Starting /dee2/code/volunteer_pipeline.sh SRR6958353 current disk space = 1549360668672 free memory = 1598257280 SRR6958353 SRAfilesize 7b08e0c516574f074aabd58c52ef15db SRR6958353.sra SRR6958353.sra file validated SRR6958353 is paired end SRR6958353 is conventional basespace SRR6958353 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958353_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8125 33.0 33.0 34.0 32.0 34.0 2 31.61225 33.0 32.0 33.0 28.0 34.0 3 32.07325 33.0 31.0 33.0 29.0 34.0 4 32.45375 33.0 33.0 34.0 31.0 34.0 5 32.74075 33.0 33.0 34.0 32.0 34.0 6 36.46475 38.0 37.0 38.0 34.0 38.0 7 36.789 38.0 37.0 38.0 34.0 38.0 8 37.31675 38.0 38.0 38.0 36.0 38.0 9 37.39975 38.0 38.0 38.0 37.0 38.0 10-14 37.4725 38.0 38.0 38.0 37.6 38.0 15-19 37.54815 38.0 38.0 38.0 37.8 38.0 20-24 37.568 38.0 38.0 38.0 38.0 38.0 25-29 37.48565 38.0 38.0 38.0 37.8 38.0 30-34 37.49655 38.0 38.0 38.0 37.4 38.0 35-39 37.40709999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.4576 38.0 38.0 38.0 37.0 38.0 45-49 37.46455 38.0 38.0 38.0 37.0 38.0 50-54 37.38265 38.0 38.0 38.0 37.0 38.0 55-59 37.2007 38.0 38.0 38.0 37.0 38.0 60-64 36.94775 38.0 38.0 38.0 36.0 38.0 65-69 37.297 38.0 38.0 38.0 36.4 38.0 70-74 37.2183 38.0 38.0 38.0 36.0 38.0 75-79 37.1348 38.0 38.0 38.0 36.0 38.0 80-84 37.007549999999995 38.0 38.0 38.0 35.6 38.0 85-89 36.96395 38.0 38.0 38.0 35.0 38.0 90-94 36.89105 38.0 38.0 38.0 35.0 38.0 95-99 36.7273 38.0 38.0 38.0 34.6 38.0 100-104 36.59740000000001 38.0 38.0 38.0 34.2 38.0 105-109 36.473650000000006 38.0 38.0 38.0 33.8 38.0 110-114 36.33845 38.0 37.6 38.0 34.0 38.0 115-119 36.1637 38.0 37.0 38.0 33.0 38.0 120-124 35.9447 38.0 37.0 38.0 31.4 38.0 125-129 35.5883 38.0 36.0 38.0 30.6 38.0 130-134 35.300650000000005 38.0 36.0 38.0 28.8 38.0 135-139 34.8587 38.0 35.6 38.0 27.8 38.0 140-144 34.58055 38.0 35.4 38.0 27.4 38.0 145-149 33.66325 38.0 33.2 38.0 23.4 38.0 150-151 28.07675 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 4.0 19 1.0 20 1.0 21 3.0 22 6.0 23 5.0 24 6.0 25 8.0 26 7.0 27 19.0 28 20.0 29 37.0 30 44.0 31 55.0 32 71.0 33 106.0 34 135.0 35 313.0 36 762.0 37 2396.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.075 9.9 9.049999999999999 34.975 2 23.05 11.85 33.1 32.0 3 21.05 16.075 25.424999999999997 37.45 4 26.400000000000002 21.825 22.05 29.725 5 26.075 25.874999999999996 24.175 23.875 6 25.3 30.5 22.725 21.475 7 18.525 23.65 38.550000000000004 19.275000000000002 8 21.675 22.7 27.525 28.1 9 21.425 22.35 31.825 24.4 10-14 23.438515777366607 26.26393959093864 25.23878581787268 25.058758813822074 15-19 24.175 24.41 25.650000000000002 25.765 20-24 23.405 24.67 25.945 25.979999999999997 25-29 23.61 24.32 25.535000000000004 26.534999999999997 30-34 23.794999999999998 24.47 25.695 26.040000000000003 35-39 23.474999999999998 24.495 25.915 26.115 40-44 23.98 24.82 25.47 25.729999999999997 45-49 24.224999999999998 24.675 24.89 26.21 50-54 24.08 24.64 25.145 26.135 55-59 24.092574928460266 24.574526833676387 25.508308650032628 25.824589587830715 60-64 24.394289735598672 24.158037599276163 25.53031064642606 25.9173620186991 65-69 24.21 24.099999999999998 25.345000000000002 26.345000000000002 70-74 23.925 24.215 25.255 26.605 75-79 24.325 24.295 24.915000000000003 26.465 80-84 23.735 25.155 24.85 26.26 85-89 24.5 23.89 25.535000000000004 26.075 90-94 24.895 23.965 25.245 25.895000000000003 95-99 24.84 23.43 25.335 26.395000000000003 100-104 24.515 24.43 24.89 26.165 105-109 24.965 23.455000000000002 25.69 25.89 110-114 24.41 24.165 25.2 26.224999999999998 115-119 24.51 23.91 25.4 26.179999999999996 120-124 24.474999999999998 23.794999999999998 25.505 26.224999999999998 125-129 24.98 24.310000000000002 24.095 26.615 130-134 24.665 24.23 24.72 26.384999999999998 135-139 24.95 23.96 24.925 26.165 140-144 24.65 24.42 24.87 26.06 145-149 24.455 23.87 25.224999999999998 26.450000000000003 150-151 24.95 23.599999999999998 24.45 27.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 2.0 28 3.5 29 4.0 30 3.5 31 4.5 32 8.5 33 12.0 34 19.5 35 28.0 36 33.0 37 45.0 38 65.0 39 90.5 40 111.0 41 140.0 42 161.5 43 173.5 44 184.0 45 188.5 46 182.0 47 181.0 48 180.0 49 168.0 50 170.5 51 157.5 52 141.0 53 137.5 54 130.0 55 116.5 56 96.0 57 95.0 58 93.5 59 80.0 60 82.0 61 90.0 62 82.0 63 66.5 64 68.5 65 71.0 66 67.5 67 54.5 68 48.0 69 38.0 70 29.5 71 25.0 72 18.5 73 16.5 74 11.0 75 8.0 76 6.5 77 5.5 78 2.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.40499999999999997 60-64 0.53 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.025 0.0 0.0 66-67 0.0 0.0 0.025 0.0 0.0 68-69 0.0 0.0 0.025 0.0 0.0 70-71 0.0 0.0 0.025 0.0 0.0 72-73 0.0 0.0 0.025 0.0 0.0 74-75 0.0 0.0 0.025 0.0 0.0 76-77 0.0 0.0 0.025 0.0 0.0 78-79 0.0 0.0 0.025 0.0 0.0 80-81 0.0 0.0 0.025 0.0 0.0 82-83 0.0 0.0 0.025 0.0 0.0 84-85 0.0 0.0 0.025 0.0 0.0 86-87 0.0 0.0 0.025 0.0 0.0 88-89 0.037500000000000006 0.0 0.025 0.0 0.0 90-91 0.05 0.0 0.025 0.0 0.0 92-93 0.05 0.0 0.025 0.0 0.0 94-95 0.0875 0.0 0.025 0.0 0.0 96-97 0.15 0.0 0.025 0.0 0.0 98-99 0.16249999999999998 0.0 0.025 0.0 0.0 100-101 0.21250000000000002 0.0 0.025 0.0 0.0 102-103 0.25 0.0 0.025 0.0 0.0 104-105 0.325 0.0 0.025 0.0 0.0 106-107 0.375 0.0 0.025 0.0 0.0 108-109 0.4 0.0 0.025 0.0 0.0 110-111 0.525 0.0 0.025 0.0 0.0 112-113 0.6 0.0 0.025 0.0 0.0 114-115 0.6875 0.0 0.025 0.0 0.0 116-117 0.8125 0.0 0.025 0.0 0.0 118-119 0.975 0.0 0.025 0.0 0.0 120-121 1.1875 0.0 0.025 0.0 0.0 122-123 1.425 0.0 0.025 0.0 0.0 124-125 1.675 0.0 0.025 0.0 0.0 126-127 1.9875 0.0 0.025 0.0 0.0 128-129 2.2249999999999996 0.0 0.025 0.0 0.0 130-131 2.5125 0.0 0.025 0.0 0.0 132-133 2.8125 0.0 0.025 0.0 0.0 134-135 3.1125 0.0 0.025 0.0 0.0 136-137 3.3125 0.0 0.025 0.0 0.0 138-139 3.5875 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCTCT 10 0.006830828 145.0 1 GGAATGA 10 0.006830828 145.0 9 AGGAGGA 10 0.006830828 145.0 7 >>END_MODULE SRR6958353 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958353_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.817 33.0 33.0 34.0 32.0 34.0 2 33.00525 33.0 33.0 34.0 32.0 34.0 3 32.9975 34.0 33.0 34.0 32.0 34.0 4 33.007 34.0 33.0 34.0 32.0 34.0 5 32.9695 34.0 33.0 34.0 32.0 34.0 6 37.129 38.0 38.0 38.0 37.0 38.0 7 37.17 38.0 38.0 38.0 37.0 38.0 8 37.15675 38.0 38.0 38.0 37.0 38.0 9 37.102 38.0 38.0 38.0 37.0 38.0 10-14 37.126549999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.0786 38.0 38.0 38.0 36.6 38.0 20-24 37.07145 38.0 38.0 38.0 36.4 38.0 25-29 37.0561 38.0 38.0 38.0 36.4 38.0 30-34 37.0099 38.0 38.0 38.0 36.0 38.0 35-39 37.0149 38.0 38.0 38.0 36.4 38.0 40-44 36.99660000000001 38.0 38.0 38.0 36.0 38.0 45-49 36.9647 38.0 38.0 38.0 36.0 38.0 50-54 36.924049999999994 38.0 38.0 38.0 36.0 38.0 55-59 36.85735 38.0 38.0 38.0 35.6 38.0 60-64 36.79820000000001 38.0 38.0 38.0 35.4 38.0 65-69 36.73845 38.0 38.0 38.0 35.2 38.0 70-74 36.81305 38.0 38.0 38.0 35.6 38.0 75-79 36.70635 38.0 38.0 38.0 35.0 38.0 80-84 36.71135 38.0 38.0 38.0 35.0 38.0 85-89 36.54885 38.0 38.0 38.0 34.4 38.0 90-94 36.40385 38.0 38.0 38.0 34.0 38.0 95-99 36.337399999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.2683 38.0 38.0 38.0 34.0 38.0 105-109 36.1496 38.0 38.0 38.0 33.6 38.0 110-114 35.85425 38.0 37.6 38.0 32.2 38.0 115-119 35.802499999999995 38.0 37.2 38.0 32.4 38.0 120-124 35.756899999999995 38.0 37.0 38.0 32.4 38.0 125-129 35.67045 38.0 36.6 38.0 32.4 38.0 130-134 35.4282 38.0 36.0 38.0 31.4 38.0 135-139 35.2215 38.0 36.0 38.0 30.2 38.0 140-144 34.64365 38.0 35.4 38.0 28.0 38.0 145-149 33.9713 38.0 34.2 38.0 24.4 38.0 150-151 30.109 35.5 28.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 2.0 5 0.0 6 0.0 7 2.0 8 1.0 9 1.0 10 2.0 11 0.0 12 2.0 13 2.0 14 2.0 15 1.0 16 1.0 17 3.0 18 3.0 19 2.0 20 4.0 21 6.0 22 12.0 23 13.0 24 5.0 25 18.0 26 25.0 27 28.0 28 26.0 29 44.0 30 37.0 31 47.0 32 70.0 33 106.0 34 131.0 35 222.0 36 515.0 37 2657.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.4 18.05 12.174999999999999 28.375 2 28.928928928928926 23.123123123123122 25.375375375375377 22.57257257257257 3 22.67267267267267 26.576576576576578 26.8018018018018 23.94894894894895 4 27.32732732732733 30.955955955955954 20.42042042042042 21.296296296296298 5 27.263631815907953 31.465732866433214 18.959479739869938 22.311155577788895 6 24.706176544136035 35.15878969742436 18.95473868467117 21.180295073768445 7 22.8978978978979 19.51951951951952 33.68368368368368 23.8988988988989 8 24.26820115086315 23.892919689767325 22.742056542406804 29.09682261696272 9 24.36827620715537 22.116587440580435 26.319739804853644 27.195396547410557 10-14 25.417792454718303 25.692985089562693 23.046132292604824 25.84309016311418 15-19 26.17856070463417 24.69722750475428 23.511160044039634 25.613051746571912 20-24 26.034732996346527 25.073820129122666 23.93774085381112 24.953706020719686 25-29 26.577590952309464 24.916178751939146 23.114647450332786 25.391582845418604 30-34 25.52424803563385 25.18892948300886 23.597417546669337 25.689404934687953 35-39 26.266820069031066 25.171327097193736 23.085388424791155 25.476464408984047 40-44 26.74139311449159 24.084267413931144 23.55884707766213 25.615492393915133 45-49 26.225245049009803 24.954990998199637 23.399679935987198 25.42008401680336 50-54 26.57765776577658 24.69246924692469 23.532353235323534 25.197519751975193 55-59 26.194167958785574 25.138798579502826 23.463212124243483 25.203821337468113 60-64 27.045818327330934 25.035014005602243 23.259303721488596 24.65986394557823 65-69 25.920368147258905 25.275110044017605 23.5344137655062 25.270108043217288 70-74 26.85305591677503 24.5223567070121 23.4370311093328 25.187556266880062 75-79 26.035828662930342 24.95496397117694 24.13931144915933 24.869895916733388 80-84 26.268940341051156 25.54383157473621 23.7635645346802 24.423663549532428 85-89 26.284999999999997 24.805 23.965 24.945 90-94 26.710342068413684 24.56991398279656 23.664732946589318 25.055011002200438 95-99 26.309208222878006 25.6139648877107 23.62326814385035 24.453558745560947 100-104 26.330266053210643 24.54490898179636 23.889777955591118 25.235047009401878 105-109 26.195239047809558 25.41008201640328 23.73474694938988 24.65993198639728 110-114 26.845369073814762 25.61512302460492 23.32966593318664 24.20984196839368 115-119 26.74837418709355 25.067533766883443 23.631815907953975 24.552276138069036 120-124 26.65666416604151 25.186296574143537 23.355838959739934 24.801200300075017 125-129 26.720344068813763 25.41008201640328 23.414682936587315 24.45489097819564 130-134 27.337733773377337 25.132513251325133 23.307330733073307 24.222422242224223 135-139 27.299554844195466 25.188816085629973 23.843345170809783 23.668283899364777 140-144 26.626656664166042 25.886471617904476 23.72093023255814 23.765941485371343 145-149 27.70331099329799 25.52265679703911 23.27698309492848 23.49704911473442 150-151 26.39739902463424 26.559959984994375 23.158684506690008 23.88395648368138 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 1.0 28 0.5 29 2.0 30 5.0 31 4.5 32 4.5 33 9.0 34 15.5 35 19.5 36 27.5 37 44.0 38 58.0 39 82.0 40 108.0 41 120.0 42 133.5 43 156.0 44 171.0 45 173.5 46 186.0 47 184.0 48 178.5 49 179.0 50 160.0 51 148.0 52 142.0 53 120.5 54 99.0 55 111.5 56 117.0 57 99.0 58 89.5 59 85.0 60 87.0 61 92.5 62 93.0 63 90.5 64 85.5 65 81.0 66 72.0 67 66.5 68 64.5 69 56.0 70 44.5 71 34.0 72 31.0 73 23.5 74 13.5 75 8.0 76 7.0 77 4.0 78 2.5 79 2.0 80 0.0 81 1.0 82 1.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.1 4 0.1 5 0.05 6 0.025 7 0.1 8 0.075 9 0.075 10-14 0.06999999999999999 15-19 0.09 20-24 0.095 25-29 0.08499999999999999 30-34 0.095 35-39 0.045 40-44 0.08 45-49 0.02 50-54 0.01 55-59 0.034999999999999996 60-64 0.04 65-69 0.04 70-74 0.03 75-79 0.08 80-84 0.015 85-89 0.0 90-94 0.02 95-99 0.034999999999999996 100-104 0.02 105-109 0.02 110-114 0.02 115-119 0.05 120-124 0.025 125-129 0.02 130-134 0.01 135-139 0.034999999999999996 140-144 0.025 145-149 0.03 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0897597977244 97.975 2 0.7332490518331226 1.4500000000000002 3 0.15170670037926676 0.44999999999999996 4 0.0 0.0 5 0.025284450063211124 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.8875 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.2374999999999998 0.0 0.0 0.0 0.0 122-123 1.475 0.0 0.0 0.0 0.0 124-125 1.725 0.0 0.0 0.0 0.0 126-127 2.0375 0.0 0.0 0.0 0.0 128-129 2.3 0.0 0.0 0.0 0.0 130-131 2.5875 0.0 0.0 0.0 0.0 132-133 2.8875 0.0 0.0 0.0 0.0 134-135 3.1875 0.0 0.0 0.0 0.0 136-137 3.3875 0.0 0.0 0.0 0.0 138-139 3.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATAATT 10 0.006830828 145.0 145 ATCTGTG 10 0.006830828 145.0 5 >>END_MODULE Read 1170002 spots for SRR6958353.sra Written 1170002 spots for SRR6958353.sra Read 1170002 spots for SRR6958353.sra Written 1170002 spots for SRR6958353.sra Read 1170002 spots for SRR6958353.sra Written 1170002 spots for SRR6958353.sra Read 1170002 spots for SRR6958353.sra Written 1170002 spots for SRR6958353.sra Read 1170002 spots for SRR6958353.sra Written 1170002 spots for SRR6958353.sra Read 1170002 spots for SRR6958353.sra Written 1170002 spots for SRR6958353.sra Read 1170002 spots for SRR6958353.sra Written 1170002 spots for SRR6958353.sra Read 1170002 spots for SRR6958353.sra Written 1170002 spots for SRR6958353.sra Read 1170002 spots for SRR6958353.sra Written 1170002 spots for SRR6958353.sra Read 1170002 spots for SRR6958353.sra Written 1170002 spots for SRR6958353.sra Read 1170002 spots for SRR6958353.sra Written 1170002 spots for SRR6958353.sra Read 1170002 spots for SRR6958353.sra Written 1170002 spots for SRR6958353.sra Read 1170007 spots for SRR6958353.sra Written 1170007 spots for SRR6958353.sra Read 1170002 spots for SRR6958353.sra Written 1170002 spots for SRR6958353.sra Read 1170002 spots for SRR6958353.sra Written 1170002 spots for SRR6958353.sra Read 1170002 spots for SRR6958353.sra Written 1170002 spots for SRR6958353.sra Read 1170002 spots for SRR6958353.sra Written 1170002 spots for SRR6958353.sra Read 1170002 spots for SRR6958353.sra Written 1170002 spots for SRR6958353.sra Read 1170002 spots for SRR6958353.sra Written 1170002 spots for SRR6958353.sra Read 1170002 spots for SRR6958353.sra Written 1170002 spots for SRR6958353.sra SRR ids: ['SRR6958353.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3hots1tw SRR6958353.sra spots: 23400045 blocks: [[1, 1170002], [1170003, 2340004], [2340005, 3510006], [3510007, 4680008], [4680009, 5850010], [5850011, 7020012], [7020013, 8190014], [8190015, 9360016], [9360017, 10530018], [10530019, 11700020], [11700021, 12870022], [12870023, 14040024], [14040025, 15210026], [15210027, 16380028], [16380029, 17550030], [17550031, 18720032], [18720033, 19890034], [19890035, 21060036], [21060037, 22230038], [22230039, 23400045]] SRR6958353 file size 7907807 SRR6958353 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958353 SRR6958353_1.fastq SRR6958353_2.fastq Input file: SRR6958353_1.fastq Paired file: SRR6958353_2.fastq trimmed: SRR6958353-trimmed-pair1.fastq, SRR6958353-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:46:54 2024 >> started Fri Dec 6 20:47:23 2024 >> done (28.383s) 23400045 read pairs processed; of these: 34217 ( 0.15%) short read pairs filtered out after trimming by size control 59560 ( 0.25%) empty read pairs filtered out after trimming by size control 23306268 (99.60%) read pairs available; of these: 9650492 (41.41%) trimmed read pairs available after processing 13655776 (58.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 5 0.00% 21 2 0.00% 22 7 0.00% 23 4 0.00% 24 1 0.00% 25 4 0.00% 26 3 0.00% 27 6 0.00% 28 8 0.00% 29 6 0.00% 30 6 0.00% 31 6 0.00% 32 7 0.00% 33 7 0.00% 34 12 0.00% 35 12 0.00% 36 9 0.00% 37 12 0.00% 38 11 0.00% 39 11 0.00% 40 15 0.00% 41 10 0.00% 42 16 0.00% 43 24 0.00% 44 24 0.00% 45 17 0.00% 46 23 0.00% 47 36 0.00% 48 23 0.00% 49 42 0.00% 50 26 0.00% 51 37 0.00% 52 36 0.00% 53 48 0.00% 54 49 0.00% 55 48 0.00% 56 69 0.00% 57 78 0.00% 58 80 0.00% 59 89 0.00% 60 105 0.00% 61 126 0.00% 62 134 0.00% 63 139 0.00% 64 178 0.00% 65 175 0.00% 66 207 0.00% 67 203 0.00% 68 236 0.00% 69 271 0.00% 70 326 0.00% 71 362 0.00% 72 403 0.00% 73 488 0.00% 74 504 0.00% 75 605 0.00% 76 699 0.00% 77 725 0.00% 78 860 0.00% 79 977 0.00% 80 1021 0.00% 81 1211 0.01% 82 1435 0.01% 83 1640 0.01% 84 2778 0.01% 85 3319 0.01% 86 3563 0.02% 87 3641 0.02% 88 3882 0.02% 89 3961 0.02% 90 4327 0.02% 91 4385 0.02% 92 4684 0.02% 93 5147 0.02% 94 5456 0.02% 95 5813 0.02% 96 6148 0.03% 97 6485 0.03% 98 7006 0.03% 99 7385 0.03% 100 7821 0.03% 101 8086 0.03% 102 9102 0.04% 103 9544 0.04% 104 10285 0.04% 105 10800 0.05% 106 11522 0.05% 107 12138 0.05% 108 12796 0.05% 109 13668 0.06% 110 13992 0.06% 111 15186 0.07% 112 16338 0.07% 113 17168 0.07% 114 18086 0.08% 115 19530 0.08% 116 20590 0.09% 117 21500 0.09% 118 22585 0.10% 119 23603 0.10% 120 24855 0.11% 121 25989 0.11% 122 27073 0.12% 123 29003 0.12% 124 30334 0.13% 125 32384 0.14% 126 33740 0.14% 127 35824 0.15% 128 37677 0.16% 129 38789 0.17% 130 40796 0.18% 131 42699 0.18% 132 45595 0.20% 133 48431 0.21% 134 51310 0.22% 135 54808 0.24% 136 57947 0.25% 137 61553 0.26% 138 65290 0.28% 139 70295 0.30% 140 75305 0.32% 141 81748 0.35% 142 91486 0.39% 143 102236 0.44% 144 118457 0.51% 145 141974 0.61% 146 178410 0.77% 147 244763 1.05% 148 389519 1.67% 149 851559 3.65% 150 6134356 26.32% 151 13655776 58.59% 23306268 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=3.28 fanout-score-rank=19 prefix-density=0.69 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=60.50 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.8 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.80 fanout-score-rank=18 prefix-density=0.44 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.16 sequence-density-rank=14 fanout-score=51.65 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=10.7 sequence=GCCGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGA SRR6958353 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:48:06 Started mapping on | Dec 06 20:48:08 Finished on | Dec 06 20:49:53 Mapping speed, Million of reads per hour | 799.07 Number of input reads | 23306268 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 22608699 Uniquely mapped reads % | 97.01% Average mapped length | 297.30 Number of splices: Total | 25874916 Number of splices: Annotated (sjdb) | 24329033 Number of splices: GT/AG | 25519583 Number of splices: GC/AG | 312727 Number of splices: AT/AC | 9275 Number of splices: Non-canonical | 33331 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 2.66 Insertion rate per base | 0.01% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 191466 % of reads mapped to multiple loci | 0.82% Number of reads mapped to too many loci | 9794 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.85% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 522172 522172 522172 N_multimapping 191466 191466 191466 N_noFeature 592098 21982582 758094 N_ambiguous 551908 3351 92838 UnstrandedReadsAssigned:21464693 PositiveStrandReadsAssigned:622766 NegativeStrandReadsAssigned:21757767 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958353 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958353-trimmed-pair1.fastq SRR6958353-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,306,268 reads, 21,744,813 reads pseudoaligned [quant] estimated average fragment length: 265.091 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52973 SRR6958353.ke.tsv 35125 SRR6958353.se.tsv 88098 total ==> SRR6958353.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 672.387 82.0169 8.0127 PNS24247 1044 779.909 58.4733 4.92503 PNS24249 1928 1663.91 65.5848 2.58922 PNS24246 1044 779.909 58.4733 4.92503 PNS24248 1044 779.909 58.4733 4.92503 PNS24244 1471 1206.91 21.9784 1.19623 PNS24243 293 80.5698 0 0 KQK14069 1603 1338.91 7860.32 385.642 KQK14071 474 222.379 72.9695 21.5547 ==> SRR6958353.se.tsv <== BRADI_1g14170v3 8348 BRADI_1g53295v3 188 BRADI_1g59795v3 364 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 262 BRADI_1g74790v3 119 BRADI_1g09890v3 0 BRADI_1g77505v3 323 BRADI_1g48960v3 0 SRR6958353 completed mapping pipeline successfully