Starting /dee2/code/volunteer_pipeline.sh SRR6958356 current disk space = 1549324832768 free memory = 1601049120 SRR6958356 SRAfilesize 4236d28446d077f01155f7582087b192 SRR6958356.sra SRR6958356.sra file validated SRR6958356 is paired end SRR6958356 is conventional basespace SRR6958356 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958356_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.2995 31.0 18.0 33.0 18.0 33.0 2 24.24875 25.0 18.0 29.0 18.0 33.0 3 29.39275 30.0 27.0 33.0 25.0 33.0 4 30.0655 31.0 29.0 33.0 25.0 33.0 5 32.237 33.0 33.0 33.0 31.0 33.0 6 36.18825 38.0 36.0 38.0 33.0 38.0 7 36.606 38.0 37.0 38.0 34.0 38.0 8 37.19225 38.0 38.0 38.0 36.0 38.0 9 37.488 38.0 38.0 38.0 37.0 38.0 10-14 37.409400000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.465650000000004 38.0 38.0 38.0 37.4 38.0 20-24 37.5333 38.0 38.0 38.0 38.0 38.0 25-29 37.4671 38.0 38.0 38.0 37.8 38.0 30-34 37.34125 38.0 38.0 38.0 37.2 38.0 35-39 37.44955 38.0 38.0 38.0 37.4 38.0 40-44 37.51825 38.0 38.0 38.0 38.0 38.0 45-49 37.5004 38.0 38.0 38.0 38.0 38.0 50-54 37.32215 38.0 38.0 38.0 37.0 38.0 55-59 37.352549999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.47655 38.0 38.0 38.0 37.6 38.0 65-69 37.53645 38.0 38.0 38.0 38.0 38.0 70-74 37.166399999999996 38.0 38.0 38.0 36.4 38.0 75-79 37.462599999999995 38.0 38.0 38.0 37.6 38.0 80-84 37.393899999999995 38.0 38.0 38.0 37.2 38.0 85-89 37.1464 38.0 38.0 38.0 36.4 38.0 90-94 35.972 38.0 37.0 38.0 31.2 38.0 95-99 36.14975 38.0 37.4 38.0 32.6 38.0 100-104 36.20145 38.0 37.8 38.0 33.0 38.0 105-109 36.413500000000006 38.0 38.0 38.0 34.0 38.0 110-114 36.1614 38.0 37.8 38.0 33.0 38.0 115-119 36.65534999999999 38.0 38.0 38.0 34.6 38.0 120-124 36.8125 38.0 38.0 38.0 35.0 38.0 125-129 36.84095 38.0 38.0 38.0 35.0 38.0 130-134 36.72685 38.0 38.0 38.0 35.0 38.0 135-139 36.65295 38.0 38.0 38.0 34.6 38.0 140-144 36.237049999999996 38.0 38.0 38.0 33.8 38.0 145-149 35.76639999999999 38.0 36.6 38.0 33.0 38.0 150-151 29.3615 35.0 19.0 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 2.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 2.0 17 2.0 18 1.0 19 0.0 20 1.0 21 2.0 22 1.0 23 2.0 24 2.0 25 3.0 26 9.0 27 14.0 28 10.0 29 19.0 30 31.0 31 43.0 32 61.0 33 91.0 34 123.0 35 237.0 36 734.0 37 2606.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.759663423612935 11.72758348672101 8.466999737049697 42.04575335261636 2 23.150000000000002 15.775 27.950000000000003 33.125 3 21.775 17.275 22.925 38.025 4 26.450000000000003 22.875 20.8 29.875 5 26.875 26.85 23.575 22.7 6 22.85 30.975 22.5 23.674999999999997 7 17.4 22.575 39.95 20.075000000000003 8 19.75 24.425 29.275000000000002 26.55 9 18.875 22.900000000000002 31.95 26.275 10-14 22.925 26.44 26.145000000000003 24.490000000000002 15-19 22.205 24.85 26.334999999999997 26.61 20-24 22.48585873754818 25.203984582269612 26.315262551934726 25.994894128247488 25-29 23.135 24.935 26.369999999999997 25.56 30-34 23.175 24.925 26.229999999999997 25.669999999999998 35-39 22.939999999999998 25.235000000000003 25.715 26.11 40-44 23.325000000000003 25.45 25.545 25.679999999999996 45-49 23.48 24.905 26.07 25.545 50-54 22.975 25.255 25.745 26.025 55-59 23.095 25.35 25.755 25.8 60-64 23.3 25.074999999999996 26.119999999999997 25.505 65-69 23.375 24.605 26.090000000000003 25.929999999999996 70-74 23.53 24.515 26.314999999999998 25.64 75-79 23.07 25.069999999999997 26.015 25.845000000000002 80-84 23.335 25.295 25.580000000000002 25.790000000000003 85-89 23.655 24.474999999999998 26.135 25.735000000000003 90-94 23.945 24.759999999999998 25.435000000000002 25.86 95-99 23.585 24.645 25.465 26.305 100-104 24.0 24.68 25.679999999999996 25.64 105-109 23.16 25.09 25.525 26.224999999999998 110-114 23.735 24.55 25.935000000000002 25.779999999999998 115-119 23.7 24.41 26.05 25.840000000000003 120-124 23.575 24.935 25.69 25.8 125-129 24.060000000000002 25.290000000000003 25.83 24.82 130-134 23.61 25.005 25.430000000000003 25.955000000000002 135-139 24.11 24.77 25.445 25.674999999999997 140-144 23.974999999999998 24.535 25.44 26.05 145-149 23.98 24.884999999999998 25.314999999999998 25.82 150-151 23.549999999999997 24.099999999999998 25.55 26.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 1.0 24 1.5 25 1.0 26 0.5 27 0.0 28 2.0 29 3.5 30 5.0 31 7.5 32 11.5 33 15.0 34 15.5 35 25.0 36 41.0 37 60.5 38 79.0 39 90.0 40 109.5 41 142.5 42 186.0 43 217.0 44 217.5 45 214.0 46 220.5 47 214.0 48 199.0 49 183.0 50 164.0 51 148.5 52 131.0 53 119.0 54 105.0 55 87.0 56 87.0 57 84.0 58 67.5 59 70.5 60 83.5 61 73.5 62 59.0 63 61.0 64 63.5 65 60.5 66 46.5 67 36.5 68 33.0 69 30.5 70 29.5 71 22.0 72 19.0 73 16.5 74 13.0 75 8.5 76 4.5 77 2.5 78 0.5 79 2.5 80 2.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.11499999999999999 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19334509705067 98.375 2 0.7814469372321654 1.55 3 0.025207965717166627 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 1.05 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.3624999999999998 0.0 0.0 0.0 0.0 120-121 1.575 0.0 0.0 0.0 0.0 122-123 1.8 0.0 0.0 0.0 0.0 124-125 2.1125 0.0 0.0 0.0 0.0 126-127 2.25 0.0 0.0 0.0 0.0 128-129 2.5125 0.0 0.0 0.0 0.0 130-131 2.85 0.0 0.0 0.0 0.0 132-133 3.2750000000000004 0.0 0.0 0.0 0.0 134-135 3.6625 0.0 0.0 0.0 0.0 136-137 4.1 0.0 0.0 0.0 0.0 138-139 4.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958356 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958356_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9845 33.0 33.0 34.0 32.0 34.0 2 33.10825 34.0 33.0 34.0 33.0 34.0 3 33.16125 34.0 33.0 34.0 33.0 34.0 4 33.13125 34.0 33.0 34.0 33.0 34.0 5 33.08575 34.0 33.0 34.0 33.0 34.0 6 37.21875 38.0 38.0 38.0 37.0 38.0 7 37.1435 38.0 38.0 38.0 37.0 38.0 8 37.17125 38.0 38.0 38.0 37.0 38.0 9 37.10225 38.0 38.0 38.0 37.0 38.0 10-14 37.0188 38.0 38.0 38.0 36.8 38.0 15-19 36.96575 38.0 38.0 38.0 36.6 38.0 20-24 37.00554999999999 38.0 38.0 38.0 36.8 38.0 25-29 36.9946 38.0 38.0 38.0 37.0 38.0 30-34 37.1106 38.0 38.0 38.0 37.0 38.0 35-39 37.184 38.0 38.0 38.0 37.4 38.0 40-44 37.256499999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.175650000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.07855 38.0 38.0 38.0 37.0 38.0 55-59 36.751 38.0 38.0 38.0 35.8 38.0 60-64 36.1604 38.0 37.8 38.0 32.6 38.0 65-69 36.540000000000006 38.0 38.0 38.0 35.2 38.0 70-74 36.824200000000005 38.0 38.0 38.0 35.8 38.0 75-79 36.7764 38.0 38.0 38.0 35.8 38.0 80-84 36.64735 38.0 38.0 38.0 35.6 38.0 85-89 36.402300000000004 38.0 38.0 38.0 34.4 38.0 90-94 36.43415 38.0 38.0 38.0 34.0 38.0 95-99 36.83355 38.0 38.0 38.0 36.0 38.0 100-104 36.8292 38.0 38.0 38.0 36.0 38.0 105-109 36.717650000000006 38.0 38.0 38.0 35.2 38.0 110-114 36.58185 38.0 38.0 38.0 35.2 38.0 115-119 36.393649999999994 38.0 38.0 38.0 34.8 38.0 120-124 36.16225 38.0 38.0 38.0 33.8 38.0 125-129 33.74275 37.8 32.2 38.0 23.0 38.0 130-134 35.8827 38.0 38.0 38.0 33.0 38.0 135-139 35.964099999999995 38.0 38.0 38.0 33.4 38.0 140-144 35.7099 38.0 38.0 38.0 33.0 38.0 145-149 35.294349999999994 38.0 36.8 38.0 31.8 38.0 150-151 31.412125 35.5 30.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 7.0 4 5.0 5 2.0 6 1.0 7 1.0 8 0.0 9 0.0 10 1.0 11 2.0 12 3.0 13 0.0 14 0.0 15 1.0 16 2.0 17 0.0 18 2.0 19 3.0 20 1.0 21 4.0 22 7.0 23 15.0 24 7.0 25 9.0 26 19.0 27 11.0 28 17.0 29 26.0 30 46.0 31 40.0 32 57.0 33 79.0 34 109.0 35 196.0 36 503.0 37 2813.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.75 19.2 12.15 30.9 2 29.9 23.549999999999997 27.025 19.525000000000002 3 24.65 25.874999999999996 26.375 23.1 4 27.05 30.55 19.900000000000002 22.5 5 28.349999999999998 31.2 20.05 20.4 6 24.65 34.475 20.674999999999997 20.200000000000003 7 22.775000000000002 20.75 34.075 22.400000000000002 8 24.125 24.425 23.45 28.000000000000004 9 22.825 23.05 27.05 27.075 10-14 26.435 26.505000000000003 22.495 24.565 15-19 25.39 25.895000000000003 24.64 24.075 20-24 25.66 25.85 24.09 24.4 25-29 25.724999999999998 25.94 24.310000000000002 24.025 30-34 25.674999999999997 26.240000000000002 23.62 24.465 35-39 25.935000000000002 25.485000000000003 24.535 24.044999999999998 40-44 26.575 25.82 23.61 23.995 45-49 25.415 25.180000000000003 24.805 24.6 50-54 25.81 26.179999999999996 24.32 23.69 55-59 25.795 25.629999999999995 24.165 24.41 60-64 26.245 25.56 24.145 24.05 65-69 26.634999999999998 25.855 23.96 23.549999999999997 70-74 26.105 25.424999999999997 24.285 24.185000000000002 75-79 25.935000000000002 25.255 24.6 24.21 80-84 26.295 25.15 24.335 24.22 85-89 26.474999999999998 25.255 24.625 23.645 90-94 25.900000000000002 25.865 24.14 24.095 95-99 26.540000000000003 25.6 24.755 23.105 100-104 26.07 25.77 24.22 23.94 105-109 25.97 25.580000000000002 25.22 23.23 110-114 26.25 25.615 24.560000000000002 23.575 115-119 25.89 25.729999999999997 24.51 23.87 120-124 26.19 26.19 24.52 23.1 125-129 25.91 26.314999999999998 24.625 23.150000000000002 130-134 26.31 25.974999999999998 24.385 23.330000000000002 135-139 26.39 25.77 24.36 23.48 140-144 26.465 26.605 24.154999999999998 22.775000000000002 145-149 26.58 25.915 24.265 23.24 150-151 27.0625 26.424999999999997 24.4375 22.075 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 2.0 28 4.5 29 3.0 30 3.5 31 7.0 32 10.5 33 15.0 34 18.5 35 29.5 36 48.5 37 62.0 38 79.5 39 94.0 40 117.0 41 146.5 42 161.5 43 173.0 44 185.5 45 196.0 46 193.5 47 182.0 48 176.5 49 179.0 50 165.5 51 142.5 52 129.0 53 124.5 54 105.5 55 99.0 56 98.0 57 84.5 58 81.0 59 84.0 60 97.5 61 90.5 62 74.0 63 67.5 64 59.5 65 55.5 66 56.0 67 52.5 68 48.0 69 47.5 70 39.5 71 26.0 72 22.0 73 19.0 74 13.5 75 9.0 76 6.0 77 5.5 78 3.5 79 2.5 80 1.5 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.78357830714648 97.45 2 1.0897110998479473 2.15 3 0.10136847440446022 0.3 4 0.025342118601115054 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2125 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.7875000000000001 0.0 0.0 0.0 0.0 112-113 0.9125 0.0 0.0 0.0 0.0 114-115 1.075 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.35 0.0 0.0 0.0 0.0 120-121 1.525 0.0 0.0 0.0 0.0 122-123 1.7374999999999998 0.0 0.0 0.0 0.0 124-125 1.9874999999999998 0.0 0.0 0.0 0.0 126-127 2.125 0.0 0.0 0.0 0.0 128-129 2.3875 0.0 0.0 0.0 0.0 130-131 2.6875 0.0 0.0 0.0 0.0 132-133 3.0999999999999996 0.0 0.0 0.0 0.0 134-135 3.4875 0.0 0.0 0.0 0.0 136-137 3.9125 0.0 0.0 0.0 0.0 138-139 4.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATGAT 10 0.006830828 145.0 6 GTTCAAG 10 0.006830828 145.0 1 CATATCA 10 0.006830828 145.0 9 >>END_MODULE Read 775547 spots for SRR6958356.sra Written 775547 spots for SRR6958356.sra Read 775547 spots for SRR6958356.sra Written 775547 spots for SRR6958356.sra Read 775547 spots for SRR6958356.sra Written 775547 spots for SRR6958356.sra Read 775547 spots for SRR6958356.sra Written 775547 spots for SRR6958356.sra Read 775547 spots for SRR6958356.sra Written 775547 spots for SRR6958356.sra Read 775547 spots for SRR6958356.sra Written 775547 spots for SRR6958356.sra Read 775547 spots for SRR6958356.sra Written 775547 spots for SRR6958356.sra Read 775547 spots for SRR6958356.sra Written 775547 spots for SRR6958356.sra Read 775547 spots for SRR6958356.sra Written 775547 spots for SRR6958356.sra Read 775547 spots for SRR6958356.sra Written 775547 spots for SRR6958356.sra Read 775547 spots for SRR6958356.sra Written 775547 spots for SRR6958356.sra Read 775547 spots for SRR6958356.sra Written 775547 spots for SRR6958356.sra Read 775547 spots for SRR6958356.sra Written 775547 spots for SRR6958356.sra Read 775547 spots for SRR6958356.sra Written 775547 spots for SRR6958356.sra Read 775561 spots for SRR6958356.sra Written 775561 spots for SRR6958356.sra Read 775547 spots for SRR6958356.sra Written 775547 spots for SRR6958356.sra Read 775547 spots for SRR6958356.sra Written 775547 spots for SRR6958356.sra Read 775547 spots for SRR6958356.sra Written 775547 spots for SRR6958356.sra Read 775547 spots for SRR6958356.sra Written 775547 spots for SRR6958356.sra Read 775547 spots for SRR6958356.sra Written 775547 spots for SRR6958356.sra SRR ids: ['SRR6958356.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yrir5ota SRR6958356.sra spots: 15510954 blocks: [[1, 775547], [775548, 1551094], [1551095, 2326641], [2326642, 3102188], [3102189, 3877735], [3877736, 4653282], [4653283, 5428829], [5428830, 6204376], [6204377, 6979923], [6979924, 7755470], [7755471, 8531017], [8531018, 9306564], [9306565, 10082111], [10082112, 10857658], [10857659, 11633205], [11633206, 12408752], [12408753, 13184299], [13184300, 13959846], [13959847, 14735393], [14735394, 15510954]] SRR6958356 file size 5234452 SRR6958356 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958356 SRR6958356_1.fastq SRR6958356_2.fastq Input file: SRR6958356_1.fastq Paired file: SRR6958356_2.fastq trimmed: SRR6958356-trimmed-pair1.fastq, SRR6958356-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:50:35 2024 >> started Fri Dec 6 20:50:51 2024 >> done (15.683s) 15510954 read pairs processed; of these: 14880 ( 0.10%) short read pairs filtered out after trimming by size control 13718 ( 0.09%) empty read pairs filtered out after trimming by size control 15482356 (99.82%) read pairs available; of these: 4676479 (30.21%) trimmed read pairs available after processing 10805877 (69.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 3 0.00% 21 6 0.00% 22 3 0.00% 23 5 0.00% 24 4 0.00% 25 4 0.00% 26 4 0.00% 27 2 0.00% 28 7 0.00% 29 4 0.00% 30 7 0.00% 31 5 0.00% 32 3 0.00% 33 5 0.00% 34 10 0.00% 35 6 0.00% 36 4 0.00% 37 6 0.00% 38 8 0.00% 39 18 0.00% 40 11 0.00% 41 12 0.00% 42 9 0.00% 43 6 0.00% 44 16 0.00% 45 7 0.00% 46 13 0.00% 47 15 0.00% 48 15 0.00% 49 17 0.00% 50 29 0.00% 51 19 0.00% 52 33 0.00% 53 40 0.00% 54 56 0.00% 55 41 0.00% 56 54 0.00% 57 70 0.00% 58 61 0.00% 59 76 0.00% 60 76 0.00% 61 80 0.00% 62 108 0.00% 63 156 0.00% 64 150 0.00% 65 167 0.00% 66 187 0.00% 67 211 0.00% 68 211 0.00% 69 254 0.00% 70 278 0.00% 71 322 0.00% 72 425 0.00% 73 475 0.00% 74 524 0.00% 75 574 0.00% 76 703 0.00% 77 737 0.00% 78 804 0.01% 79 976 0.01% 80 1013 0.01% 81 1128 0.01% 82 1357 0.01% 83 1537 0.01% 84 2348 0.02% 85 2871 0.02% 86 3049 0.02% 87 3222 0.02% 88 3464 0.02% 89 3629 0.02% 90 3685 0.02% 91 3988 0.03% 92 4355 0.03% 93 4676 0.03% 94 4993 0.03% 95 5236 0.03% 96 5719 0.04% 97 6091 0.04% 98 6484 0.04% 99 6799 0.04% 100 7318 0.05% 101 7625 0.05% 102 8111 0.05% 103 8611 0.06% 104 9162 0.06% 105 9917 0.06% 106 10339 0.07% 107 10842 0.07% 108 11311 0.07% 109 12262 0.08% 110 12548 0.08% 111 13135 0.08% 112 13811 0.09% 113 14490 0.09% 114 15575 0.10% 115 16582 0.11% 116 17298 0.11% 117 18092 0.12% 118 18560 0.12% 119 19074 0.12% 120 20054 0.13% 121 20848 0.13% 122 21408 0.14% 123 22642 0.15% 124 23693 0.15% 125 24642 0.16% 126 25773 0.17% 127 26826 0.17% 128 27674 0.18% 129 29140 0.19% 130 30087 0.19% 131 31338 0.20% 132 32437 0.21% 133 33972 0.22% 134 35138 0.23% 135 36574 0.24% 136 38680 0.25% 137 40383 0.26% 138 41894 0.27% 139 44773 0.29% 140 46862 0.30% 141 50050 0.32% 142 54117 0.35% 143 59341 0.38% 144 65208 0.42% 145 74704 0.48% 146 87925 0.57% 147 111272 0.72% 148 159869 1.03% 149 310752 2.01% 150 2709961 17.50% 151 10805877 69.79% 15482356 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=3.02 fanout-score-rank=15 prefix-density=0.91 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=19.24 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.83 fanout-score-rank=15 prefix-density=0.58 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=69.80 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=6.2 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958356 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:52:36 Started mapping on | Dec 06 20:52:36 Finished on | Dec 06 20:54:29 Mapping speed, Million of reads per hour | 493.24 Number of input reads | 15482356 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14610999 Uniquely mapped reads % | 94.37% Average mapped length | 296.84 Number of splices: Total | 17058212 Number of splices: Annotated (sjdb) | 16088241 Number of splices: GT/AG | 16822958 Number of splices: GC/AG | 199444 Number of splices: AT/AC | 5883 Number of splices: Non-canonical | 29927 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 249536 % of reads mapped to multiple loci | 1.61% Number of reads mapped to too many loci | 39559 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.15% % of reads unmapped: other | 1.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 631348 631348 631348 N_multimapping 249536 249536 249536 N_noFeature 523793 14182839 630412 N_ambiguous 375689 1746 54744 UnstrandedReadsAssigned:13711517 PositiveStrandReadsAssigned:426414 NegativeStrandReadsAssigned:13925843 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6958356 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958356-trimmed-pair1.fastq SRR6958356-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,482,356 reads, 13,951,124 reads pseudoaligned [quant] estimated average fragment length: 261.833 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52973 SRR6958356.ke.tsv 35125 SRR6958356.se.tsv 88098 total ==> SRR6958356.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 675.672 0 0 PNS24247 1044 783.167 38.1343 5.07679 PNS24249 1928 1667.17 45.2684 2.83102 PNS24246 1044 783.167 38.1343 5.07679 PNS24248 1044 783.167 38.1343 5.07679 PNS24244 1471 1210.17 4.32866 0.372938 PNS24243 293 85.7053 0 0 KQK14069 1603 1342.17 5150.07 400.069 KQK14071 474 227.592 112.081 51.3453 ==> SRR6958356.se.tsv <== BRADI_1g14170v3 5784 BRADI_1g53295v3 572 BRADI_1g59795v3 79 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 168 BRADI_1g74790v3 47 BRADI_1g09890v3 0 BRADI_1g77505v3 215 BRADI_1g48960v3 0 SRR6958356 completed mapping pipeline successfully