958352.sra SRR6958352.sra file validated SRR6958352 is paired end SRR6958352 is conventional basespace SRR6958352 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958352_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.9135 25.0 18.0 33.0 18.0 33.0 2 28.215 30.0 27.0 33.0 18.0 33.0 3 30.509 31.0 29.0 33.0 27.0 33.0 4 31.38875 33.0 31.0 33.0 29.0 33.0 5 32.31925 33.0 33.0 33.0 31.0 34.0 6 36.57425 38.0 37.0 38.0 34.0 38.0 7 37.518 38.0 38.0 38.0 37.0 38.0 8 37.3675 38.0 38.0 38.0 37.0 38.0 9 37.5485 38.0 38.0 38.0 37.0 38.0 10-14 37.52865 38.0 38.0 38.0 37.6 38.0 15-19 37.5265 38.0 38.0 38.0 37.8 38.0 20-24 37.63275 38.0 38.0 38.0 38.0 38.0 25-29 37.56935 38.0 38.0 38.0 37.8 38.0 30-34 37.390100000000004 38.0 38.0 38.0 37.2 38.0 35-39 37.50265 38.0 38.0 38.0 37.4 38.0 40-44 37.63455 38.0 38.0 38.0 38.0 38.0 45-49 37.6037 38.0 38.0 38.0 38.0 38.0 50-54 37.401149999999994 38.0 38.0 38.0 37.2 38.0 55-59 37.41065 38.0 38.0 38.0 37.2 38.0 60-64 37.59349999999999 38.0 38.0 38.0 37.8 38.0 65-69 37.62070000000001 38.0 38.0 38.0 38.0 38.0 70-74 37.16725 38.0 38.0 38.0 36.2 38.0 75-79 37.5249 38.0 38.0 38.0 37.4 38.0 80-84 37.4767 38.0 38.0 38.0 37.0 38.0 85-89 37.26995 38.0 38.0 38.0 36.4 38.0 90-94 36.00705000000001 38.0 37.0 38.0 31.4 38.0 95-99 36.3012 38.0 37.4 38.0 33.0 38.0 100-104 36.3292 38.0 37.6 38.0 33.6 38.0 105-109 36.4716 38.0 38.0 38.0 34.0 38.0 110-114 36.347300000000004 38.0 38.0 38.0 33.8 38.0 115-119 36.8195 38.0 38.0 38.0 34.8 38.0 120-124 36.9679 38.0 38.0 38.0 35.0 38.0 125-129 36.9166 38.0 38.0 38.0 35.0 38.0 130-134 36.86615 38.0 38.0 38.0 35.0 38.0 135-139 36.74744999999999 38.0 38.0 38.0 34.8 38.0 140-144 36.3634 38.0 38.0 38.0 34.0 38.0 145-149 35.82775 38.0 36.2 38.0 33.0 38.0 150-151 30.284625 35.5 19.0 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 1.0 18 0.0 19 0.0 20 0.0 21 1.0 22 0.0 23 3.0 24 1.0 25 7.0 26 3.0 27 6.0 28 9.0 29 17.0 30 25.0 31 32.0 32 47.0 33 90.0 34 137.0 35 264.0 36 718.0 37 2638.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.63788836953533 11.135551278526258 8.276051690954082 39.950508660984326 2 25.424999999999997 12.825000000000001 32.574999999999996 29.175 3 23.75 16.975 22.275 37.0 4 26.25 24.6 20.974999999999998 28.175 5 26.375 27.950000000000003 23.425 22.25 6 22.2 32.175 24.2 21.425 7 17.675 23.1 40.575 18.65 8 21.05 22.35 29.975 26.625 9 19.3 21.099999999999998 32.9 26.700000000000003 10-14 23.09 25.915 25.074999999999996 25.919999999999998 15-19 23.07 24.845 26.625 25.46 20-24 23.64773580185139 25.143857893420062 26.25969477107831 24.948711533650236 25-29 23.565 24.81 26.424999999999997 25.2 30-34 24.19 24.585 25.990000000000002 25.235000000000003 35-39 23.76 25.2 26.055 24.985 40-44 23.45 24.654999999999998 26.105 25.790000000000003 45-49 22.945 24.995 26.165 25.895000000000003 50-54 23.165 24.87 25.924999999999997 26.040000000000003 55-59 23.375 25.3 25.53 25.795 60-64 23.195 25.580000000000002 25.735000000000003 25.490000000000002 65-69 23.86 24.605 25.695 25.840000000000003 70-74 23.200000000000003 25.135 25.729999999999997 25.935000000000002 75-79 23.315 24.735 26.07 25.88 80-84 23.724999999999998 24.93 25.94 25.405 85-89 23.465 24.884999999999998 25.22 26.43 90-94 23.919999999999998 25.230000000000004 24.23 26.619999999999997 95-99 23.535 25.055 25.474999999999998 25.935000000000002 100-104 24.21 24.959999999999997 25.055 25.775 105-109 24.2 24.77 25.455 25.575 110-114 23.895 24.59 25.47 26.045 115-119 23.78 25.105 25.41 25.705 120-124 24.36 25.06 24.98 25.6 125-129 23.905 24.990000000000002 25.009999999999998 26.095000000000002 130-134 24.095 25.195 25.09 25.619999999999997 135-139 23.400000000000002 24.995 25.55 26.055 140-144 24.29 24.36 25.679999999999996 25.669999999999998 145-149 23.865 24.645 25.415 26.075 150-151 24.875 24.212500000000002 24.825 26.087500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 2.0 25 1.5 26 1.5 27 3.0 28 4.0 29 6.5 30 8.5 31 8.5 32 10.0 33 12.0 34 19.5 35 31.0 36 43.0 37 57.0 38 76.5 39 104.0 40 131.5 41 165.0 42 190.0 43 183.0 44 188.0 45 201.0 46 185.5 47 185.0 48 193.5 49 173.0 50 154.5 51 143.0 52 129.0 53 121.5 54 109.5 55 100.0 56 97.0 57 96.5 58 97.0 59 88.0 60 85.0 61 84.5 62 80.5 63 70.5 64 52.0 65 50.5 66 48.0 67 34.0 68 35.0 69 34.5 70 26.0 71 22.0 72 17.0 73 12.0 74 8.5 75 7.0 76 5.0 77 3.0 78 1.0 79 1.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.075 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11705348133198 98.225 2 0.8577194752774974 1.7000000000000002 3 0.025227043390514632 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.95 0.0 0.0 0.0 0.0 120-121 1.025 0.0 0.0 0.0 0.0 122-123 1.1375000000000002 0.0 0.0 0.0 0.0 124-125 1.35 0.0 0.0 0.0 0.0 126-127 1.4249999999999998 0.0 0.0 0.0 0.0 128-129 1.7 0.0 0.0 0.0 0.0 130-131 1.9375 0.0 0.0 0.0 0.0 132-133 2.2125 0.0 0.0 0.0 0.0 134-135 2.4625 0.0 0.0 0.0 0.0 136-137 2.6375 0.0 0.0 0.0 0.0 138-139 2.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGATTC 10 0.0068378756 144.95 3 >>END_MODULE SRR6958352 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958352_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2035 33.0 33.0 34.0 33.0 34.0 2 33.25375 34.0 33.0 34.0 33.0 34.0 3 33.2655 34.0 33.0 34.0 33.0 34.0 4 33.31975 34.0 33.0 34.0 33.0 34.0 5 33.1865 34.0 33.0 34.0 33.0 34.0 6 37.315 38.0 38.0 38.0 37.0 38.0 7 37.39 38.0 38.0 38.0 37.0 38.0 8 37.49425 38.0 38.0 38.0 38.0 38.0 9 37.306 38.0 38.0 38.0 37.0 38.0 10-14 37.28515 38.0 38.0 38.0 37.0 38.0 15-19 37.24375 38.0 38.0 38.0 37.0 38.0 20-24 37.31415 38.0 38.0 38.0 37.2 38.0 25-29 37.3357 38.0 38.0 38.0 37.2 38.0 30-34 37.42405000000001 38.0 38.0 38.0 37.8 38.0 35-39 37.50355 38.0 38.0 38.0 38.0 38.0 40-44 37.5369 38.0 38.0 38.0 38.0 38.0 45-49 37.438599999999994 38.0 38.0 38.0 38.0 38.0 50-54 37.395500000000006 38.0 38.0 38.0 37.4 38.0 55-59 37.119749999999996 38.0 38.0 38.0 36.6 38.0 60-64 36.700100000000006 38.0 38.0 38.0 34.8 38.0 65-69 36.9901 38.0 38.0 38.0 36.2 38.0 70-74 37.1357 38.0 38.0 38.0 36.6 38.0 75-79 37.092499999999994 38.0 38.0 38.0 36.2 38.0 80-84 36.98565000000001 38.0 38.0 38.0 35.8 38.0 85-89 36.75019999999999 38.0 38.0 38.0 35.2 38.0 90-94 36.67819999999999 38.0 38.0 38.0 34.8 38.0 95-99 37.15625 38.0 38.0 38.0 36.4 38.0 100-104 37.084950000000006 38.0 38.0 38.0 36.0 38.0 105-109 37.0276 38.0 38.0 38.0 35.6 38.0 110-114 36.98094999999999 38.0 38.0 38.0 35.8 38.0 115-119 36.73745 38.0 38.0 38.0 35.0 38.0 120-124 36.50865 38.0 38.0 38.0 34.4 38.0 125-129 34.731049999999996 38.0 35.0 38.0 26.0 38.0 130-134 36.344 38.0 38.0 38.0 34.0 38.0 135-139 36.43315 38.0 38.0 38.0 34.0 38.0 140-144 36.33605 38.0 38.0 38.0 34.0 38.0 145-149 35.980900000000005 38.0 37.8 38.0 33.0 38.0 150-151 32.279375 35.5 33.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 4.0 19 2.0 20 1.0 21 1.0 22 5.0 23 3.0 24 7.0 25 11.0 26 11.0 27 13.0 28 10.0 29 19.0 30 27.0 31 36.0 32 51.0 33 84.0 34 114.0 35 196.0 36 468.0 37 2929.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.1 17.5 11.700000000000001 33.7 2 28.725 23.150000000000002 29.45 18.675 3 22.325 25.25 27.474999999999998 24.95 4 27.35 29.025000000000002 20.375 23.25 5 26.700000000000003 32.125 20.674999999999997 20.5 6 21.45 36.3 20.5 21.75 7 22.125 19.075 34.425 24.375 8 24.375 22.900000000000002 23.7 29.025000000000002 9 23.025000000000002 22.425 27.800000000000004 26.75 10-14 26.290000000000003 25.55 23.455000000000002 24.705 15-19 25.39 25.41 24.665 24.535 20-24 25.445 26.165 24.09 24.3 25-29 24.935 25.845000000000002 24.525 24.695 30-34 25.455 25.355 24.695 24.495 35-39 25.445 25.564999999999998 24.310000000000002 24.68 40-44 25.615 25.61 24.315 24.46 45-49 25.89 25.555 24.36 24.195 50-54 26.145000000000003 25.115 24.305 24.435000000000002 55-59 26.405 25.019999999999996 24.635 23.94 60-64 25.755 25.240000000000002 24.965 24.04 65-69 25.330000000000002 25.215 24.779999999999998 24.675 70-74 26.229999999999997 25.180000000000003 24.12 24.47 75-79 26.090000000000003 25.09 24.47 24.349999999999998 80-84 25.615 25.695 24.5 24.19 85-89 26.56 25.650000000000002 23.724999999999998 24.065 90-94 26.295 25.145 24.34 24.22 95-99 26.235000000000003 24.685000000000002 24.575 24.505 100-104 25.965 24.745 25.025 24.265 105-109 25.724999999999998 25.14 24.775 24.36 110-114 26.125 25.755 24.525 23.595 115-119 26.795 25.525 23.849999999999998 23.830000000000002 120-124 26.150000000000002 25.56 24.490000000000002 23.799999999999997 125-129 25.89 25.745 24.275 24.09 130-134 27.084999999999997 25.515 23.915 23.485 135-139 26.715 26.19 23.855 23.24 140-144 26.284999999999997 25.490000000000002 24.4 23.825 145-149 26.11 25.924999999999997 24.18 23.785 150-151 26.55 26.8625 23.6125 22.975 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.0 24 1.5 25 0.5 26 1.0 27 2.0 28 2.0 29 3.0 30 5.0 31 10.0 32 11.0 33 13.0 34 17.5 35 25.5 36 32.5 37 48.5 38 77.0 39 100.0 40 129.0 41 144.0 42 164.0 43 179.0 44 178.0 45 189.0 46 190.0 47 190.5 48 184.5 49 174.5 50 157.5 51 131.5 52 122.0 53 117.0 54 105.0 55 97.5 56 93.5 57 93.0 58 95.5 59 89.5 60 87.0 61 84.5 62 86.5 63 88.0 64 73.0 65 59.5 66 53.0 67 51.5 68 49.0 69 45.0 70 41.5 71 33.5 72 24.0 73 15.5 74 11.0 75 8.0 76 4.0 77 2.5 78 2.5 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.5234215885947 96.75 2 1.2729124236252547 2.5 3 0.12729124236252545 0.375 4 0.02545824847250509 0.1 5 0.02545824847250509 0.125 6 0.02545824847250509 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit CAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.7875 0.0 0.0 0.0 0.0 118-119 0.925 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.1124999999999998 0.0 0.0 0.0 0.0 124-125 1.2999999999999998 0.0 0.0 0.0 0.0 126-127 1.375 0.0 0.0 0.0 0.0 128-129 1.65 0.0 0.0 0.0 0.0 130-131 1.8875000000000002 0.0 0.0 0.0 0.0 132-133 2.1625 0.0 0.0 0.0 0.0 134-135 2.4125 0.0 0.0 0.0 0.0 136-137 2.5875 0.0 0.0 0.0 0.0 138-139 2.9000000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCAAAG 10 0.006830828 145.0 7 TCAAAGA 10 0.006830828 145.0 8 >>END_MODULE Read 1030598 spots for SRR6958352.sra Written 1030598 spots for SRR6958352.sra Read 1030598 spots for SRR6958352.sra Written 1030598 spots for SRR6958352.sra Read 1030598 spots for SRR6958352.sra Written 1030598 spots for SRR6958352.sra Read 1030598 spots for SRR6958352.sra Written 1030598 spots for SRR6958352.sra Read 1030598 spots for SRR6958352.sra Written 1030598 spots for SRR6958352.sra Read 1030598 spots for SRR6958352.sra Written 1030598 spots for SRR6958352.sra Read 1030598 spots for SRR6958352.sra Written 1030598 spots for SRR6958352.sra Read 1030598 spots for SRR6958352.sra Written 1030598 spots for SRR6958352.sra Read 1030598 spots for SRR6958352.sra Written 1030598 spots for SRR6958352.sra Read 1030598 spots for SRR6958352.sra Written 1030598 spots for SRR6958352.sra Read 1030598 spots for SRR6958352.sra Written 1030598 spots for SRR6958352.sra Read 1030598 spots for SRR6958352.sra Written 1030598 spots for SRR6958352.sra Read 1030598 spots for SRR6958352.sra Written 1030598 spots for SRR6958352.sra Read 1030598 spots for SRR6958352.sra Written 1030598 spots for SRR6958352.sra Read 1030598 spots for SRR6958352.sra Written 1030598 spots for SRR6958352.sra Read 1030598 spots for SRR6958352.sra Written 1030598 spots for SRR6958352.sra Read 1030598 spots for SRR6958352.sra Written 1030598 spots for SRR6958352.sra Read 1030601 spots for SRR6958352.sra Written 1030601 spots for SRR6958352.sra Read 1030598 spots for SRR6958352.sra Written 1030598 spots for SRR6958352.sra Read 1030598 spots for SRR6958352.sra Written 1030598 spots for SRR6958352.sra SRR ids: ['SRR6958352.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0rzvo821 SRR6958352.sra spots: 20611963 blocks: [[1, 1030598], [1030599, 2061196], [2061197, 3091794], [3091795, 4122392], [4122393, 5152990], [5152991, 6183588], [6183589, 7214186], [7214187, 8244784], [8244785, 9275382], [9275383, 10305980], [10305981, 11336578], [11336579, 12367176], [12367177, 13397774], [13397775, 14428372], [14428373, 15458970], [15458971, 16489568], [16489569, 17520166], [17520167, 18550764], [18550765, 19581362], [19581363, 20611963]] SRR6958352 file size 6963017 SRR6958352 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958352 SRR6958352_1.fastq SRR6958352_2.fastq Input file: SRR6958352_1.fastq Paired file: SRR6958352_2.fastq trimmed: SRR6958352-trimmed-pair1.fastq, SRR6958352-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:44:59 2024 >> started Fri Dec 6 20:45:24 2024 >> done (25.186s) 20611963 read pairs processed; of these: 10620 ( 0.05%) short read pairs filtered out after trimming by size control 8128 ( 0.04%) empty read pairs filtered out after trimming by size control 20593215 (99.91%) read pairs available; of these: 5941662 (28.85%) trimmed read pairs available after processing 14651553 (71.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 8 0.00% 21 4 0.00% 22 5 0.00% 23 3 0.00% 24 8 0.00% 25 9 0.00% 26 6 0.00% 27 3 0.00% 28 14 0.00% 29 8 0.00% 30 4 0.00% 31 6 0.00% 32 7 0.00% 33 2 0.00% 34 6 0.00% 35 7 0.00% 36 9 0.00% 37 5 0.00% 38 7 0.00% 39 5 0.00% 40 9 0.00% 41 9 0.00% 42 7 0.00% 43 7 0.00% 44 10 0.00% 45 7 0.00% 46 16 0.00% 47 19 0.00% 48 9 0.00% 49 25 0.00% 50 17 0.00% 51 39 0.00% 52 32 0.00% 53 31 0.00% 54 34 0.00% 55 35 0.00% 56 42 0.00% 57 49 0.00% 58 61 0.00% 59 67 0.00% 60 64 0.00% 61 61 0.00% 62 92 0.00% 63 88 0.00% 64 131 0.00% 65 117 0.00% 66 140 0.00% 67 148 0.00% 68 180 0.00% 69 197 0.00% 70 233 0.00% 71 252 0.00% 72 303 0.00% 73 351 0.00% 74 358 0.00% 75 438 0.00% 76 472 0.00% 77 617 0.00% 78 636 0.00% 79 751 0.00% 80 862 0.00% 81 974 0.00% 82 1072 0.01% 83 1258 0.01% 84 1827 0.01% 85 2359 0.01% 86 2447 0.01% 87 2518 0.01% 88 2832 0.01% 89 2879 0.01% 90 3179 0.02% 91 3444 0.02% 92 3563 0.02% 93 4222 0.02% 94 4432 0.02% 95 4596 0.02% 96 5076 0.02% 97 5488 0.03% 98 5781 0.03% 99 6141 0.03% 100 6648 0.03% 101 7025 0.03% 102 7537 0.04% 103 8152 0.04% 104 8749 0.04% 105 9331 0.05% 106 9942 0.05% 107 10385 0.05% 108 10925 0.05% 109 11778 0.06% 110 12239 0.06% 111 13050 0.06% 112 13919 0.07% 113 14562 0.07% 114 15547 0.08% 115 16476 0.08% 116 17324 0.08% 117 18050 0.09% 118 18961 0.09% 119 19661 0.10% 120 20399 0.10% 121 21045 0.10% 122 22088 0.11% 123 23395 0.11% 124 24992 0.12% 125 25944 0.13% 126 27166 0.13% 127 28809 0.14% 128 29280 0.14% 129 30669 0.15% 130 31869 0.15% 131 32995 0.16% 132 34942 0.17% 133 36674 0.18% 134 38629 0.19% 135 40614 0.20% 136 42811 0.21% 137 44596 0.22% 138 47320 0.23% 139 50068 0.24% 140 52626 0.26% 141 56510 0.27% 142 61727 0.30% 143 68001 0.33% 144 75812 0.37% 145 88533 0.43% 146 105587 0.51% 147 136465 0.66% 148 202041 0.98% 149 412291 2.00% 150 3706265 18.00% 151 14651553 71.15% 20593215 reads passed initial QC criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=21 prefix-density=0.97 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=30.32 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.3 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=3.68 fanout-score-rank=16 prefix-density=0.65 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=61.58 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.2 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958352 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:46:04 Started mapping on | Dec 06 20:46:04 Finished on | Dec 06 20:47:40 Mapping speed, Million of reads per hour | 772.25 Number of input reads | 20593215 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 20124760 Uniquely mapped reads % | 97.73% Average mapped length | 298.00 Number of splices: Total | 23902055 Number of splices: Annotated (sjdb) | 22569460 Number of splices: GT/AG | 23586251 Number of splices: GC/AG | 277731 Number of splices: AT/AC | 8581 Number of splices: Non-canonical | 29492 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 2.40 Insertion rate per base | 0.01% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 170730 % of reads mapped to multiple loci | 0.83% Number of reads mapped to too many loci | 15012 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.94% % of reads unmapped: other | 0.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 304790 304790 304790 N_multimapping 170730 170730 170730 N_noFeature 642457 19578955 790402 N_ambiguous 478132 2706 81966 UnstrandedReadsAssigned:19004171 PositiveStrandReadsAssigned:543099 NegativeStrandReadsAssigned:19252392 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6958352 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958352-trimmed-pair1.fastq SRR6958352-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,593,215 reads, 19,250,363 reads pseudoaligned [quant] estimated average fragment length: 273.166 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,183 rounds 52973 SRR6958352.ke.tsv 35125 SRR6958352.se.tsv 88098 total ==> SRR6958352.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 664.426 0 0 PNS24247 1044 771.834 59.1309 5.89289 PNS24249 1928 1655.83 50.6328 2.35209 PNS24246 1044 771.834 59.1309 5.89289 PNS24248 1044 771.834 59.1309 5.89289 PNS24244 1471 1198.83 9.97452 0.639986 PNS24243 293 81.8648 0 0 KQK14069 1603 1330.83 4217.26 243.75 KQK14071 474 219.825 88.2826 30.8913 ==> SRR6958352.se.tsv <== BRADI_1g14170v3 4850 BRADI_1g53295v3 157 BRADI_1g59795v3 205 BRADI_1g07683v3 1 BRADI_1g00485v3 7 BRADI_1g20270v3 251 BRADI_1g74790v3 104 BRADI_1g09890v3 0 BRADI_1g77505v3 240 BRADI_1g48960v3 0 SRR6958352 completed mapping pipeline successfully