Starting /dee2/code/volunteer_pipeline.sh SRR6958358 current disk space = 1549255004160 free memory = 1599982844 SRR6958358 SRAfilesize 6b2af8b22ba18308af373b36ca0dae77 SRR6958358.sra SRR6958358.sra file validated SRR6958358 is paired end SRR6958358 is conventional basespace SRR6958358 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958358_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.16925 27.0 18.0 33.0 18.0 33.0 2 29.1975 31.0 27.0 33.0 25.0 33.0 3 29.3455 31.0 28.0 33.0 25.0 33.0 4 31.979 33.0 31.0 33.0 30.0 33.0 5 32.53925 33.0 33.0 33.0 31.0 34.0 6 37.295 38.0 38.0 38.0 36.0 38.0 7 37.56275 38.0 38.0 38.0 37.0 38.0 8 37.43 38.0 38.0 38.0 37.0 38.0 9 37.6195 38.0 38.0 38.0 38.0 38.0 10-14 37.5052 38.0 38.0 38.0 37.8 38.0 15-19 37.50585 38.0 38.0 38.0 37.8 38.0 20-24 37.6087 38.0 38.0 38.0 38.0 38.0 25-29 37.52865 38.0 38.0 38.0 37.8 38.0 30-34 37.348749999999995 38.0 38.0 38.0 37.4 38.0 35-39 37.492399999999996 38.0 38.0 38.0 37.4 38.0 40-44 37.547850000000004 38.0 38.0 38.0 37.8 38.0 45-49 37.50205 38.0 38.0 38.0 37.6 38.0 50-54 37.342400000000005 38.0 38.0 38.0 37.2 38.0 55-59 37.3883 38.0 38.0 38.0 37.0 38.0 60-64 37.545 38.0 38.0 38.0 38.0 38.0 65-69 37.53645 38.0 38.0 38.0 38.0 38.0 70-74 37.1395 38.0 38.0 38.0 36.0 38.0 75-79 37.4637 38.0 38.0 38.0 37.4 38.0 80-84 37.414550000000006 38.0 38.0 38.0 37.4 38.0 85-89 37.19495 38.0 38.0 38.0 36.4 38.0 90-94 35.82715 38.0 36.8 38.0 30.2 38.0 95-99 36.103449999999995 38.0 37.2 38.0 32.4 38.0 100-104 36.249849999999995 38.0 37.6 38.0 32.6 38.0 105-109 36.30635 38.0 38.0 38.0 33.8 38.0 110-114 36.1853 38.0 37.6 38.0 33.2 38.0 115-119 36.68665 38.0 38.0 38.0 34.4 38.0 120-124 36.83905 38.0 38.0 38.0 35.0 38.0 125-129 36.88805 38.0 38.0 38.0 35.0 38.0 130-134 36.6984 38.0 38.0 38.0 34.6 38.0 135-139 36.628750000000004 38.0 38.0 38.0 34.6 38.0 140-144 36.215500000000006 38.0 38.0 38.0 33.6 38.0 145-149 35.63955 38.0 36.2 38.0 32.4 38.0 150-151 29.6385 35.5 19.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 2.0 17 0.0 18 0.0 19 1.0 20 0.0 21 0.0 22 1.0 23 0.0 24 1.0 25 10.0 26 10.0 27 14.0 28 16.0 29 18.0 30 28.0 31 39.0 32 65.0 33 75.0 34 134.0 35 248.0 36 708.0 37 2628.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.546934346174716 11.475854584915899 8.952794357026587 35.0244167118828 2 24.75 14.224999999999998 34.5 26.525 3 22.0 19.15 25.45 33.4 4 25.75 26.900000000000002 22.275 25.074999999999996 5 25.775 28.975 23.400000000000002 21.85 6 21.775 32.675 24.85 20.7 7 16.925 22.5 41.4 19.175 8 20.375 24.5 28.9 26.224999999999998 9 20.5 21.825 32.324999999999996 25.35 10-14 22.189999999999998 26.805 25.8 25.205 15-19 22.23 25.695 26.369999999999997 25.705 20-24 21.8687474989996 26.140456182472988 26.90076030412165 25.090036014405765 25-29 22.24 26.395000000000003 25.715 25.650000000000002 30-34 22.39 25.91 26.27 25.430000000000003 35-39 22.945 25.395 26.35 25.31 40-44 22.55 25.655 26.435 25.36 45-49 22.28 25.974999999999998 26.355 25.39 50-54 22.71 25.505 26.064999999999998 25.72 55-59 22.745 26.075 25.755 25.424999999999997 60-64 22.79 25.31 26.295 25.605 65-69 22.075 26.19 26.085 25.650000000000002 70-74 22.919999999999998 25.91 25.75 25.419999999999998 75-79 22.205 26.02 26.229999999999997 25.545 80-84 22.54 25.19 26.805 25.465 85-89 22.650000000000002 24.990000000000002 26.415 25.945 90-94 23.135 25.564999999999998 25.89 25.41 95-99 22.75 25.814999999999998 25.995 25.44 100-104 23.07 26.040000000000003 25.66 25.230000000000004 105-109 22.88 25.674999999999997 26.064999999999998 25.380000000000003 110-114 23.01 25.135 25.874999999999996 25.979999999999997 115-119 22.795 25.180000000000003 26.63 25.395 120-124 23.06 25.255 25.775 25.91 125-129 23.369999999999997 25.395 25.775 25.46 130-134 23.62 25.83 25.825 24.725 135-139 23.200000000000003 25.355 25.66 25.785000000000004 140-144 23.02 25.759999999999998 25.535000000000004 25.685000000000002 145-149 23.77 25.869999999999997 25.330000000000002 25.03 150-151 22.425 25.2875 26.6625 25.624999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.0 26 1.5 27 3.0 28 6.5 29 9.0 30 9.5 31 14.0 32 18.0 33 21.0 34 32.0 35 44.0 36 56.0 37 63.5 38 82.5 39 116.5 40 127.0 41 147.0 42 186.0 43 218.0 44 235.5 45 235.0 46 222.0 47 217.0 48 206.0 49 176.0 50 167.0 51 159.5 52 132.5 53 105.5 54 79.5 55 80.5 56 87.5 57 86.0 58 75.5 59 54.0 60 57.0 61 54.5 62 47.5 63 48.5 64 45.5 65 43.5 66 41.5 67 35.0 68 35.0 69 29.0 70 18.5 71 17.5 72 14.0 73 13.0 74 10.0 75 5.5 76 4.0 77 1.5 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.85 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.04 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.32499999999999996 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 0.975 0.0 0.0 0.0 0.0 116-117 1.1124999999999998 0.0 0.0 0.0 0.0 118-119 1.225 0.0 0.0 0.0 0.0 120-121 1.475 0.0 0.0 0.0 0.0 122-123 1.7374999999999998 0.0 0.0 0.0 0.0 124-125 2.0375 0.0 0.0 0.0 0.0 126-127 2.425 0.0 0.0 0.0 0.0 128-129 2.6125 0.0 0.0 0.0 0.0 130-131 2.8125 0.0 0.0 0.0 0.0 132-133 3.05 0.0 0.0 0.0 0.0 134-135 3.25 0.0 0.0 0.0 0.0 136-137 3.6125 0.0 0.0 0.0 0.0 138-139 4.050000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGGGA 10 0.0056249425 154.6 1 TGCATTG 10 0.0068396386 144.9375 3 CTGCATT 10 0.0068396386 144.9375 2 >>END_MODULE SRR6958358 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958358_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.03025 33.0 33.0 34.0 32.0 34.0 2 33.14125 34.0 33.0 34.0 33.0 34.0 3 33.20925 34.0 33.0 34.0 33.0 34.0 4 33.19525 34.0 33.0 34.0 33.0 34.0 5 33.07475 34.0 33.0 34.0 33.0 34.0 6 37.1705 38.0 38.0 38.0 37.0 38.0 7 37.21125 38.0 38.0 38.0 37.0 38.0 8 37.28525 38.0 38.0 38.0 37.0 38.0 9 37.113 38.0 38.0 38.0 37.0 38.0 10-14 37.050799999999995 38.0 38.0 38.0 36.6 38.0 15-19 37.026799999999994 38.0 38.0 38.0 36.4 38.0 20-24 37.115449999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.14425 38.0 38.0 38.0 37.0 38.0 30-34 37.2187 38.0 38.0 38.0 37.2 38.0 35-39 37.32084999999999 38.0 38.0 38.0 37.8 38.0 40-44 37.3654 38.0 38.0 38.0 37.8 38.0 45-49 37.2154 38.0 38.0 38.0 37.0 38.0 50-54 37.111850000000004 38.0 38.0 38.0 37.0 38.0 55-59 36.83195 38.0 38.0 38.0 35.8 38.0 60-64 36.4007 38.0 37.8 38.0 33.8 38.0 65-69 36.6917 38.0 38.0 38.0 35.2 38.0 70-74 36.82875 38.0 38.0 38.0 35.6 38.0 75-79 36.79985 38.0 38.0 38.0 35.8 38.0 80-84 36.6391 38.0 38.0 38.0 35.0 38.0 85-89 36.369749999999996 38.0 38.0 38.0 34.0 38.0 90-94 36.345150000000004 38.0 38.0 38.0 33.6 38.0 95-99 36.844849999999994 38.0 38.0 38.0 35.8 38.0 100-104 36.84839999999999 38.0 38.0 38.0 36.0 38.0 105-109 36.747 38.0 38.0 38.0 35.2 38.0 110-114 36.619350000000004 38.0 38.0 38.0 35.0 38.0 115-119 36.41825 38.0 38.0 38.0 34.4 38.0 120-124 36.00335 38.0 38.0 38.0 33.6 38.0 125-129 34.28190000000001 38.0 34.2 38.0 24.8 38.0 130-134 35.9039 38.0 38.0 38.0 33.0 38.0 135-139 35.8757 38.0 38.0 38.0 33.0 38.0 140-144 35.66435 38.0 38.0 38.0 32.6 38.0 145-149 35.319950000000006 38.0 36.8 38.0 31.6 38.0 150-151 31.446125000000002 35.5 31.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 1.0 4 2.0 5 2.0 6 2.0 7 2.0 8 2.0 9 0.0 10 1.0 11 2.0 12 0.0 13 1.0 14 2.0 15 2.0 16 3.0 17 4.0 18 3.0 19 3.0 20 3.0 21 4.0 22 2.0 23 3.0 24 4.0 25 12.0 26 12.0 27 30.0 28 25.0 29 26.0 30 37.0 31 40.0 32 51.0 33 100.0 34 117.0 35 197.0 36 495.0 37 2802.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.525 19.075 12.375 30.025000000000002 2 30.3 23.375 27.150000000000002 19.175 3 22.075 27.725 27.025 23.175 4 25.874999999999996 31.574999999999996 21.175 21.375 5 27.275 32.9 19.0 20.825 6 23.799999999999997 35.125 20.375 20.7 7 20.875 20.175 35.675000000000004 23.275000000000002 8 24.825 23.724999999999998 23.549999999999997 27.900000000000002 9 23.525 23.35 28.000000000000004 25.124999999999996 10-14 25.39 26.384999999999998 23.79 24.435000000000002 15-19 25.665 26.365 24.495 23.474999999999998 20-24 25.615 26.0 24.525 23.86 25-29 25.77 26.02 24.515 23.695 30-34 24.855 26.255 25.025 23.865 35-39 25.685000000000002 25.674999999999997 25.095 23.544999999999998 40-44 25.205 26.150000000000002 24.51 24.135 45-49 25.15 26.015 24.990000000000002 23.845 50-54 25.64 26.845000000000002 24.224999999999998 23.29 55-59 25.66 26.040000000000003 24.875 23.425 60-64 25.705 25.5 25.22 23.575 65-69 25.374999999999996 25.395 25.64 23.59 70-74 25.635 25.56 24.795 24.01 75-79 25.180000000000003 26.200000000000003 24.834999999999997 23.785 80-84 25.64 26.090000000000003 25.324999999999996 22.945 85-89 25.3 26.419999999999998 24.779999999999998 23.5 90-94 25.8 26.31 25.145 22.745 95-99 24.834999999999997 26.27 25.319999999999997 23.575 100-104 26.08 25.935000000000002 25.014999999999997 22.97 105-109 25.785000000000004 25.775 25.71 22.73 110-114 25.590000000000003 26.174999999999997 25.235000000000003 23.0 115-119 25.474999999999998 25.615 25.605 23.305 120-124 25.985000000000003 25.91 25.35 22.755 125-129 26.240000000000002 25.915 25.445 22.400000000000002 130-134 26.090000000000003 26.44 24.845 22.625 135-139 26.340000000000003 25.96 25.595000000000002 22.105 140-144 26.345000000000002 26.605 25.035 22.015 145-149 26.965 27.060000000000002 23.855 22.12 150-151 27.1375 26.674999999999997 24.5125 21.675 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 1.0 23 1.5 24 1.5 25 0.5 26 1.5 27 2.0 28 2.0 29 4.5 30 6.5 31 9.5 32 18.0 33 25.5 34 27.5 35 35.0 36 50.0 37 67.0 38 88.5 39 103.0 40 117.5 41 135.5 42 162.5 43 195.0 44 205.0 45 208.5 46 213.5 47 212.5 48 195.5 49 165.5 50 156.0 51 151.0 52 125.0 53 112.0 54 109.5 55 102.5 56 98.5 57 86.0 58 77.0 59 74.0 60 64.5 61 64.5 62 67.0 63 53.0 64 50.5 65 56.5 66 52.5 67 49.0 68 39.0 69 33.5 70 28.0 71 23.0 72 26.0 73 15.0 74 6.5 75 8.0 76 6.0 77 3.0 78 1.0 79 1.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.32499999999999996 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.6875 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.1375000000000002 0.0 0.0 0.0 0.0 118-119 1.25 0.0 0.0 0.0 0.0 120-121 1.4874999999999998 0.0 0.0 0.0 0.0 122-123 1.725 0.0 0.0 0.0 0.0 124-125 2.0125 0.0 0.0 0.0 0.0 126-127 2.4 0.0 0.0 0.0 0.0 128-129 2.5875000000000004 0.0 0.0 0.0 0.0 130-131 2.7874999999999996 0.0 0.0 0.0 0.0 132-133 3.0250000000000004 0.0 0.0 0.0 0.0 134-135 3.2249999999999996 0.0 0.0 0.0 0.0 136-137 3.5875000000000004 0.0 0.0 0.0 0.0 138-139 4.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 971543 spots for SRR6958358.sra Written 971543 spots for SRR6958358.sra Read 971543 spots for SRR6958358.sra Written 971543 spots for SRR6958358.sra Read 971543 spots for SRR6958358.sra Written 971543 spots for SRR6958358.sra Read 971543 spots for SRR6958358.sra Written 971543 spots for SRR6958358.sra Read 971543 spots for SRR6958358.sra Written 971543 spots for SRR6958358.sra Read 971543 spots for SRR6958358.sra Written 971543 spots for SRR6958358.sra Read 971543 spots for SRR6958358.sra Written 971543 spots for SRR6958358.sra Read 971543 spots for SRR6958358.sra Written 971543 spots for SRR6958358.sra Read 971543 spots for SRR6958358.sra Written 971543 spots for SRR6958358.sra Read 971543 spots for SRR6958358.sra Written 971543 spots for SRR6958358.sra Read 971543 spots for SRR6958358.sra Written 971543 spots for SRR6958358.sra Read 971543 spots for SRR6958358.sra Written 971543 spots for SRR6958358.sra Read 971543 spots for SRR6958358.sra Written 971543 spots for SRR6958358.sra Read 971543 spots for SRR6958358.sra Written 971543 spots for SRR6958358.sra Read 971543 spots for SRR6958358.sra Written 971543 spots for SRR6958358.sra Read 971546 spots for SRR6958358.sra Written 971546 spots for SRR6958358.sra Read 971543 spots for SRR6958358.sra Written 971543 spots for SRR6958358.sra Read 971543 spots for SRR6958358.sra Written 971543 spots for SRR6958358.sra Read 971543 spots for SRR6958358.sra Written 971543 spots for SRR6958358.sra Read 971543 spots for SRR6958358.sra Written 971543 spots for SRR6958358.sra SRR ids: ['SRR6958358.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yd887_m3 SRR6958358.sra spots: 19430863 blocks: [[1, 971543], [971544, 1943086], [1943087, 2914629], [2914630, 3886172], [3886173, 4857715], [4857716, 5829258], [5829259, 6800801], [6800802, 7772344], [7772345, 8743887], [8743888, 9715430], [9715431, 10686973], [10686974, 11658516], [11658517, 12630059], [12630060, 13601602], [13601603, 14573145], [14573146, 15544688], [15544689, 16516231], [16516232, 17487774], [17487775, 18459317], [18459318, 19430863]] SRR6958358 file size 6562781 SRR6958358 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958358 SRR6958358_1.fastq SRR6958358_2.fastq Input file: SRR6958358_1.fastq Paired file: SRR6958358_2.fastq trimmed: SRR6958358-trimmed-pair1.fastq, SRR6958358-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:51:32 2024 >> started Fri Dec 6 20:51:55 2024 >> done (23.146s) 19430863 read pairs processed; of these: 21715 ( 0.11%) short read pairs filtered out after trimming by size control 16375 ( 0.08%) empty read pairs filtered out after trimming by size control 19392773 (99.80%) read pairs available; of these: 5959334 (30.73%) trimmed read pairs available after processing 13433439 (69.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 9 0.00% 20 1 0.00% 21 2 0.00% 22 6 0.00% 23 3 0.00% 24 3 0.00% 25 5 0.00% 26 6 0.00% 27 7 0.00% 28 6 0.00% 29 7 0.00% 30 8 0.00% 31 5 0.00% 32 3 0.00% 33 4 0.00% 34 3 0.00% 35 2 0.00% 36 3 0.00% 37 8 0.00% 38 6 0.00% 39 10 0.00% 40 11 0.00% 41 8 0.00% 42 13 0.00% 43 5 0.00% 44 6 0.00% 45 9 0.00% 46 17 0.00% 47 22 0.00% 48 16 0.00% 49 23 0.00% 50 28 0.00% 51 29 0.00% 52 25 0.00% 53 34 0.00% 54 33 0.00% 55 47 0.00% 56 40 0.00% 57 38 0.00% 58 72 0.00% 59 71 0.00% 60 91 0.00% 61 107 0.00% 62 110 0.00% 63 112 0.00% 64 125 0.00% 65 131 0.00% 66 148 0.00% 67 179 0.00% 68 179 0.00% 69 237 0.00% 70 272 0.00% 71 323 0.00% 72 350 0.00% 73 409 0.00% 74 457 0.00% 75 554 0.00% 76 583 0.00% 77 728 0.00% 78 722 0.00% 79 911 0.00% 80 1002 0.01% 81 1182 0.01% 82 1371 0.01% 83 1581 0.01% 84 2476 0.01% 85 3287 0.02% 86 3427 0.02% 87 3542 0.02% 88 3785 0.02% 89 3942 0.02% 90 4156 0.02% 91 4390 0.02% 92 4842 0.02% 93 5148 0.03% 94 5588 0.03% 95 5921 0.03% 96 6209 0.03% 97 6616 0.03% 98 6853 0.04% 99 7515 0.04% 100 7997 0.04% 101 8599 0.04% 102 9463 0.05% 103 10446 0.05% 104 11025 0.06% 105 11774 0.06% 106 12446 0.06% 107 12690 0.07% 108 13049 0.07% 109 13884 0.07% 110 14579 0.08% 111 15412 0.08% 112 16727 0.09% 113 17948 0.09% 114 19064 0.10% 115 20131 0.10% 116 20874 0.11% 117 21651 0.11% 118 22523 0.12% 119 22637 0.12% 120 24071 0.12% 121 24901 0.13% 122 26412 0.14% 123 28225 0.15% 124 30061 0.16% 125 31260 0.16% 126 32691 0.17% 127 33602 0.17% 128 34329 0.18% 129 35346 0.18% 130 36620 0.19% 131 38210 0.20% 132 39834 0.21% 133 42616 0.22% 134 44687 0.23% 135 47482 0.24% 136 49854 0.26% 137 51864 0.27% 138 54088 0.28% 139 56375 0.29% 140 58797 0.30% 141 62922 0.32% 142 68849 0.36% 143 75100 0.39% 144 86158 0.44% 145 98484 0.51% 146 116703 0.60% 147 148968 0.77% 148 215380 1.11% 149 419548 2.16% 150 3452758 17.80% 151 13433439 69.27% 19392773 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=7.32 fanout-score-rank=15 prefix-density=0.47 prefix-fanout=4.3 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.13 sequence-density-rank=11 fanout-score=33.50 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=8.7 sequence=GGCGGCGGCGGCCTCGAAGCCTGACTTGGTCGCCGGCGGCGCGACGCCCATGACGAGTGTCTGGGAAGAAGTCGCCTCCTCGGCCATCATCTCTGGGTACAT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=4.33 fanout-score-rank=25 prefix-density=0.28 prefix-fanout=3.6 sequence=GGCAAGACCATCACCCTTGAGGTGGAGTCATCTGACACCATCGA criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=93.75 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=14.3 sequence=GCCGCCGCCGCCA SRR6958358 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:52:42 Started mapping on | Dec 06 20:52:42 Finished on | Dec 06 20:54:44 Mapping speed, Million of reads per hour | 572.25 Number of input reads | 19392773 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 18667641 Uniquely mapped reads % | 96.26% Average mapped length | 296.84 Number of splices: Total | 22116414 Number of splices: Annotated (sjdb) | 20919379 Number of splices: GT/AG | 21818361 Number of splices: GC/AG | 248040 Number of splices: AT/AC | 9090 Number of splices: Non-canonical | 40923 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 227940 % of reads mapped to multiple loci | 1.18% Number of reads mapped to too many loci | 10679 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.17% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 512434 512434 512434 N_multimapping 227940 227940 227940 N_noFeature 696002 18193478 826337 N_ambiguous 406146 2466 63247 UnstrandedReadsAssigned:17565493 PositiveStrandReadsAssigned:471697 NegativeStrandReadsAssigned:17778057 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958358 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958358-trimmed-pair1.fastq SRR6958358-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,392,773 reads, 17,736,886 reads pseudoaligned [quant] estimated average fragment length: 267.927 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,166 rounds 52973 SRR6958358.ke.tsv 35125 SRR6958358.se.tsv 88098 total ==> SRR6958358.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 669.737 21.3188 2.72572 PNS24247 1044 777.073 43.0056 4.73899 PNS24249 1928 1661.07 76.6638 3.95207 PNS24246 1044 777.073 43.0056 4.73899 PNS24248 1044 777.073 43.0056 4.73899 PNS24244 1471 1204.07 28.0006 1.9913 PNS24243 293 86.1213 0 0 KQK14069 1603 1336.07 961.979 61.6536 KQK14071 474 226.49 22.7093 8.58574 ==> SRR6958358.se.tsv <== BRADI_1g14170v3 1095 BRADI_1g53295v3 1543 BRADI_1g59795v3 68 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 699 BRADI_1g74790v3 294 BRADI_1g09890v3 0 BRADI_1g77505v3 298 BRADI_1g48960v3 0 SRR6958358 completed mapping pipeline successfully