Starting /dee2/code/volunteer_pipeline.sh SRR6958359 current disk space = 1549207371776 free memory = 1600132144 SRR6958359 SRAfilesize 4d65744b04900f55c0767031110318eb SRR6958359.sra SRR6958359.sra file validated SRR6958359 is paired end SRR6958359 is conventional basespace SRR6958359 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958359_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.81025 18.0 18.0 18.0 18.0 31.0 2 28.38975 28.0 27.0 30.0 27.0 31.0 3 26.6265 29.0 18.0 31.0 18.0 33.0 4 26.9555 29.0 25.0 31.0 15.0 33.0 5 30.67075 31.0 29.0 33.0 28.0 33.0 6 35.14 37.0 35.0 38.0 29.0 38.0 7 36.86425 38.0 37.0 38.0 34.0 38.0 8 36.77725 38.0 37.0 38.0 34.0 38.0 9 37.19075 38.0 38.0 38.0 36.0 38.0 10-14 37.288 38.0 38.0 38.0 36.6 38.0 15-19 37.45585 38.0 38.0 38.0 37.0 38.0 20-24 37.487350000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.42255 38.0 38.0 38.0 37.0 38.0 30-34 37.43795 38.0 38.0 38.0 37.0 38.0 35-39 37.41465 38.0 38.0 38.0 37.0 38.0 40-44 37.343149999999994 38.0 38.0 38.0 37.0 38.0 45-49 37.3045 38.0 38.0 38.0 36.8 38.0 50-54 37.2188 38.0 38.0 38.0 36.6 38.0 55-59 36.70115 38.0 38.0 38.0 36.0 38.0 60-64 36.424150000000004 38.0 38.0 38.0 35.0 38.0 65-69 36.8353 38.0 38.0 38.0 35.0 38.0 70-74 37.04495 38.0 38.0 38.0 36.0 38.0 75-79 37.04155 38.0 38.0 38.0 36.0 38.0 80-84 36.921 38.0 38.0 38.0 35.2 38.0 85-89 36.81015 38.0 38.0 38.0 35.0 38.0 90-94 36.75385 38.0 38.0 38.0 34.8 38.0 95-99 36.6269 38.0 38.0 38.0 34.0 38.0 100-104 36.4815 38.0 38.0 38.0 34.0 38.0 105-109 36.32715 38.0 37.8 38.0 33.6 38.0 110-114 36.23885 38.0 37.4 38.0 33.4 38.0 115-119 36.103249999999996 38.0 37.0 38.0 32.6 38.0 120-124 35.71085 38.0 36.2 38.0 31.2 38.0 125-129 35.26715 38.0 36.0 38.0 29.8 38.0 130-134 35.1006 38.0 36.0 38.0 28.6 38.0 135-139 34.288399999999996 38.0 34.2 38.0 25.8 38.0 140-144 33.82995 38.0 33.2 38.0 23.4 38.0 145-149 33.161950000000004 38.0 33.0 38.0 18.0 38.0 150-151 27.85725 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 2.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 2.0 20 4.0 21 4.0 22 3.0 23 4.0 24 20.0 25 12.0 26 20.0 27 20.0 28 26.0 29 29.0 30 44.0 31 70.0 32 89.0 33 110.0 34 216.0 35 424.0 36 1072.0 37 1824.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.325 9.225 18.95 37.5 2 24.73736868434217 11.255627813906953 33.71685842921461 30.29014507253627 3 21.099999999999998 14.774999999999999 26.950000000000003 37.175000000000004 4 24.349999999999998 21.625 25.174999999999997 28.849999999999998 5 25.55 26.075 24.349999999999998 24.025 6 24.05 30.275000000000002 22.75 22.925 7 17.45 23.35 38.85 20.349999999999998 8 21.65 23.275000000000002 27.700000000000003 27.375 9 20.05 22.475 33.175 24.3 10-14 23.461730865432717 25.117558779389693 25.807903951975987 25.6128064032016 15-19 23.71 24.09 26.39 25.81 20-24 23.735 24.93 25.56 25.775 25-29 23.425 24.83 26.015 25.729999999999997 30-34 23.785 24.275 26.045 25.895000000000003 35-39 23.405 24.585 26.085 25.924999999999997 40-44 23.3 24.12 26.0 26.58 45-49 23.535 24.88 25.735000000000003 25.85 50-54 23.25 24.555 26.255 25.94 55-59 23.589925505498403 24.035878984442306 26.032534333350227 26.341661176709064 60-64 23.634881825590874 24.460065199674002 25.66727791361043 26.237775061124697 65-69 23.78278092563807 24.108709822995536 26.13448327734042 25.97402597402597 70-74 23.815 24.654999999999998 25.724999999999998 25.805 75-79 23.805 24.345 26.005 25.845000000000002 80-84 23.794999999999998 24.495 25.31 26.400000000000002 85-89 24.355 23.955000000000002 25.515 26.174999999999997 90-94 23.905 24.65 25.900000000000002 25.545 95-99 24.385 24.19 25.75 25.674999999999997 100-104 23.955000000000002 24.875 25.515 25.655 105-109 24.265 23.915 25.650000000000002 26.169999999999998 110-114 24.175 24.755 25.21 25.86 115-119 24.43 23.905 25.735000000000003 25.929999999999996 120-124 23.745 24.145 25.77 26.340000000000003 125-129 24.36 24.310000000000002 24.735 26.595000000000002 130-134 24.52 24.169999999999998 25.055 26.255 135-139 24.3 24.37 24.745 26.584999999999997 140-144 24.58 23.630000000000003 25.765 26.025 145-149 24.34 24.595 25.455 25.61 150-151 24.575 23.674999999999997 25.3 26.450000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.0 27 0.5 28 1.0 29 2.5 30 5.5 31 6.5 32 8.0 33 13.5 34 18.5 35 30.0 36 41.5 37 48.5 38 72.5 39 93.5 40 125.5 41 145.5 42 176.5 43 196.5 44 186.0 45 208.0 46 208.0 47 196.5 48 179.5 49 158.0 50 142.5 51 142.5 52 147.5 53 124.5 54 105.0 55 104.0 56 117.5 57 110.0 58 94.5 59 98.5 60 84.5 61 74.5 62 77.0 63 72.0 64 71.5 65 65.5 66 52.0 67 43.5 68 33.0 69 27.5 70 21.0 71 15.0 72 13.5 73 10.5 74 11.5 75 8.0 76 4.0 77 2.5 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.05 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 1.335 60-64 1.8399999999999999 65-69 0.28500000000000003 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14141414141415 98.15 2 0.7575757575757576 1.5 3 0.07575757575757576 0.22499999999999998 4 0.0 0.0 5 0.025252525252525252 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.07500000000000001 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.7875000000000001 0.0 0.0 0.0 0.0 122-123 0.8999999999999999 0.0 0.0 0.0 0.0 124-125 1.0750000000000002 0.0 0.0 0.0 0.0 126-127 1.1875 0.0 0.0 0.0 0.0 128-129 1.3250000000000002 0.0 0.0 0.0 0.0 130-131 1.4625 0.0 0.0 0.0 0.0 132-133 1.7 0.0 0.0 0.0 0.0 134-135 1.85 0.0 0.0 0.0 0.0 136-137 2.0375 0.0 0.0 0.0 0.0 138-139 2.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAAGGC 10 0.006882143 144.6375 145 TATCAAG 10 0.006882143 144.6375 5 ATCAAGG 10 0.006882143 144.6375 6 ATATCAA 10 0.006882143 144.6375 4 >>END_MODULE SRR6958359 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958359_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.871 33.0 33.0 34.0 32.0 34.0 2 32.99475 33.0 33.0 34.0 32.0 34.0 3 32.9985 34.0 33.0 34.0 32.0 34.0 4 33.00825 34.0 33.0 34.0 32.0 34.0 5 32.99025 34.0 33.0 34.0 32.0 34.0 6 37.19325 38.0 38.0 38.0 37.0 38.0 7 37.193 38.0 38.0 38.0 37.0 38.0 8 37.15025 38.0 38.0 38.0 36.0 38.0 9 37.17425 38.0 38.0 38.0 37.0 38.0 10-14 37.1759 38.0 38.0 38.0 37.0 38.0 15-19 37.10445 38.0 38.0 38.0 36.4 38.0 20-24 37.09905 38.0 38.0 38.0 36.4 38.0 25-29 37.112049999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.08515 38.0 38.0 38.0 36.6 38.0 35-39 37.06755 38.0 38.0 38.0 36.6 38.0 40-44 37.028949999999995 38.0 38.0 38.0 36.0 38.0 45-49 36.9863 38.0 38.0 38.0 36.0 38.0 50-54 36.95245 38.0 38.0 38.0 36.0 38.0 55-59 36.9259 38.0 38.0 38.0 36.0 38.0 60-64 36.82085 38.0 38.0 38.0 36.0 38.0 65-69 36.789649999999995 38.0 38.0 38.0 35.2 38.0 70-74 36.786649999999995 38.0 38.0 38.0 35.4 38.0 75-79 36.73085 38.0 38.0 38.0 35.0 38.0 80-84 36.715199999999996 38.0 38.0 38.0 35.0 38.0 85-89 36.626549999999995 38.0 38.0 38.0 35.0 38.0 90-94 36.551649999999995 38.0 38.0 38.0 34.2 38.0 95-99 36.429050000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.29235 38.0 38.0 38.0 34.0 38.0 105-109 36.08555 38.0 37.8 38.0 33.6 38.0 110-114 35.8527 38.0 37.4 38.0 32.8 38.0 115-119 35.75445 38.0 37.0 38.0 32.4 38.0 120-124 35.70245 38.0 37.0 38.0 32.6 38.0 125-129 35.5743 38.0 36.4 38.0 31.0 38.0 130-134 35.510200000000005 38.0 36.0 38.0 31.4 38.0 135-139 35.275600000000004 38.0 36.0 38.0 31.0 38.0 140-144 34.86725 38.0 36.0 38.0 29.4 38.0 145-149 34.4329 38.0 35.0 38.0 28.2 38.0 150-151 29.986 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 1.0 5 1.0 6 1.0 7 2.0 8 1.0 9 0.0 10 3.0 11 1.0 12 0.0 13 1.0 14 3.0 15 3.0 16 4.0 17 2.0 18 2.0 19 2.0 20 8.0 21 2.0 22 9.0 23 10.0 24 14.0 25 18.0 26 14.0 27 17.0 28 13.0 29 47.0 30 44.0 31 61.0 32 56.0 33 83.0 34 148.0 35 203.0 36 565.0 37 2652.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.675 17.65 12.925 30.75 2 29.025000000000002 23.849999999999998 25.575 21.55 3 24.099999999999998 26.125 27.175 22.6 4 26.974999999999998 30.925000000000004 19.35 22.75 5 27.725 31.75 19.625 20.9 6 23.275000000000002 34.449999999999996 20.525 21.75 7 23.625 19.25 34.375 22.75 8 23.674999999999997 23.65 23.65 29.025000000000002 9 23.849999999999998 23.275000000000002 26.674999999999997 26.200000000000003 10-14 25.795 26.245 22.56 25.4 15-19 26.055 25.335 23.665 24.945 20-24 26.064999999999998 25.05 24.165 24.72 25-29 25.929999999999996 25.365 23.7 25.005 30-34 25.94 25.52 24.025 24.515 35-39 25.900000000000002 25.430000000000003 23.31 25.36 40-44 25.929999999999996 25.55 23.66 24.86 45-49 26.085 25.69 23.365 24.86 50-54 26.479999999999997 25.28 23.585 24.654999999999998 55-59 26.135 25.245 24.145 24.474999999999998 60-64 25.955000000000002 25.6 23.905 24.54 65-69 26.455000000000002 25.155 23.97 24.42 70-74 26.365 24.959999999999997 24.055 24.62 75-79 26.21 24.725 24.355 24.709999999999997 80-84 26.790000000000003 25.105 23.57 24.535 85-89 26.779999999999998 24.98 23.775 24.465 90-94 26.009999999999998 25.36 23.86 24.77 95-99 25.679999999999996 25.285000000000004 23.885 25.15 100-104 26.07 25.424999999999997 23.685000000000002 24.82 105-109 26.075 26.150000000000002 23.595 24.18 110-114 26.02 26.1 23.71 24.169999999999998 115-119 25.89 25.419999999999998 23.974999999999998 24.715 120-124 26.44 25.645 23.94 23.974999999999998 125-129 26.035000000000004 25.619999999999997 23.64 24.705 130-134 26.605 26.495 23.01 23.89 135-139 26.21 26.040000000000003 23.95 23.799999999999997 140-144 26.540000000000003 26.245 23.925 23.29 145-149 26.755000000000003 25.590000000000003 23.69 23.965 150-151 26.6625 26.35 23.7 23.2875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 1.0 29 1.5 30 2.5 31 4.0 32 9.0 33 8.5 34 9.5 35 20.5 36 31.5 37 44.5 38 72.5 39 86.0 40 90.0 41 122.5 42 140.0 43 158.0 44 190.0 45 190.0 46 178.5 47 180.5 48 191.5 49 190.0 50 172.5 51 163.0 52 143.5 53 120.5 54 119.5 55 120.0 56 102.5 57 99.5 58 103.0 59 93.0 60 91.0 61 85.0 62 78.5 63 79.0 64 80.0 65 71.0 66 65.5 67 58.0 68 47.5 69 44.5 70 41.5 71 30.5 72 14.5 73 14.0 74 14.5 75 9.5 76 5.5 77 3.5 78 2.0 79 1.0 80 1.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.54740061162079 96.675 2 1.0703363914373087 2.1 3 0.2803261977573904 0.8250000000000001 4 0.10193679918450561 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.7875000000000001 0.0 0.0 0.0 0.0 122-123 0.8999999999999999 0.0 0.0 0.0 0.0 124-125 1.0750000000000002 0.0 0.0 0.0 0.0 126-127 1.1875 0.0 0.0 0.0 0.0 128-129 1.2999999999999998 0.0 0.0 0.0 0.0 130-131 1.4375 0.0 0.0 0.0 0.0 132-133 1.675 0.0 0.0 0.0 0.0 134-135 1.825 0.0 0.0 0.0 0.0 136-137 2.025 0.0 0.0 0.0 0.0 138-139 2.2249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCTGC 10 0.006830828 145.0 6 >>END_MODULE Read 1225533 spots for SRR6958359.sra Written 1225533 spots for SRR6958359.sra Read 1225533 spots for SRR6958359.sra Written 1225533 spots for SRR6958359.sra Read 1225533 spots for SRR6958359.sra Written 1225533 spots for SRR6958359.sra Read 1225533 spots for SRR6958359.sra Written 1225533 spots for SRR6958359.sra Read 1225533 spots for SRR6958359.sra Written 1225533 spots for SRR6958359.sra Read 1225533 spots for SRR6958359.sra Written 1225533 spots for SRR6958359.sra Read 1225533 spots for SRR6958359.sra Written 1225533 spots for SRR6958359.sra Read 1225533 spots for SRR6958359.sra Written 1225533 spots for SRR6958359.sra Read 1225533 spots for SRR6958359.sra Written 1225533 spots for SRR6958359.sra Read 1225533 spots for SRR6958359.sra Written 1225533 spots for SRR6958359.sra Read 1225533 spots for SRR6958359.sra Written 1225533 spots for SRR6958359.sra Read 1225537 spots for SRR6958359.sra Written 1225537 spots for SRR6958359.sra Read 1225533 spots for SRR6958359.sra Written 1225533 spots for SRR6958359.sra Read 1225533 spots for SRR6958359.sra Written 1225533 spots for SRR6958359.sra Read 1225533 spots for SRR6958359.sra Written 1225533 spots for SRR6958359.sra Read 1225533 spots for SRR6958359.sra Written 1225533 spots for SRR6958359.sra Read 1225533 spots for SRR6958359.sra Written 1225533 spots for SRR6958359.sra Read 1225533 spots for SRR6958359.sra Written 1225533 spots for SRR6958359.sra Read 1225533 spots for SRR6958359.sra Written 1225533 spots for SRR6958359.sra Read 1225533 spots for SRR6958359.sra Written 1225533 spots for SRR6958359.sra SRR ids: ['SRR6958359.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vm95a0y5 SRR6958359.sra spots: 24510664 blocks: [[1, 1225533], [1225534, 2451066], [2451067, 3676599], [3676600, 4902132], [4902133, 6127665], [6127666, 7353198], [7353199, 8578731], [8578732, 9804264], [9804265, 11029797], [11029798, 12255330], [12255331, 13480863], [13480864, 14706396], [14706397, 15931929], [15931930, 17157462], [17157463, 18382995], [18382996, 19608528], [19608529, 20834061], [20834062, 22059594], [22059595, 23285127], [23285128, 24510664]] SRR6958359 file size 8284159 SRR6958359 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958359 SRR6958359_1.fastq SRR6958359_2.fastq Input file: SRR6958359_1.fastq Paired file: SRR6958359_2.fastq trimmed: SRR6958359-trimmed-pair1.fastq, SRR6958359-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:57:05 2024 >> started Fri Dec 6 20:57:29 2024 >> done (24.518s) 24510664 read pairs processed; of these: 34725 ( 0.14%) short read pairs filtered out after trimming by size control 45724 ( 0.19%) empty read pairs filtered out after trimming by size control 24430215 (99.67%) read pairs available; of these: 9133387 (37.39%) trimmed read pairs available after processing 15296828 (62.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 2 0.00% 21 5 0.00% 22 7 0.00% 23 11 0.00% 24 6 0.00% 25 9 0.00% 26 10 0.00% 27 3 0.00% 28 8 0.00% 29 9 0.00% 30 11 0.00% 31 6 0.00% 32 5 0.00% 33 10 0.00% 34 8 0.00% 35 12 0.00% 36 7 0.00% 37 14 0.00% 38 11 0.00% 39 4 0.00% 40 19 0.00% 41 9 0.00% 42 8 0.00% 43 16 0.00% 44 18 0.00% 45 19 0.00% 46 15 0.00% 47 33 0.00% 48 23 0.00% 49 25 0.00% 50 27 0.00% 51 31 0.00% 52 37 0.00% 53 39 0.00% 54 57 0.00% 55 46 0.00% 56 58 0.00% 57 73 0.00% 58 66 0.00% 59 76 0.00% 60 99 0.00% 61 98 0.00% 62 101 0.00% 63 116 0.00% 64 126 0.00% 65 136 0.00% 66 168 0.00% 67 174 0.00% 68 186 0.00% 69 208 0.00% 70 264 0.00% 71 252 0.00% 72 297 0.00% 73 376 0.00% 74 411 0.00% 75 426 0.00% 76 478 0.00% 77 576 0.00% 78 656 0.00% 79 694 0.00% 80 803 0.00% 81 910 0.00% 82 1047 0.00% 83 1245 0.01% 84 2428 0.01% 85 3141 0.01% 86 3105 0.01% 87 3387 0.01% 88 3446 0.01% 89 3700 0.02% 90 3669 0.02% 91 3914 0.02% 92 4064 0.02% 93 4300 0.02% 94 4490 0.02% 95 4758 0.02% 96 5093 0.02% 97 5354 0.02% 98 5709 0.02% 99 6221 0.03% 100 6469 0.03% 101 6874 0.03% 102 7511 0.03% 103 8003 0.03% 104 8592 0.04% 105 9089 0.04% 106 9652 0.04% 107 10139 0.04% 108 10897 0.04% 109 11369 0.05% 110 12082 0.05% 111 13066 0.05% 112 13666 0.06% 113 14622 0.06% 114 15626 0.06% 115 16699 0.07% 116 17822 0.07% 117 18543 0.08% 118 19292 0.08% 119 19903 0.08% 120 20954 0.09% 121 22409 0.09% 122 23606 0.10% 123 24957 0.10% 124 26077 0.11% 125 27542 0.11% 126 28726 0.12% 127 30295 0.12% 128 31572 0.13% 129 33661 0.14% 130 35074 0.14% 131 37187 0.15% 132 39779 0.16% 133 41907 0.17% 134 44858 0.18% 135 47858 0.20% 136 51171 0.21% 137 54580 0.22% 138 58921 0.24% 139 63714 0.26% 140 69967 0.29% 141 76443 0.31% 142 85164 0.35% 143 97876 0.40% 144 113700 0.47% 145 137700 0.56% 146 175052 0.72% 147 256254 1.05% 148 388000 1.59% 149 814728 3.33% 150 5846253 23.93% 151 15296828 62.61% 24430215 reads passed initial QC criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=23 prefix-density=1.01 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=39.92 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.1 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=30 prefix-density=0.68 prefix-fanout=2.4 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=314.00 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=19.1 sequence=CAGCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958359 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:58:13 Started mapping on | Dec 06 20:58:13 Finished on | Dec 06 21:00:01 Mapping speed, Million of reads per hour | 814.34 Number of input reads | 24430215 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 23394271 Uniquely mapped reads % | 95.76% Average mapped length | 298.17 Number of splices: Total | 27454167 Number of splices: Annotated (sjdb) | 25915373 Number of splices: GT/AG | 27106392 Number of splices: GC/AG | 319025 Number of splices: AT/AC | 10482 Number of splices: Non-canonical | 18268 Mismatch rate per base, % | 0.08% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 245446 % of reads mapped to multiple loci | 1.00% Number of reads mapped to too many loci | 44140 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.80% % of reads unmapped: other | 1.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 807720 807720 807720 N_multimapping 245446 245446 245446 N_noFeature 713463 22801195 854289 N_ambiguous 534818 2640 84604 UnstrandedReadsAssigned:22145990 PositiveStrandReadsAssigned:590436 NegativeStrandReadsAssigned:22455378 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958359 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958359-trimmed-pair1.fastq SRR6958359-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,430,215 reads, 22,520,641 reads pseudoaligned [quant] estimated average fragment length: 278.941 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,070 rounds 52973 SRR6958359.ke.tsv 35125 SRR6958359.se.tsv 88098 total ==> SRR6958359.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 658.643 0 0 PNS24247 1044 766.059 58.8562 4.97514 PNS24249 1928 1650.06 37.5744 1.47458 PNS24246 1044 766.059 58.8562 4.97514 PNS24248 1044 766.059 58.8562 4.97514 PNS24244 1471 1193.06 38.8569 2.10903 PNS24243 293 76.143 0 0 KQK14069 1603 1325.06 1945.7 95.086 KQK14071 474 212.479 39.1438 11.9295 ==> SRR6958359.se.tsv <== BRADI_1g14170v3 2317 BRADI_1g53295v3 355 BRADI_1g59795v3 217 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 345 BRADI_1g74790v3 98 BRADI_1g09890v3 0 BRADI_1g77505v3 230 BRADI_1g48960v3 0 SRR6958359 completed mapping pipeline successfully