Starting /dee2/code/volunteer_pipeline.sh SRR6958355 current disk space = 1549338292224 free memory = 1600880396 SRR6958355 SRAfilesize aba88d8e62a368e9bc751cf02b435e11 SRR6958355.sra SRR6958355.sra file validated SRR6958355 is paired end SRR6958355 is conventional basespace SRR6958355 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958355_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.1105 30.0 18.0 33.0 18.0 34.0 2 31.11025 31.0 30.0 33.0 27.0 34.0 3 32.284 33.0 33.0 33.0 30.0 34.0 4 32.544 33.0 33.0 33.0 31.0 34.0 5 32.968 33.0 33.0 34.0 31.0 34.0 6 35.37275 37.0 35.0 38.0 29.0 38.0 7 36.97725 38.0 37.0 38.0 35.0 38.0 8 37.3315 38.0 38.0 38.0 36.0 38.0 9 37.47 38.0 38.0 38.0 37.0 38.0 10-14 37.477349999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.5656 38.0 38.0 38.0 38.0 38.0 20-24 37.549600000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.51625 38.0 38.0 38.0 37.2 38.0 30-34 37.532799999999995 38.0 38.0 38.0 37.4 38.0 35-39 37.5025 38.0 38.0 38.0 37.2 38.0 40-44 37.4572 38.0 38.0 38.0 37.0 38.0 45-49 37.4262 38.0 38.0 38.0 37.0 38.0 50-54 37.3344 38.0 38.0 38.0 37.0 38.0 55-59 36.7663 38.0 38.0 38.0 36.0 38.0 60-64 36.49475 38.0 38.0 38.0 35.8 38.0 65-69 36.967650000000006 38.0 38.0 38.0 36.0 38.0 70-74 37.1552 38.0 38.0 38.0 36.0 38.0 75-79 37.19675 38.0 38.0 38.0 36.0 38.0 80-84 37.038250000000005 38.0 38.0 38.0 35.6 38.0 85-89 36.982949999999995 38.0 38.0 38.0 35.0 38.0 90-94 36.878 38.0 38.0 38.0 35.0 38.0 95-99 36.825649999999996 38.0 38.0 38.0 35.0 38.0 100-104 36.62675 38.0 38.0 38.0 34.0 38.0 105-109 36.5366 38.0 38.0 38.0 34.0 38.0 110-114 36.388349999999996 38.0 38.0 38.0 33.8 38.0 115-119 36.23815 38.0 37.4 38.0 33.2 38.0 120-124 35.8852 38.0 36.6 38.0 31.4 38.0 125-129 35.44879999999999 38.0 36.0 38.0 31.0 38.0 130-134 35.35934999999999 38.0 36.0 38.0 29.6 38.0 135-139 34.600100000000005 38.0 34.6 38.0 27.6 38.0 140-144 34.1136 38.0 33.8 38.0 24.8 38.0 145-149 33.51045 38.0 33.0 38.0 22.2 38.0 150-151 28.35875 34.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 1.0 19 1.0 20 3.0 21 2.0 22 7.0 23 8.0 24 9.0 25 9.0 26 15.0 27 15.0 28 26.0 29 26.0 30 37.0 31 53.0 32 80.0 33 99.0 34 178.0 35 318.0 36 872.0 37 2238.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.775 13.575000000000001 8.799999999999999 36.85 2 24.175 12.2 34.2 29.425 3 19.775000000000002 16.825000000000003 26.974999999999998 36.425000000000004 4 24.275 23.0 22.775000000000002 29.95 5 26.674999999999997 27.200000000000003 23.974999999999998 22.15 6 24.575 29.75 23.25 22.425 7 18.85 23.95 37.375 19.825 8 21.475 23.025000000000002 29.375 26.125 9 20.075000000000003 22.075 32.5 25.35 10-14 23.321996598979695 26.537961388416527 25.227568270481143 24.912473742122636 15-19 22.91 24.635 26.71 25.745 20-24 23.705000000000002 24.895 26.02 25.380000000000003 25-29 23.474999999999998 25.165 25.83 25.53 30-34 22.975 25.31 25.96 25.755 35-39 23.385 24.945 25.945 25.724999999999998 40-44 23.235 24.95 26.055 25.759999999999998 45-49 23.075000000000003 25.005 25.979999999999997 25.94 50-54 23.41 24.63 25.935000000000002 26.025 55-59 23.53179835683132 25.30175474186023 25.606045237853735 25.560401663454712 60-64 23.50242161611012 24.659699209788428 26.06678562324751 25.77109355085394 65-69 23.63061797752809 24.37800963081862 26.003210272873194 25.988162118780096 70-74 23.76 25.165 25.724999999999998 25.35 75-79 23.645 25.035 25.8 25.52 80-84 23.97 24.895 25.290000000000003 25.845000000000002 85-89 23.64 24.41 25.64 26.31 90-94 23.46 24.68 25.27 26.590000000000003 95-99 23.794999999999998 24.560000000000002 25.874999999999996 25.77 100-104 23.535 25.130000000000003 25.619999999999997 25.715 105-109 24.02 24.575 25.974999999999998 25.430000000000003 110-114 23.97 24.935 25.235000000000003 25.86 115-119 23.915 24.6 25.869999999999997 25.615 120-124 24.125 24.455 25.590000000000003 25.83 125-129 24.19 24.745 25.055 26.009999999999998 130-134 24.495 24.085 25.715 25.705 135-139 24.29 24.89 25.69 25.130000000000003 140-144 24.529999999999998 24.875 24.825 25.77 145-149 24.145 24.52 25.430000000000003 25.905 150-151 24.5375 23.8875 25.174999999999997 26.400000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 2.0 28 2.0 29 5.5 30 6.5 31 8.5 32 11.0 33 15.0 34 25.5 35 37.5 36 45.0 37 53.0 38 76.0 39 101.5 40 115.5 41 145.0 42 167.0 43 176.5 44 195.5 45 204.0 46 211.0 47 209.0 48 197.5 49 184.0 50 163.5 51 149.5 52 138.0 53 126.5 54 112.0 55 99.0 56 92.5 57 85.0 58 84.0 59 87.5 60 90.0 61 82.0 62 70.0 63 65.5 64 62.0 65 57.5 66 47.0 67 40.5 68 39.5 69 29.5 70 22.0 71 18.0 72 14.0 73 12.5 74 8.5 75 3.5 76 1.5 77 1.0 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.03 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 1.41 60-64 1.925 65-69 0.32 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31972789115646 98.55000000000001 2 0.5794910556815319 1.15 3 0.10078105316200556 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.6499999999999999 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.5375 0.0 0.0 0.0 0.0 124-125 1.6625 0.0 0.0 0.0 0.0 126-127 1.85 0.0 0.0 0.0 0.0 128-129 1.9625 0.0 0.0 0.0 0.0 130-131 2.175 0.0 0.0 0.0 0.0 132-133 2.45 0.0 0.0 0.0 0.0 134-135 2.7249999999999996 0.0 0.0 0.0 0.0 136-137 3.125 0.0 0.0 0.0 0.0 138-139 3.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTGAA 10 0.0068910434 144.575 2 >>END_MODULE SRR6958355 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958355_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95025 33.0 33.0 34.0 32.0 34.0 2 33.0655 34.0 33.0 34.0 32.0 34.0 3 33.1055 34.0 33.0 34.0 32.0 34.0 4 33.0315 34.0 33.0 34.0 32.0 34.0 5 33.06875 34.0 33.0 34.0 33.0 34.0 6 37.2365 38.0 38.0 38.0 37.0 38.0 7 37.24225 38.0 38.0 38.0 37.0 38.0 8 37.26725 38.0 38.0 38.0 37.0 38.0 9 37.219 38.0 38.0 38.0 37.0 38.0 10-14 37.2235 38.0 38.0 38.0 37.0 38.0 15-19 37.1866 38.0 38.0 38.0 37.0 38.0 20-24 37.16525 38.0 38.0 38.0 37.0 38.0 25-29 37.20195 38.0 38.0 38.0 37.0 38.0 30-34 37.13415 38.0 38.0 38.0 37.0 38.0 35-39 37.084 38.0 38.0 38.0 36.4 38.0 40-44 37.0926 38.0 38.0 38.0 36.8 38.0 45-49 37.10425 38.0 38.0 38.0 36.4 38.0 50-54 37.014599999999994 38.0 38.0 38.0 36.4 38.0 55-59 37.0004 38.0 38.0 38.0 36.0 38.0 60-64 36.976800000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.89375 38.0 38.0 38.0 36.0 38.0 70-74 36.86805 38.0 38.0 38.0 35.6 38.0 75-79 36.8519 38.0 38.0 38.0 35.8 38.0 80-84 36.81765 38.0 38.0 38.0 35.4 38.0 85-89 36.72405 38.0 38.0 38.0 35.0 38.0 90-94 36.604949999999995 38.0 38.0 38.0 34.8 38.0 95-99 36.52105 38.0 38.0 38.0 34.6 38.0 100-104 36.42335 38.0 38.0 38.0 34.0 38.0 105-109 36.18525 38.0 38.0 38.0 33.8 38.0 110-114 36.03275 38.0 37.8 38.0 33.4 38.0 115-119 35.8044 38.0 37.4 38.0 32.2 38.0 120-124 35.7259 38.0 37.0 38.0 32.2 38.0 125-129 35.72 38.0 36.4 38.0 32.4 38.0 130-134 35.64655 38.0 36.2 38.0 32.4 38.0 135-139 35.3211 38.0 36.0 38.0 30.6 38.0 140-144 35.00699999999999 38.0 36.0 38.0 30.4 38.0 145-149 34.4786 38.0 35.0 38.0 28.8 38.0 150-151 30.142875 35.5 27.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 4.0 4 2.0 5 1.0 6 0.0 7 1.0 8 1.0 9 2.0 10 2.0 11 0.0 12 0.0 13 1.0 14 1.0 15 3.0 16 4.0 17 4.0 18 5.0 19 2.0 20 1.0 21 3.0 22 8.0 23 10.0 24 12.0 25 15.0 26 14.0 27 13.0 28 27.0 29 36.0 30 29.0 31 46.0 32 50.0 33 72.0 34 143.0 35 240.0 36 555.0 37 2687.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.875 19.400000000000002 11.95 29.775000000000002 2 29.349999999999998 24.675 25.025 20.95 3 22.75 27.224999999999998 26.35 23.674999999999997 4 25.7 31.65 20.025000000000002 22.625 5 25.95 33.650000000000006 19.125 21.275 6 22.575 35.55 20.175 21.7 7 23.25 19.525000000000002 33.15 24.075 8 24.775 23.1 23.925 28.199999999999996 9 24.2 23.275000000000002 26.400000000000002 26.125 10-14 26.605 25.629999999999995 22.62 25.145 15-19 25.724999999999998 24.795 24.395 25.085 20-24 25.945 25.259999999999998 24.055 24.740000000000002 25-29 26.05 24.72 24.21 25.019999999999996 30-34 25.395 25.255 24.18 25.169999999999998 35-39 25.61 25.835 23.915 24.64 40-44 25.585 25.69 23.555 25.169999999999998 45-49 25.900000000000002 24.834999999999997 24.485 24.779999999999998 50-54 26.06 25.374999999999996 24.01 24.555 55-59 26.634999999999998 24.975 23.695 24.695 60-64 25.840000000000003 25.095 24.505 24.560000000000002 65-69 26.625 25.064999999999998 24.23 24.08 70-74 25.28 25.28 24.83 24.610000000000003 75-79 25.52 25.395 24.075 25.009999999999998 80-84 25.965 25.5 23.86 24.675 85-89 26.035000000000004 25.16 24.474999999999998 24.33 90-94 26.08 24.67 24.5 24.75 95-99 25.75 25.36 24.29 24.6 100-104 25.82 25.605 24.099999999999998 24.474999999999998 105-109 25.77 25.85 24.37 24.01 110-114 26.009999999999998 25.825 23.955000000000002 24.21 115-119 26.279999999999998 25.335 24.12 24.265 120-124 25.95 25.665 24.365000000000002 24.02 125-129 26.695 25.365 24.365000000000002 23.575 130-134 26.765 24.79 24.6 23.845 135-139 26.435 25.46 24.8 23.305 140-144 26.43 25.275 24.884999999999998 23.41 145-149 26.41 25.66 24.555 23.375 150-151 26.6125 25.7125 23.825 23.849999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 1.5 28 1.0 29 1.0 30 3.0 31 5.5 32 6.5 33 10.5 34 16.0 35 20.5 36 31.5 37 48.5 38 66.5 39 81.5 40 96.5 41 127.5 42 156.5 43 173.0 44 186.0 45 193.5 46 202.5 47 207.0 48 190.5 49 166.0 50 147.5 51 134.5 52 132.5 53 131.0 54 114.0 55 105.0 56 108.5 57 109.0 58 103.0 59 105.0 60 94.5 61 79.5 62 83.0 63 72.5 64 72.0 65 77.0 66 69.5 67 58.5 68 45.5 69 38.0 70 38.0 71 32.0 72 22.0 73 14.5 74 9.0 75 4.5 76 1.5 77 1.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91166793216907 97.7 2 0.9870918754745633 1.95 3 0.07593014426727411 0.22499999999999998 4 0.0 0.0 5 0.02531004808909137 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.6499999999999999 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.5375 0.0 0.0 0.0 0.0 124-125 1.675 0.0 0.0 0.0 0.0 126-127 1.875 0.0 0.0 0.0 0.0 128-129 1.9874999999999998 0.0 0.0 0.0 0.0 130-131 2.2 0.0 0.0 0.0 0.0 132-133 2.4749999999999996 0.0 0.0 0.0 0.0 134-135 2.7875 0.0 0.025 0.0 0.0 136-137 3.175 0.0 0.025 0.0 0.0 138-139 3.575 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1295701 spots for SRR6958355.sra Written 1295701 spots for SRR6958355.sra Read 1295701 spots for SRR6958355.sra Written 1295701 spots for SRR6958355.sra Read 1295701 spots for SRR6958355.sra Written 1295701 spots for SRR6958355.sra Read 1295701 spots for SRR6958355.sra Written 1295701 spots for SRR6958355.sra Read 1295701 spots for SRR6958355.sra Written 1295701 spots for SRR6958355.sra Read 1295701 spots for SRR6958355.sra Written 1295701 spots for SRR6958355.sra Read 1295701 spots for SRR6958355.sra Written 1295701 spots for SRR6958355.sra Read 1295701 spots for SRR6958355.sra Written 1295701 spots for SRR6958355.sra Read 1295701 spots for SRR6958355.sra Written 1295701 spots for SRR6958355.sra Read 1295701 spots for SRR6958355.sra Written 1295701 spots for SRR6958355.sra Read 1295701 spots for SRR6958355.sra Written 1295701 spots for SRR6958355.sra Read 1295701 spots for SRR6958355.sra Written 1295701 spots for SRR6958355.sra Read 1295701 spots for SRR6958355.sra Written 1295701 spots for SRR6958355.sra Read 1295711 spots for SRR6958355.sra Written 1295711 spots for SRR6958355.sra Read 1295701 spots for SRR6958355.sra Written 1295701 spots for SRR6958355.sra Read 1295701 spots for SRR6958355.sra Written 1295701 spots for SRR6958355.sra Read 1295701 spots for SRR6958355.sra Written 1295701 spots for SRR6958355.sra Read 1295701 spots for SRR6958355.sra Written 1295701 spots for SRR6958355.sra Read 1295701 spots for SRR6958355.sra Written 1295701 spots for SRR6958355.sra Read 1295701 spots for SRR6958355.sra Written 1295701 spots for SRR6958355.sra SRR ids: ['SRR6958355.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p42ibv8y SRR6958355.sra spots: 25914030 blocks: [[1, 1295701], [1295702, 2591402], [2591403, 3887103], [3887104, 5182804], [5182805, 6478505], [6478506, 7774206], [7774207, 9069907], [9069908, 10365608], [10365609, 11661309], [11661310, 12957010], [12957011, 14252711], [14252712, 15548412], [15548413, 16844113], [16844114, 18139814], [18139815, 19435515], [19435516, 20731216], [20731217, 22026917], [22026918, 23322618], [23322619, 24618319], [24618320, 25914030]] SRR6958355 file size 8759714 SRR6958355 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958355 SRR6958355_1.fastq SRR6958355_2.fastq Input file: SRR6958355_1.fastq Paired file: SRR6958355_2.fastq trimmed: SRR6958355-trimmed-pair1.fastq, SRR6958355-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:50:24 2024 >> started Fri Dec 6 20:50:50 2024 >> done (26.672s) 25914030 read pairs processed; of these: 35300 ( 0.14%) short read pairs filtered out after trimming by size control 41865 ( 0.16%) empty read pairs filtered out after trimming by size control 25836865 (99.70%) read pairs available; of these: 10035298 (38.84%) trimmed read pairs available after processing 15801567 (61.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 4 0.00% 21 4 0.00% 22 8 0.00% 23 6 0.00% 24 7 0.00% 25 6 0.00% 26 9 0.00% 27 8 0.00% 28 9 0.00% 29 7 0.00% 30 6 0.00% 31 11 0.00% 32 7 0.00% 33 7 0.00% 34 5 0.00% 35 8 0.00% 36 11 0.00% 37 12 0.00% 38 13 0.00% 39 12 0.00% 40 12 0.00% 41 23 0.00% 42 15 0.00% 43 17 0.00% 44 21 0.00% 45 21 0.00% 46 20 0.00% 47 23 0.00% 48 21 0.00% 49 35 0.00% 50 28 0.00% 51 35 0.00% 52 33 0.00% 53 50 0.00% 54 51 0.00% 55 50 0.00% 56 68 0.00% 57 57 0.00% 58 73 0.00% 59 91 0.00% 60 112 0.00% 61 112 0.00% 62 127 0.00% 63 173 0.00% 64 150 0.00% 65 176 0.00% 66 200 0.00% 67 215 0.00% 68 225 0.00% 69 317 0.00% 70 295 0.00% 71 359 0.00% 72 407 0.00% 73 477 0.00% 74 665 0.00% 75 634 0.00% 76 731 0.00% 77 798 0.00% 78 856 0.00% 79 1067 0.00% 80 1167 0.00% 81 1375 0.01% 82 1604 0.01% 83 1937 0.01% 84 3171 0.01% 85 3919 0.02% 86 4152 0.02% 87 4448 0.02% 88 4615 0.02% 89 4767 0.02% 90 5061 0.02% 91 5311 0.02% 92 5752 0.02% 93 6056 0.02% 94 6521 0.03% 95 7129 0.03% 96 7309 0.03% 97 7931 0.03% 98 8176 0.03% 99 8999 0.03% 100 9512 0.04% 101 10307 0.04% 102 11126 0.04% 103 11709 0.05% 104 12743 0.05% 105 13867 0.05% 106 14571 0.06% 107 15261 0.06% 108 15892 0.06% 109 16880 0.07% 110 17882 0.07% 111 18939 0.07% 112 20499 0.08% 113 21297 0.08% 114 23145 0.09% 115 24328 0.09% 116 25858 0.10% 117 26906 0.10% 118 27951 0.11% 119 28783 0.11% 120 30239 0.12% 121 31836 0.12% 122 33388 0.13% 123 35583 0.14% 124 37062 0.14% 125 38968 0.15% 126 40659 0.16% 127 42589 0.16% 128 43772 0.17% 129 45446 0.18% 130 47894 0.19% 131 50433 0.20% 132 53108 0.21% 133 56214 0.22% 134 59071 0.23% 135 63595 0.25% 136 66471 0.26% 137 70512 0.27% 138 74463 0.29% 139 80257 0.31% 140 86119 0.33% 141 93833 0.36% 142 103562 0.40% 143 116224 0.45% 144 132512 0.51% 145 157637 0.61% 146 196674 0.76% 147 279689 1.08% 148 420427 1.63% 149 863912 3.34% 150 6107284 23.64% 151 15801567 61.16% 25836865 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=18 prefix-density=0.91 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=162.43 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.9 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.92 fanout-score-rank=22 prefix-density=0.63 prefix-fanout=2.5 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=17.76 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=1.6 sequence=GCCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGCTCCTTTCCA SRR6958355 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:51:43 Started mapping on | Dec 06 20:51:43 Finished on | Dec 06 20:54:38 Mapping speed, Million of reads per hour | 531.50 Number of input reads | 25836865 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 24755183 Uniquely mapped reads % | 95.81% Average mapped length | 296.86 Number of splices: Total | 29440187 Number of splices: Annotated (sjdb) | 27698584 Number of splices: GT/AG | 29030688 Number of splices: GC/AG | 347663 Number of splices: AT/AC | 10885 Number of splices: Non-canonical | 50951 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 278181 % of reads mapped to multiple loci | 1.08% Number of reads mapped to too many loci | 12898 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.76% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 821769 821769 821769 N_multimapping 278181 278181 278181 N_noFeature 703411 24058387 859811 N_ambiguous 633692 3171 94379 UnstrandedReadsAssigned:23418080 PositiveStrandReadsAssigned:693625 NegativeStrandReadsAssigned:23800993 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958355 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958355-trimmed-pair1.fastq SRR6958355-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,836,865 reads, 23,779,239 reads pseudoaligned [quant] estimated average fragment length: 273.795 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,199 rounds 52973 SRR6958355.ke.tsv 35125 SRR6958355.se.tsv 88098 total ==> SRR6958355.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 663.647 0 0 PNS24247 1044 771.206 84.631 6.74397 PNS24249 1928 1655.21 38.2412 1.41983 PNS24246 1044 771.206 84.631 6.74397 PNS24248 1044 771.206 84.631 6.74397 PNS24244 1471 1198.21 68.8657 3.53206 PNS24243 293 82.5903 0 0 KQK14069 1603 1330.21 6443.79 297.7 KQK14071 474 219.686 84.8147 23.726 ==> SRR6958355.se.tsv <== BRADI_1g14170v3 7119 BRADI_1g53295v3 1502 BRADI_1g59795v3 115 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 564 BRADI_1g74790v3 135 BRADI_1g09890v3 0 BRADI_1g77505v3 352 BRADI_1g48960v3 0 SRR6958355 completed mapping pipeline successfully