Starting /dee2/code/volunteer_pipeline.sh SRR6958357 current disk space = 1549221519360 free memory = 1595498216 SRR6958357 SRAfilesize ad37faa686d83d862c929d1c24241209 SRR6958357.sra SRR6958357.sra file validated SRR6958357 is paired end SRR6958357 is conventional basespace SRR6958357 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958357_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.999 33.0 32.0 34.0 2.0 34.0 2 32.14025 33.0 31.0 34.0 28.0 34.0 3 31.82575 33.0 31.0 34.0 27.0 34.0 4 32.799 33.0 33.0 34.0 31.0 34.0 5 33.18325 34.0 33.0 34.0 33.0 34.0 6 37.33325 38.0 38.0 38.0 36.0 38.0 7 37.45475 38.0 38.0 38.0 37.0 38.0 8 37.60775 38.0 38.0 38.0 38.0 38.0 9 37.6555 38.0 38.0 38.0 38.0 38.0 10-14 37.47515 38.0 38.0 38.0 37.8 38.0 15-19 37.56054999999999 38.0 38.0 38.0 37.8 38.0 20-24 37.5064 38.0 38.0 38.0 37.8 38.0 25-29 37.122299999999996 38.0 38.0 38.0 36.2 38.0 30-34 37.44924999999999 38.0 38.0 38.0 37.2 38.0 35-39 36.999300000000005 38.0 38.0 38.0 35.6 38.0 40-44 37.526349999999994 38.0 38.0 38.0 37.8 38.0 45-49 37.34815 38.0 38.0 38.0 36.8 38.0 50-54 37.194900000000004 38.0 38.0 38.0 36.4 38.0 55-59 37.203250000000004 38.0 38.0 38.0 36.4 38.0 60-64 37.3275 38.0 38.0 38.0 37.0 38.0 65-69 37.352 38.0 38.0 38.0 37.0 38.0 70-74 37.2685 38.0 38.0 38.0 36.6 38.0 75-79 37.2138 38.0 38.0 38.0 36.2 38.0 80-84 37.12435 38.0 38.0 38.0 36.0 38.0 85-89 36.550700000000006 38.0 38.0 38.0 34.4 38.0 90-94 35.81245 38.0 37.4 38.0 31.4 38.0 95-99 34.11675 37.8 33.0 38.0 24.4 38.0 100-104 35.552350000000004 38.0 36.8 38.0 29.6 38.0 105-109 35.5064 38.0 36.6 38.0 30.0 38.0 110-114 35.28600000000001 38.0 36.0 38.0 29.0 38.0 115-119 35.5184 38.0 36.0 38.0 31.0 38.0 120-124 35.4345 38.0 36.4 38.0 30.2 38.0 125-129 35.15835 38.0 36.0 38.0 29.2 38.0 130-134 34.85959999999999 38.0 35.8 38.0 28.0 38.0 135-139 34.09439999999999 38.0 33.8 38.0 24.2 38.0 140-144 32.9429 38.0 33.0 38.0 18.8 38.0 145-149 32.007250000000006 38.0 32.2 38.0 10.6 38.0 150-151 26.218875 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 2.0 15 0.0 16 3.0 17 0.0 18 2.0 19 3.0 20 4.0 21 7.0 22 5.0 23 7.0 24 13.0 25 17.0 26 15.0 27 26.0 28 36.0 29 49.0 30 51.0 31 100.0 32 94.0 33 133.0 34 226.0 35 382.0 36 860.0 37 1963.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.38434579439252 10.367990654205608 8.820093457943926 39.427570093457945 2 24.675 13.525 34.050000000000004 27.750000000000004 3 22.75 18.4 23.7 35.15 4 26.25 24.525 21.725 27.500000000000004 5 26.1 28.7 22.325 22.875 6 22.475 31.574999999999996 24.85 21.099999999999998 7 16.925 23.674999999999997 40.050000000000004 19.35 8 20.375 23.275000000000002 29.9 26.450000000000003 9 19.425 21.375 32.85 26.35 10-14 22.805 26.195 25.97 25.03 15-19 23.200000000000003 24.755 26.529999999999998 25.515 20-24 23.07 25.275 26.365 25.290000000000003 25-29 22.900000000000002 25.765 25.840000000000003 25.495 30-34 23.235 25.03 25.82 25.915 35-39 23.375 25.335 25.929999999999996 25.36 40-44 22.46 25.655 25.5 26.384999999999998 45-49 23.275000000000002 24.785 25.669999999999998 26.27 50-54 23.11 24.91 26.115 25.865 55-59 22.95 25.335 26.195 25.52 60-64 23.39 24.68 26.185000000000002 25.745 65-69 23.29 25.45 25.75 25.509999999999998 70-74 23.400000000000002 25.124999999999996 25.36 26.115 75-79 23.94 24.875 25.540000000000003 25.645 80-84 23.74 24.89 25.64 25.729999999999997 85-89 23.215 24.83 25.89 26.064999999999998 90-94 23.645 25.240000000000002 25.480000000000004 25.635 95-99 23.23 24.86 26.185000000000002 25.724999999999998 100-104 23.75 24.67 25.874999999999996 25.705 105-109 23.69 25.080000000000002 25.83 25.4 110-114 23.845 24.47 26.075 25.61 115-119 23.3 25.35 25.929999999999996 25.419999999999998 120-124 23.335 25.380000000000003 25.47 25.814999999999998 125-129 23.25 25.455 25.485000000000003 25.81 130-134 23.375 24.855 25.605 26.165 135-139 24.495 24.765 25.305 25.435000000000002 140-144 23.435 24.990000000000002 25.915 25.66 145-149 24.065 24.94 25.330000000000002 25.665 150-151 24.325 24.125 25.724999999999998 25.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 1.5 28 3.0 29 3.5 30 5.0 31 9.0 32 8.5 33 12.0 34 26.0 35 34.0 36 44.5 37 64.0 38 78.5 39 88.0 40 124.5 41 153.5 42 171.0 43 194.0 44 205.5 45 209.5 46 205.0 47 202.0 48 194.0 49 184.0 50 188.0 51 176.5 52 149.5 53 129.0 54 109.0 55 98.0 56 84.5 57 84.0 58 84.5 59 80.0 60 79.0 61 75.5 62 64.0 63 50.5 64 46.5 65 45.5 66 43.0 67 35.5 68 29.0 69 27.5 70 23.0 71 19.0 72 20.5 73 16.5 74 8.5 75 3.5 76 1.5 77 2.0 78 2.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 14.399999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.5875 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.775 0.0 0.0 0.0 0.0 114-115 0.8875 0.0 0.0 0.0 0.0 116-117 1.025 0.0 0.0 0.0 0.0 118-119 1.2125 0.0 0.0 0.0 0.0 120-121 1.3375 0.0 0.0 0.0 0.0 122-123 1.4874999999999998 0.0 0.0 0.0 0.0 124-125 1.625 0.0 0.0 0.0 0.0 126-127 1.7999999999999998 0.0 0.0 0.0 0.0 128-129 2.0 0.0 0.0 0.0 0.0 130-131 2.1624999999999996 0.0 0.0 0.0 0.0 132-133 2.4375 0.0 0.0 0.0 0.0 134-135 2.625 0.0 0.0 0.0 0.0 136-137 2.875 0.0 0.0 0.0 0.0 138-139 2.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958357 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958357_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94475 33.0 33.0 34.0 32.0 34.0 2 33.15525 34.0 33.0 34.0 32.0 34.0 3 32.997 34.0 33.0 34.0 32.0 34.0 4 32.94725 34.0 33.0 34.0 32.0 34.0 5 32.901 34.0 33.0 34.0 32.0 34.0 6 37.181 38.0 38.0 38.0 37.0 38.0 7 37.22475 38.0 38.0 38.0 37.0 38.0 8 36.90125 38.0 38.0 38.0 36.0 38.0 9 36.92325 38.0 38.0 38.0 36.0 38.0 10-14 36.87435000000001 38.0 38.0 38.0 36.0 38.0 15-19 36.9199 38.0 38.0 38.0 36.0 38.0 20-24 36.94055 38.0 38.0 38.0 35.8 38.0 25-29 37.12264999999999 38.0 38.0 38.0 36.6 38.0 30-34 37.25215 38.0 38.0 38.0 37.0 38.0 35-39 37.31565 38.0 38.0 38.0 37.4 38.0 40-44 35.1041 37.8 35.0 38.0 28.2 38.0 45-49 35.2728 37.8 35.6 38.0 29.2 38.0 50-54 34.73865 37.8 34.2 38.0 27.2 38.0 55-59 35.183949999999996 37.8 35.4 38.0 29.2 38.0 60-64 36.53415 38.0 37.8 38.0 34.2 38.0 65-69 36.2384 38.0 37.6 38.0 32.8 38.0 70-74 36.092150000000004 38.0 37.4 38.0 32.4 38.0 75-79 36.1887 38.0 37.8 38.0 33.2 38.0 80-84 36.05585000000001 38.0 38.0 38.0 32.8 38.0 85-89 35.95055000000001 38.0 37.6 38.0 32.4 38.0 90-94 35.8914 38.0 37.2 38.0 32.2 38.0 95-99 36.0445 38.0 37.8 38.0 33.4 38.0 100-104 34.34575 37.8 33.4 38.0 25.8 38.0 105-109 35.80305 38.0 37.4 38.0 31.8 38.0 110-114 35.43275 38.0 37.0 38.0 31.0 38.0 115-119 34.7217 38.0 36.0 38.0 27.4 38.0 120-124 30.256850000000004 34.0 25.8 38.0 15.8 38.0 125-129 28.709750000000003 33.0 20.4 38.0 12.4 38.0 130-134 29.43795 34.4 23.2 38.0 12.6 38.0 135-139 32.15375 37.6 31.6 38.0 13.0 38.0 140-144 30.8979 37.6 29.0 38.0 11.2 38.0 145-149 29.409550000000003 36.6 25.4 38.0 2.0 38.0 150-151 23.82075 29.5 15.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 2.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 2.0 12 1.0 13 1.0 14 4.0 15 2.0 16 5.0 17 11.0 18 7.0 19 11.0 20 19.0 21 13.0 22 22.0 23 27.0 24 26.0 25 44.0 26 42.0 27 54.0 28 57.0 29 62.0 30 91.0 31 108.0 32 145.0 33 185.0 34 326.0 35 591.0 36 1253.0 37 880.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.1 19.225 11.975 32.7 2 30.375000000000004 22.775000000000002 27.0 19.85 3 23.575 26.200000000000003 25.95 24.275 4 26.025 31.674999999999997 19.625 22.675 5 27.85 33.275 19.75 19.125 6 23.549999999999997 34.675 20.65 21.125 7 22.325 19.325 35.825 22.525000000000002 8 23.45 22.475 24.325 29.75 9 22.8 22.575 27.950000000000003 26.674999999999997 10-14 25.905 26.3 22.78 25.014999999999997 15-19 25.895000000000003 25.665 24.26 24.18 20-24 25.424999999999997 26.365 23.849999999999998 24.36 25-29 25.085 25.765 24.265 24.884999999999998 30-34 25.52 25.56 24.555 24.365000000000002 35-39 25.3 25.94 24.48 24.279999999999998 40-44 25.665 25.169999999999998 24.385 24.779999999999998 45-49 25.71 25.424999999999997 24.725 24.14 50-54 26.0 25.535000000000004 24.705 23.76 55-59 25.455 25.27 24.715 24.560000000000002 60-64 25.765 25.285000000000004 24.62 24.33 65-69 25.740000000000002 25.174999999999997 24.83 24.255 70-74 25.16 25.629999999999995 24.44 24.77 75-79 26.025 25.575 24.725 23.674999999999997 80-84 26.224999999999998 25.790000000000003 24.245 23.74 85-89 25.509999999999998 25.755 24.715 24.02 90-94 25.615 25.82 24.75 23.815 95-99 26.11 24.95 24.805 24.135 100-104 26.145000000000003 25.345000000000002 24.54 23.97 105-109 25.915 25.430000000000003 24.735 23.919999999999998 110-114 26.61 25.655 24.18 23.555 115-119 26.169999999999998 25.635 24.884999999999998 23.31 120-124 26.495 25.72 24.81 22.975 125-129 26.205000000000002 26.275 24.355 23.165 130-134 26.56 25.97 24.26 23.21 135-139 26.88 25.53 24.709999999999997 22.88 140-144 26.255 26.135 24.235 23.375 145-149 26.529999999999998 26.015 24.48 22.975 150-151 27.500000000000004 26.05 24.15 22.3 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 1.0 24 1.0 25 1.0 26 0.5 27 1.5 28 1.5 29 3.0 30 7.5 31 9.0 32 10.0 33 10.5 34 15.0 35 22.0 36 31.0 37 54.5 38 77.5 39 94.0 40 120.5 41 148.0 42 161.5 43 169.0 44 187.5 45 202.0 46 206.0 47 198.0 48 188.0 49 183.5 50 163.5 51 151.0 52 143.5 53 124.5 54 109.0 55 100.0 56 96.0 57 94.5 58 87.5 59 77.5 60 74.5 61 84.0 62 86.5 63 66.5 64 59.0 65 58.5 66 51.0 67 45.0 68 42.5 69 46.5 70 40.5 71 26.5 72 16.5 73 19.0 74 15.5 75 7.0 76 5.0 77 1.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.8500000000000001 0.0 0.0 0.0 0.0 118-119 0.9625 0.0 0.0 0.0 0.0 120-121 1.05 0.0 0.0 0.0 0.0 122-123 1.1375000000000002 0.0 0.0 0.0 0.0 124-125 1.25 0.0 0.0 0.0 0.0 126-127 1.4 0.0 0.0 0.0 0.0 128-129 1.575 0.0 0.0 0.0 0.0 130-131 1.675 0.0 0.0 0.0 0.0 132-133 1.8875000000000002 0.0 0.0 0.0 0.0 134-135 2.075 0.0 0.0 0.0 0.0 136-137 2.3 0.0 0.0 0.0 0.0 138-139 2.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1170805 spots for SRR6958357.sra Written 1170805 spots for SRR6958357.sra Read 1170805 spots for SRR6958357.sra Written 1170805 spots for SRR6958357.sra Read 1170805 spots for SRR6958357.sra Written 1170805 spots for SRR6958357.sra Read 1170812 spots for SRR6958357.sra Written 1170812 spots for SRR6958357.sra Read 1170805 spots for SRR6958357.sra Written 1170805 spots for SRR6958357.sra Read 1170805 spots for SRR6958357.sra Written 1170805 spots for SRR6958357.sra Read 1170805 spots for SRR6958357.sra Written 1170805 spots for SRR6958357.sra Read 1170805 spots for SRR6958357.sra Written 1170805 spots for SRR6958357.sra Read 1170805 spots for SRR6958357.sra Written 1170805 spots for SRR6958357.sra Read 1170805 spots for SRR6958357.sra Written 1170805 spots for SRR6958357.sra Read 1170805 spots for SRR6958357.sra Written 1170805 spots for SRR6958357.sra Read 1170805 spots for SRR6958357.sra Written 1170805 spots for SRR6958357.sra Read 1170805 spots for SRR6958357.sra Written 1170805 spots for SRR6958357.sra Read 1170805 spots for SRR6958357.sra Written 1170805 spots for SRR6958357.sra Read 1170805 spots for SRR6958357.sra Written 1170805 spots for SRR6958357.sra Read 1170805 spots for SRR6958357.sra Written 1170805 spots for SRR6958357.sra Read 1170805 spots for SRR6958357.sra Written 1170805 spots for SRR6958357.sra Read 1170805 spots for SRR6958357.sra Written 1170805 spots for SRR6958357.sra Read 1170805 spots for SRR6958357.sra Written 1170805 spots for SRR6958357.sra Read 1170805 spots for SRR6958357.sra Written 1170805 spots for SRR6958357.sra SRR ids: ['SRR6958357.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7dbpqvq7 SRR6958357.sra spots: 23416107 blocks: [[1, 1170805], [1170806, 2341610], [2341611, 3512415], [3512416, 4683220], [4683221, 5854025], [5854026, 7024830], [7024831, 8195635], [8195636, 9366440], [9366441, 10537245], [10537246, 11708050], [11708051, 12878855], [12878856, 14049660], [14049661, 15220465], [15220466, 16391270], [16391271, 17562075], [17562076, 18732880], [18732881, 19903685], [19903686, 21074490], [21074491, 22245295], [22245296, 23416107]] SRR6958357 file size 7913249 SRR6958357 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958357 SRR6958357_1.fastq SRR6958357_2.fastq Input file: SRR6958357_1.fastq Paired file: SRR6958357_2.fastq trimmed: SRR6958357-trimmed-pair1.fastq, SRR6958357-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:51:44 2024 >> started Fri Dec 6 20:52:12 2024 >> done (27.161s) 23416107 read pairs processed; of these: 16484 ( 0.07%) short read pairs filtered out after trimming by size control 13927 ( 0.06%) empty read pairs filtered out after trimming by size control 23385696 (99.87%) read pairs available; of these: 10217569 (43.69%) trimmed read pairs available after processing 13168127 (56.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 6 0.00% 21 2 0.00% 22 2 0.00% 23 3 0.00% 24 8 0.00% 25 5 0.00% 26 2 0.00% 27 4 0.00% 28 6 0.00% 29 4 0.00% 30 6 0.00% 31 8 0.00% 32 8 0.00% 33 5 0.00% 34 10 0.00% 35 7 0.00% 36 8 0.00% 37 6 0.00% 38 12 0.00% 39 5 0.00% 40 12 0.00% 41 14 0.00% 42 5 0.00% 43 13 0.00% 44 9 0.00% 45 19 0.00% 46 12 0.00% 47 17 0.00% 48 23 0.00% 49 14 0.00% 50 33 0.00% 51 28 0.00% 52 29 0.00% 53 24 0.00% 54 39 0.00% 55 47 0.00% 56 46 0.00% 57 45 0.00% 58 53 0.00% 59 70 0.00% 60 85 0.00% 61 93 0.00% 62 118 0.00% 63 125 0.00% 64 131 0.00% 65 150 0.00% 66 171 0.00% 67 210 0.00% 68 199 0.00% 69 236 0.00% 70 243 0.00% 71 303 0.00% 72 356 0.00% 73 392 0.00% 74 457 0.00% 75 484 0.00% 76 579 0.00% 77 667 0.00% 78 791 0.00% 79 845 0.00% 80 984 0.00% 81 1087 0.00% 82 1339 0.01% 83 1583 0.01% 84 2285 0.01% 85 2841 0.01% 86 2986 0.01% 87 3179 0.01% 88 3276 0.01% 89 3465 0.01% 90 3611 0.02% 91 3999 0.02% 92 4370 0.02% 93 4674 0.02% 94 5225 0.02% 95 5609 0.02% 96 5998 0.03% 97 6204 0.03% 98 6754 0.03% 99 6980 0.03% 100 7762 0.03% 101 8246 0.04% 102 8933 0.04% 103 9764 0.04% 104 10643 0.05% 105 11228 0.05% 106 11961 0.05% 107 12489 0.05% 108 13126 0.06% 109 13849 0.06% 110 14582 0.06% 111 15389 0.07% 112 16428 0.07% 113 17810 0.08% 114 18908 0.08% 115 20058 0.09% 116 21248 0.09% 117 22165 0.09% 118 23207 0.10% 119 23870 0.10% 120 25319 0.11% 121 26485 0.11% 122 28053 0.12% 123 30122 0.13% 124 32060 0.14% 125 33973 0.15% 126 35486 0.15% 127 37892 0.16% 128 39543 0.17% 129 41612 0.18% 130 44458 0.19% 131 46284 0.20% 132 49990 0.21% 133 53160 0.23% 134 57174 0.24% 135 61147 0.26% 136 65015 0.28% 137 69408 0.30% 138 73835 0.32% 139 80111 0.34% 140 86480 0.37% 141 94909 0.41% 142 107112 0.46% 143 121226 0.52% 144 141208 0.60% 145 169894 0.73% 146 215027 0.92% 147 298979 1.28% 148 465267 1.99% 149 968692 4.14% 150 6232226 26.65% 151 13168127 56.31% 23385696 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.97 fanout-score-rank=23 prefix-density=0.68 prefix-fanout=2.8 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=83.20 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.21 fanout-score-rank=21 prefix-density=0.52 prefix-fanout=2.7 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=22.71 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=4.1 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958357 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:52:51 Started mapping on | Dec 06 20:52:52 Finished on | Dec 06 20:54:36 Mapping speed, Million of reads per hour | 809.50 Number of input reads | 23385696 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 22878114 Uniquely mapped reads % | 97.83% Average mapped length | 297.35 Number of splices: Total | 27186571 Number of splices: Annotated (sjdb) | 25663794 Number of splices: GT/AG | 26835069 Number of splices: GC/AG | 321819 Number of splices: AT/AC | 10663 Number of splices: Non-canonical | 19020 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 173703 % of reads mapped to multiple loci | 0.74% Number of reads mapped to too many loci | 16626 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.92% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 345058 345058 345058 N_multimapping 173703 173703 173703 N_noFeature 676880 22272373 826950 N_ambiguous 537958 2787 84023 UnstrandedReadsAssigned:21663276 PositiveStrandReadsAssigned:602954 NegativeStrandReadsAssigned:21967141 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958357 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958357-trimmed-pair1.fastq SRR6958357-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,385,696 reads, 22,007,443 reads pseudoaligned [quant] estimated average fragment length: 274.598 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,199 rounds 52973 SRR6958357.ke.tsv 35125 SRR6958357.se.tsv 88098 total ==> SRR6958357.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 663.041 7.61195 0.780783 PNS24247 1044 770.402 68.0159 6.00438 PNS24249 1928 1654.4 44.7833 1.84098 PNS24246 1044 770.402 68.0159 6.00438 PNS24248 1044 770.402 68.0159 6.00438 PNS24244 1471 1197.4 19.557 1.1108 PNS24243 293 81.1997 0 0 KQK14069 1603 1329.4 6223.93 318.408 KQK14071 474 218.808 103.992 32.323 ==> SRR6958357.se.tsv <== BRADI_1g14170v3 6874 BRADI_1g53295v3 362 BRADI_1g59795v3 251 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 454 BRADI_1g74790v3 93 BRADI_1g09890v3 0 BRADI_1g77505v3 270 BRADI_1g48960v3 0 SRR6958357 completed mapping pipeline successfully