Starting /dee2/code/volunteer_pipeline.sh SRR6958354 current disk space = 1549375541248 free memory = 1599860720 SRR6958354 SRAfilesize 9794c7eaa0a0cd5280f68fc060833237 SRR6958354.sra SRR6958354.sra file validated SRR6958354 is paired end SRR6958354 is conventional basespace SRR6958354 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958354_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.507 32.0 27.0 33.0 18.0 34.0 2 31.00725 33.0 29.0 33.0 27.0 34.0 3 31.8685 33.0 31.0 33.0 27.0 34.0 4 32.41625 33.0 33.0 33.0 32.0 34.0 5 33.00125 33.0 33.0 34.0 32.0 34.0 6 37.1275 38.0 37.0 38.0 36.0 38.0 7 37.53525 38.0 38.0 38.0 37.0 38.0 8 37.557 38.0 38.0 38.0 37.0 38.0 9 37.5985 38.0 38.0 38.0 38.0 38.0 10-14 37.470000000000006 38.0 38.0 38.0 37.8 38.0 15-19 37.4285 38.0 38.0 38.0 37.4 38.0 20-24 37.4287 38.0 38.0 38.0 37.6 38.0 25-29 37.0477 38.0 38.0 38.0 35.6 38.0 30-34 37.34625 38.0 38.0 38.0 37.0 38.0 35-39 37.371 38.0 38.0 38.0 37.2 38.0 40-44 37.30544999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.255399999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.258300000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.3021 38.0 38.0 38.0 37.0 38.0 60-64 37.32340000000001 38.0 38.0 38.0 37.0 38.0 65-69 37.299099999999996 38.0 38.0 38.0 36.8 38.0 70-74 37.2 38.0 38.0 38.0 36.4 38.0 75-79 37.2835 38.0 38.0 38.0 37.0 38.0 80-84 37.14835 38.0 38.0 38.0 36.2 38.0 85-89 36.825100000000006 38.0 38.0 38.0 35.2 38.0 90-94 35.7485 38.0 37.2 38.0 31.0 38.0 95-99 35.85955 38.0 37.0 38.0 31.2 38.0 100-104 35.77675000000001 38.0 36.8 38.0 31.2 38.0 105-109 35.8665 38.0 37.4 38.0 31.8 38.0 110-114 35.8349 38.0 37.0 38.0 31.4 38.0 115-119 36.2342 38.0 37.6 38.0 33.4 38.0 120-124 36.36775 38.0 38.0 38.0 34.0 38.0 125-129 36.4685 38.0 38.0 38.0 34.0 38.0 130-134 36.22055 38.0 38.0 38.0 33.6 38.0 135-139 36.08175 38.0 37.8 38.0 33.4 38.0 140-144 34.940099999999994 38.0 35.2 38.0 29.0 38.0 145-149 34.095299999999995 38.0 34.4 38.0 25.6 38.0 150-151 31.381625 36.5 31.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 2.0 17 0.0 18 2.0 19 0.0 20 3.0 21 3.0 22 3.0 23 6.0 24 6.0 25 8.0 26 9.0 27 25.0 28 20.0 29 31.0 30 42.0 31 59.0 32 94.0 33 111.0 34 168.0 35 251.0 36 645.0 37 2511.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.674057649667404 8.89689578713969 7.926829268292683 36.50221729490023 2 25.724999999999998 12.275 35.075 26.924999999999997 3 22.57822277847309 16.545682102628284 23.128911138923655 37.74718397997497 4 27.025 24.5 21.2 27.275 5 26.700000000000003 28.000000000000004 23.599999999999998 21.7 6 23.0 31.65 24.175 21.175 7 17.65 21.725 40.6 20.025000000000002 8 20.849999999999998 23.925 28.999999999999996 26.224999999999998 9 19.925 20.424999999999997 33.025 26.625 10-14 23.22 26.525 25.5 24.755 15-19 23.235 24.595 26.515 25.655 20-24 23.03615180759038 24.971248562428123 26.18630931546577 25.806290314515728 25-29 23.26 25.655 25.455 25.629999999999995 30-34 23.325000000000003 24.585 26.71 25.380000000000003 35-39 23.23 25.165 25.645 25.96 40-44 23.465 25.105 25.990000000000002 25.44 45-49 23.585 24.92 26.265 25.230000000000004 50-54 23.41 24.965 25.590000000000003 26.035000000000004 55-59 24.026201310065503 25.156257812890644 24.98624931246562 25.83129156457823 60-64 23.485 25.305 25.395 25.814999999999998 65-69 23.474999999999998 24.965 25.835 25.724999999999998 70-74 23.849999999999998 24.529999999999998 25.965 25.655 75-79 23.56 24.68 25.825 25.935000000000002 80-84 23.66 25.115 25.34 25.885 85-89 23.75 25.014999999999997 25.69 25.545 90-94 24.11 25.019999999999996 25.629999999999995 25.240000000000002 95-99 23.995 24.935 25.035 26.035000000000004 100-104 23.875 24.555 25.775 25.795 105-109 23.985 24.645 25.474999999999998 25.895000000000003 110-114 23.865 24.755 25.8 25.580000000000002 115-119 23.36 24.805 26.11 25.724999999999998 120-124 24.025 25.040000000000003 24.93 26.005 125-129 23.794999999999998 25.0 25.3 25.905 130-134 23.82 24.84 25.629999999999995 25.71 135-139 24.435000000000002 24.735 25.0 25.83 140-144 25.069999999999997 25.085 24.86 24.985 145-149 23.855 24.740000000000002 25.44 25.965 150-151 24.65 23.962500000000002 25.2875 26.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.0 24 1.0 25 1.5 26 2.5 27 2.5 28 3.5 29 6.0 30 6.0 31 8.5 32 13.0 33 16.0 34 22.0 35 37.0 36 49.0 37 59.0 38 79.0 39 95.0 40 108.0 41 141.0 42 174.5 43 191.5 44 197.5 45 211.0 46 215.0 47 195.5 48 174.0 49 154.0 50 153.0 51 151.0 52 147.0 53 140.0 54 119.0 55 101.5 56 99.0 57 89.5 58 82.0 59 86.5 60 76.5 61 70.0 62 74.5 63 64.0 64 54.0 65 51.0 66 48.0 67 42.5 68 38.5 69 39.0 70 30.5 71 20.0 72 13.0 73 12.5 74 11.5 75 8.0 76 4.5 77 2.0 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.8 2 0.0 3 0.125 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19232710752145 98.25 2 0.6814740030287734 1.35 3 0.10095911155981827 0.3 4 0.025239777889954566 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.8375 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.2374999999999998 0.0 0.0 0.0 0.0 122-123 1.375 0.0 0.0 0.0 0.0 124-125 1.5125000000000002 0.0 0.0 0.0 0.0 126-127 1.7 0.0 0.0 0.0 0.0 128-129 1.8625 0.0 0.0 0.0 0.0 130-131 2.0875 0.0 0.0 0.0 0.0 132-133 2.3125 0.0 0.0 0.0 0.0 134-135 2.525 0.0 0.0 0.0 0.0 136-137 2.825 0.0 0.0 0.0 0.0 138-139 3.0875000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCGGCC 10 0.0054020355 156.67567 1 CAGTGTA 10 0.006841402 144.925 4 >>END_MODULE SRR6958354 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958354_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98975 33.0 33.0 34.0 32.0 34.0 2 33.1345 34.0 33.0 34.0 32.0 34.0 3 33.122 34.0 33.0 34.0 33.0 34.0 4 33.14925 34.0 33.0 34.0 33.0 34.0 5 32.9265 34.0 33.0 34.0 32.0 34.0 6 37.21175 38.0 38.0 38.0 37.0 38.0 7 37.2655 38.0 38.0 38.0 37.0 38.0 8 37.20625 38.0 38.0 38.0 37.0 38.0 9 37.26 38.0 38.0 38.0 37.0 38.0 10-14 36.72525 38.0 37.8 38.0 34.8 38.0 15-19 36.75625000000001 38.0 38.0 38.0 34.8 38.0 20-24 36.76475000000001 38.0 38.0 38.0 35.2 38.0 25-29 36.95075 38.0 38.0 38.0 36.0 38.0 30-34 36.70785 38.0 37.8 38.0 34.4 38.0 35-39 37.1859 38.0 38.0 38.0 36.8 38.0 40-44 36.82925 38.0 37.8 38.0 35.0 38.0 45-49 36.333800000000004 38.0 37.6 38.0 32.2 38.0 50-54 36.14790000000001 38.0 36.2 38.0 32.0 38.0 55-59 36.28294999999999 38.0 37.4 38.0 33.0 38.0 60-64 34.0007 37.4 32.8 38.0 24.2 38.0 65-69 36.53075 38.0 37.8 38.0 34.4 38.0 70-74 35.69035 38.0 37.0 38.0 29.6 38.0 75-79 36.050850000000004 38.0 37.6 38.0 32.4 38.0 80-84 34.3848 37.8 33.6 38.0 25.8 38.0 85-89 35.629450000000006 38.0 37.0 38.0 29.8 38.0 90-94 36.182750000000006 38.0 37.8 38.0 33.2 38.0 95-99 34.4112 37.2 31.6 38.0 28.0 38.0 100-104 36.10965 38.0 37.2 38.0 32.8 38.0 105-109 36.39935 38.0 38.0 38.0 34.0 38.0 110-114 35.85115 38.0 37.4 38.0 31.8 38.0 115-119 35.739599999999996 38.0 37.4 38.0 32.0 38.0 120-124 35.153 38.0 36.2 38.0 28.2 38.0 125-129 34.05555 38.0 34.0 38.0 23.2 38.0 130-134 34.18555 38.0 34.4 38.0 22.6 38.0 135-139 35.0287 38.0 35.6 38.0 29.6 38.0 140-144 34.16475 38.0 34.2 38.0 24.2 38.0 145-149 34.23595 38.0 35.0 38.0 26.4 38.0 150-151 29.511000000000003 35.0 27.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 1.0 5 0.0 6 1.0 7 2.0 8 0.0 9 0.0 10 1.0 11 1.0 12 2.0 13 2.0 14 2.0 15 2.0 16 3.0 17 2.0 18 3.0 19 4.0 20 2.0 21 12.0 22 7.0 23 16.0 24 14.0 25 18.0 26 21.0 27 29.0 28 48.0 29 47.0 30 80.0 31 78.0 32 115.0 33 143.0 34 195.0 35 409.0 36 877.0 37 1856.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.824999999999996 18.575 10.225 33.375 2 28.725 24.025 28.325 18.925 3 22.725 25.8 26.375 25.1 4 26.674999999999997 30.8 20.200000000000003 22.325 5 28.375 32.425 19.525000000000002 19.675 6 24.474999999999998 33.875 19.925 21.725 7 22.45 19.625 35.6 22.325 8 22.3 23.075000000000003 25.900000000000002 28.725 9 23.875 23.925 27.474999999999998 24.725 10-14 26.145000000000003 25.685000000000002 23.455000000000002 24.715 15-19 26.045 25.64 24.21 24.104999999999997 20-24 25.385 26.365 23.830000000000002 24.42 25-29 25.825 25.795 23.775 24.605 30-34 26.290000000000003 25.805 23.44 24.465 35-39 25.81 25.264999999999997 24.495 24.43 40-44 25.86 25.09 24.154999999999998 24.895 45-49 25.91 24.88 24.445 24.765 50-54 25.385 25.145 24.84 24.63 55-59 26.14 24.675 24.385 24.8 60-64 25.905 25.080000000000002 24.355 24.66 65-69 25.319999999999997 25.240000000000002 24.48 24.959999999999997 70-74 25.755 25.7 24.169999999999998 24.375 75-79 25.685000000000002 25.314999999999998 24.275 24.725 80-84 25.990000000000002 25.435000000000002 24.455 24.12 85-89 25.965 25.825 24.325 23.885 90-94 25.81 25.555 24.36 24.275 95-99 25.865 25.330000000000002 25.11 23.695 100-104 25.77 25.580000000000002 24.18 24.47 105-109 25.865 25.895000000000003 23.845 24.395 110-114 26.245 25.374999999999996 24.39 23.990000000000002 115-119 26.47 25.11 24.41 24.01 120-124 26.279999999999998 25.745 24.279999999999998 23.695 125-129 26.064999999999998 25.46 24.325 24.15 130-134 26.125 25.569999999999997 24.6 23.705000000000002 135-139 26.25 25.95 24.46 23.34 140-144 26.11 25.96 24.065 23.865 145-149 26.224999999999998 25.569999999999997 24.235 23.97 150-151 27.1375 25.162499999999998 24.6125 23.0875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.0 26 2.0 27 3.0 28 6.5 29 6.5 30 5.0 31 6.5 32 8.5 33 15.0 34 23.0 35 31.0 36 39.5 37 54.0 38 81.0 39 98.5 40 115.0 41 135.0 42 159.0 43 174.5 44 176.5 45 185.0 46 180.0 47 170.5 48 176.5 49 184.5 50 171.5 51 144.0 52 129.0 53 115.0 54 97.5 55 92.5 56 96.0 57 89.5 58 93.5 59 105.0 60 100.5 61 83.0 62 68.0 63 72.0 64 72.5 65 64.0 66 54.5 67 59.5 68 59.0 69 53.0 70 39.0 71 25.0 72 25.0 73 17.5 74 12.0 75 9.5 76 4.5 77 1.5 78 1.5 79 1.0 80 1.0 81 1.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06471183013144 97.975 2 0.8088978766430739 1.6 3 0.07583417593528817 0.22499999999999998 4 0.05055611729019212 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.025 0.0 0.0 84-85 0.05 0.0 0.025 0.0 0.0 86-87 0.075 0.0 0.025 0.0 0.0 88-89 0.075 0.0 0.025 0.0 0.0 90-91 0.0875 0.0 0.025 0.0 0.0 92-93 0.1125 0.0 0.025 0.0 0.0 94-95 0.125 0.0 0.025 0.0 0.0 96-97 0.15 0.0 0.025 0.0 0.0 98-99 0.1875 0.0 0.025 0.0 0.0 100-101 0.275 0.0 0.025 0.0 0.0 102-103 0.3375 0.0 0.025 0.0 0.0 104-105 0.4125 0.0 0.025 0.0 0.0 106-107 0.575 0.0 0.025 0.0 0.0 108-109 0.6 0.0 0.025 0.0 0.0 110-111 0.625 0.0 0.025 0.0 0.0 112-113 0.7 0.0 0.025 0.0 0.0 114-115 0.8125 0.0 0.025 0.0 0.0 116-117 0.925 0.0 0.025 0.0 0.0 118-119 1.0375 0.0 0.025 0.0 0.0 120-121 1.2125 0.0 0.025 0.0 0.0 122-123 1.325 0.0 0.025 0.0 0.0 124-125 1.4625 0.0 0.025 0.0 0.0 126-127 1.6625 0.0 0.025 0.0 0.0 128-129 1.8 0.0 0.025 0.0 0.0 130-131 2.0 0.0 0.025 0.0 0.0 132-133 2.175 0.0 0.025 0.0 0.0 134-135 2.375 0.0 0.025 0.0 0.0 136-137 2.675 0.0 0.025 0.0 0.0 138-139 2.9125 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATGAA 10 0.006830828 145.0 5 >>END_MODULE Read 999058 spots for SRR6958354.sra Written 999058 spots for SRR6958354.sra Read 999058 spots for SRR6958354.sra Written 999058 spots for SRR6958354.sra Read 999058 spots for SRR6958354.sra Written 999058 spots for SRR6958354.sra Read 999058 spots for SRR6958354.sra Written 999058 spots for SRR6958354.sra Read 999058 spots for SRR6958354.sra Written 999058 spots for SRR6958354.sra Read 999058 spots for SRR6958354.sra Written 999058 spots for SRR6958354.sra Read 999058 spots for SRR6958354.sra Written 999058 spots for SRR6958354.sra Read 999058 spots for SRR6958354.sra Written 999058 spots for SRR6958354.sra Read 999071 spots for SRR6958354.sra Written 999071 spots for SRR6958354.sra Read 999058 spots for SRR6958354.sra Written 999058 spots for SRR6958354.sra Read 999058 spots for SRR6958354.sra Written 999058 spots for SRR6958354.sra Read 999058 spots for SRR6958354.sra Written 999058 spots for SRR6958354.sra Read 999058 spots for SRR6958354.sra Written 999058 spots for SRR6958354.sra Read 999058 spots for SRR6958354.sra Written 999058 spots for SRR6958354.sra Read 999058 spots for SRR6958354.sra Written 999058 spots for SRR6958354.sra Read 999058 spots for SRR6958354.sra Written 999058 spots for SRR6958354.sra Read 999058 spots for SRR6958354.sra Written 999058 spots for SRR6958354.sra Read 999058 spots for SRR6958354.sra Written 999058 spots for SRR6958354.sra Read 999058 spots for SRR6958354.sra Written 999058 spots for SRR6958354.sra Read 999058 spots for SRR6958354.sra Written 999058 spots for SRR6958354.sra SRR ids: ['SRR6958354.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lamkhf7i SRR6958354.sra spots: 19981173 blocks: [[1, 999058], [999059, 1998116], [1998117, 2997174], [2997175, 3996232], [3996233, 4995290], [4995291, 5994348], [5994349, 6993406], [6993407, 7992464], [7992465, 8991522], [8991523, 9990580], [9990581, 10989638], [10989639, 11988696], [11988697, 12987754], [12987755, 13986812], [13986813, 14985870], [14985871, 15984928], [15984929, 16983986], [16983987, 17983044], [17983045, 18982102], [18982103, 19981173]] SRR6958354 file size 6749263 SRR6958354 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958354 SRR6958354_1.fastq SRR6958354_2.fastq Input file: SRR6958354_1.fastq Paired file: SRR6958354_2.fastq trimmed: SRR6958354-trimmed-pair1.fastq, SRR6958354-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:47:37 2024 >> started Fri Dec 6 20:48:01 2024 >> done (24.221s) 19981173 read pairs processed; of these: 13757 ( 0.07%) short read pairs filtered out after trimming by size control 11694 ( 0.06%) empty read pairs filtered out after trimming by size control 19955722 (99.87%) read pairs available; of these: 6365876 (31.90%) trimmed read pairs available after processing 13589846 (68.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 4 0.00% 21 4 0.00% 22 3 0.00% 23 6 0.00% 24 2 0.00% 25 8 0.00% 26 5 0.00% 27 6 0.00% 28 7 0.00% 29 6 0.00% 30 6 0.00% 31 3 0.00% 32 6 0.00% 33 5 0.00% 34 8 0.00% 35 2 0.00% 36 9 0.00% 37 7 0.00% 38 10 0.00% 39 9 0.00% 40 7 0.00% 41 11 0.00% 42 12 0.00% 43 12 0.00% 44 14 0.00% 45 12 0.00% 46 20 0.00% 47 25 0.00% 48 21 0.00% 49 24 0.00% 50 28 0.00% 51 30 0.00% 52 30 0.00% 53 47 0.00% 54 29 0.00% 55 30 0.00% 56 52 0.00% 57 54 0.00% 58 81 0.00% 59 71 0.00% 60 90 0.00% 61 86 0.00% 62 88 0.00% 63 133 0.00% 64 135 0.00% 65 139 0.00% 66 189 0.00% 67 227 0.00% 68 230 0.00% 69 266 0.00% 70 315 0.00% 71 366 0.00% 72 370 0.00% 73 425 0.00% 74 545 0.00% 75 544 0.00% 76 595 0.00% 77 766 0.00% 78 777 0.00% 79 885 0.00% 80 1042 0.01% 81 1236 0.01% 82 1365 0.01% 83 1579 0.01% 84 2324 0.01% 85 2803 0.01% 86 2915 0.01% 87 2996 0.02% 88 3127 0.02% 89 3308 0.02% 90 3588 0.02% 91 3823 0.02% 92 4150 0.02% 93 4428 0.02% 94 4898 0.02% 95 5305 0.03% 96 5504 0.03% 97 6072 0.03% 98 6197 0.03% 99 6636 0.03% 100 7115 0.04% 101 7576 0.04% 102 8159 0.04% 103 8809 0.04% 104 9308 0.05% 105 9859 0.05% 106 10488 0.05% 107 11077 0.06% 108 11735 0.06% 109 12133 0.06% 110 12775 0.06% 111 13454 0.07% 112 14636 0.07% 113 15056 0.08% 114 16298 0.08% 115 17011 0.09% 116 17946 0.09% 117 18792 0.09% 118 19344 0.10% 119 20103 0.10% 120 20910 0.10% 121 21797 0.11% 122 23274 0.12% 123 24108 0.12% 124 25959 0.13% 125 27080 0.14% 126 27951 0.14% 127 29257 0.15% 128 30575 0.15% 129 31872 0.16% 130 32777 0.16% 131 34553 0.17% 132 37046 0.19% 133 38837 0.19% 134 40281 0.20% 135 42832 0.21% 136 45517 0.23% 137 47729 0.24% 138 50496 0.25% 139 54321 0.27% 140 57453 0.29% 141 62012 0.31% 142 68853 0.35% 143 76737 0.38% 144 86771 0.43% 145 103339 0.52% 146 125235 0.63% 147 166415 0.83% 148 250086 1.25% 149 496097 2.49% 150 3842831 19.26% 151 13589846 68.10% 19955722 reads passed initial QC criterion=sequence-density sequence-density=1.13 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=18 prefix-density=1.17 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=43.81 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.9 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=3.52 fanout-score-rank=17 prefix-density=0.80 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=28.82 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=5.4 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958354 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:48:48 Started mapping on | Dec 06 20:48:48 Finished on | Dec 06 20:50:57 Mapping speed, Million of reads per hour | 556.90 Number of input reads | 19955722 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 19371734 Uniquely mapped reads % | 97.07% Average mapped length | 297.59 Number of splices: Total | 22334290 Number of splices: Annotated (sjdb) | 21061923 Number of splices: GT/AG | 22038320 Number of splices: GC/AG | 258192 Number of splices: AT/AC | 7915 Number of splices: Non-canonical | 29863 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.43 Insertion rate per base | 0.01% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 157152 % of reads mapped to multiple loci | 0.79% Number of reads mapped to too many loci | 17920 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.51% % of reads unmapped: other | 0.54% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 435477 435477 435477 N_multimapping 157152 157152 157152 N_noFeature 664806 18815121 819559 N_ambiguous 480109 2751 79588 UnstrandedReadsAssigned:18226819 PositiveStrandReadsAssigned:553862 NegativeStrandReadsAssigned:18472587 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958354 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958354-trimmed-pair1.fastq SRR6958354-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,955,722 reads, 18,463,059 reads pseudoaligned [quant] estimated average fragment length: 271.093 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52973 SRR6958354.ke.tsv 35125 SRR6958354.se.tsv 88098 total ==> SRR6958354.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 666.48 0 0 PNS24247 1044 773.907 59.8484 6.16284 PNS24249 1928 1657.91 58.6637 2.81985 PNS24246 1044 773.907 59.8484 6.16284 PNS24248 1044 773.907 59.8484 6.16284 PNS24244 1471 1200.91 18.7911 1.24698 PNS24243 293 81.8285 0 0 KQK14069 1603 1332.91 3349.58 200.266 KQK14071 474 220.783 69.6024 25.1232 ==> SRR6958354.se.tsv <== BRADI_1g14170v3 3776 BRADI_1g53295v3 195 BRADI_1g59795v3 228 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 239 BRADI_1g74790v3 77 BRADI_1g09890v3 0 BRADI_1g77505v3 207 BRADI_1g48960v3 0 SRR6958354 completed mapping pipeline successfully