Starting /dee2/code/volunteer_pipeline.sh SRR6958360 current disk space = 1549147009024 free memory = 1601201600 SRR6958360 SRAfilesize bfec6cd07273a63bc07eb6a7a9e51bbc SRR6958360.sra SRR6958360.sra file validated SRR6958360 is paired end SRR6958360 is conventional basespace SRR6958360 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958360_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.155 32.0 27.0 33.0 18.0 34.0 2 31.7105 33.0 31.0 34.0 27.0 34.0 3 32.57025 33.0 33.0 34.0 30.0 34.0 4 32.4025 33.0 33.0 34.0 31.0 34.0 5 32.77625 33.0 33.0 34.0 31.0 34.0 6 36.79075 38.0 37.0 38.0 35.0 38.0 7 37.41475 38.0 38.0 38.0 37.0 38.0 8 37.52775 38.0 38.0 38.0 37.0 38.0 9 37.02625 38.0 38.0 38.0 36.0 38.0 10-14 37.1175 38.0 38.0 38.0 36.2 38.0 15-19 37.596050000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.495549999999994 38.0 38.0 38.0 37.6 38.0 25-29 37.5123 38.0 38.0 38.0 37.4 38.0 30-34 37.52419999999999 38.0 38.0 38.0 37.6 38.0 35-39 37.505849999999995 38.0 38.0 38.0 37.6 38.0 40-44 37.58335 38.0 38.0 38.0 38.0 38.0 45-49 37.483850000000004 38.0 38.0 38.0 37.4 38.0 50-54 37.38335 38.0 38.0 38.0 37.0 38.0 55-59 37.13465 38.0 38.0 38.0 36.0 38.0 60-64 37.30024999999999 38.0 38.0 38.0 36.6 38.0 65-69 37.24915 38.0 38.0 38.0 36.2 38.0 70-74 37.125299999999996 38.0 38.0 38.0 35.8 38.0 75-79 36.8722 38.0 38.0 38.0 35.2 38.0 80-84 37.0447 38.0 38.0 38.0 35.8 38.0 85-89 36.99575 38.0 38.0 38.0 35.4 38.0 90-94 36.805949999999996 38.0 38.0 38.0 35.0 38.0 95-99 36.712450000000004 38.0 38.0 38.0 34.4 38.0 100-104 36.4765 38.0 38.0 38.0 34.0 38.0 105-109 36.29545 38.0 37.2 38.0 34.0 38.0 110-114 36.16295 38.0 37.0 38.0 33.4 38.0 115-119 35.84415 38.0 36.4 38.0 32.0 38.0 120-124 35.902049999999996 38.0 36.6 38.0 32.2 38.0 125-129 35.3505 38.0 36.0 38.0 30.0 38.0 130-134 35.2095 38.0 35.4 38.0 29.8 38.0 135-139 35.01325 38.0 35.2 38.0 28.8 38.0 140-144 34.57115 38.0 34.4 38.0 27.6 38.0 145-149 33.2575 38.0 33.4 38.0 19.2 38.0 150-151 27.54225 34.0 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 3.0 17 0.0 18 0.0 19 2.0 20 1.0 21 2.0 22 0.0 23 1.0 24 6.0 25 8.0 26 12.0 27 19.0 28 16.0 29 34.0 30 39.0 31 54.0 32 103.0 33 113.0 34 211.0 35 321.0 36 801.0 37 2253.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.65719452337897 10.204081632653061 8.395763368638596 44.742960475329376 2 21.5 12.8 36.375 29.325000000000003 3 19.5 16.525000000000002 25.75 38.224999999999994 4 24.4 25.275 21.5 28.825 5 24.8 29.075 24.224999999999998 21.9 6 22.475 34.65 22.675 20.200000000000003 7 17.375 25.025 39.85 17.75 8 18.925 23.575 32.300000000000004 25.2 9 19.8 21.15 35.75 23.3 10-14 22.215 27.634999999999998 26.05 24.099999999999998 15-19 21.685 26.815 27.034999999999997 24.465 20-24 21.983297494624193 27.459118867830174 26.67900185027754 23.87858178726809 25-29 22.14 26.63 26.700000000000003 24.529999999999998 30-34 22.515 26.505000000000003 27.139999999999997 23.84 35-39 21.685 26.355 26.965 24.995 40-44 21.77 26.845000000000002 26.855 24.529999999999998 45-49 22.67 26.875 26.150000000000002 24.305 50-54 22.295 26.715 26.615 24.375 55-59 22.106105305265263 27.026351317565876 26.721336066803342 24.14620731036552 60-64 21.736086804340218 27.211360568028404 26.121306065303262 24.931246562328116 65-69 22.845 26.135 26.490000000000002 24.529999999999998 70-74 22.28 26.889999999999997 26.22 24.610000000000003 75-79 22.575 26.290000000000003 26.424999999999997 24.709999999999997 80-84 22.220000000000002 25.89 26.695 25.195 85-89 22.11 26.384999999999998 26.33 25.174999999999997 90-94 22.56 26.284999999999997 26.415 24.740000000000002 95-99 22.67 26.165 27.16 24.005000000000003 100-104 22.586293146573286 26.468234117058532 26.493246623311656 24.452226113056525 105-109 22.24 26.47 26.85 24.44 110-114 22.344799919767325 26.170895597231976 26.827800621803227 24.656503861197475 115-119 22.321875939472893 26.891472091391922 26.540735544643752 24.245916424491433 120-124 22.53528175357822 26.49384446001401 26.303673305975376 24.66720048043239 125-129 22.430422988043805 26.816035366221243 26.09263538631568 24.66090625941927 130-134 22.945154019534183 26.3961933383421 26.130728775356875 24.527923866766844 135-139 22.11 26.61 26.265 25.014999999999997 140-144 23.28 25.94 25.685000000000002 25.095 145-149 22.384999999999998 26.56 26.150000000000002 24.905 150-151 22.9625 25.25 26.2625 25.525 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.5 25 2.0 26 2.0 27 2.0 28 3.0 29 3.5 30 5.0 31 8.0 32 13.5 33 24.0 34 35.0 35 45.5 36 53.5 37 69.0 38 102.0 39 129.0 40 139.0 41 180.0 42 218.5 43 232.5 44 236.0 45 253.5 46 269.0 47 230.5 48 201.5 49 194.5 50 174.5 51 152.0 52 125.5 53 106.5 54 90.5 55 71.5 56 82.0 57 84.0 58 63.0 59 53.5 60 57.0 61 50.0 62 35.5 63 32.0 64 32.0 65 30.0 66 27.0 67 19.0 68 12.5 69 13.0 70 10.0 71 4.5 72 5.0 73 4.0 74 3.5 75 3.5 76 1.5 77 2.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.015 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.05 105-109 0.0 110-114 0.29 115-119 0.21 120-124 0.09 125-129 0.47000000000000003 130-134 0.17500000000000002 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09021986353298 98.02499999999999 2 0.7581501137225171 1.5 3 0.1263583522870862 0.375 4 0.025271670457417232 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.45 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.1875 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.5125000000000002 0.0 0.0 0.0 0.0 124-125 1.7125 0.0 0.0 0.0 0.0 126-127 1.9625 0.0 0.0 0.0 0.0 128-129 2.2375 0.0 0.0 0.0 0.0 130-131 2.5125 0.0 0.0 0.0 0.0 132-133 2.825 0.0 0.0 0.0 0.0 134-135 3.1625 0.0 0.0 0.0 0.0 136-137 3.4875 0.0 0.0 0.0 0.0 138-139 3.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958360 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958360_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.49 33.0 33.0 34.0 28.0 34.0 2 31.86075 33.0 33.0 34.0 27.0 34.0 3 32.61825 33.0 33.0 34.0 28.0 34.0 4 31.41 33.0 33.0 34.0 27.0 34.0 5 32.60325 33.0 33.0 34.0 30.0 34.0 6 37.0995 38.0 38.0 38.0 36.0 38.0 7 37.372 38.0 38.0 38.0 37.0 38.0 8 37.40475 38.0 38.0 38.0 37.0 38.0 9 37.464 38.0 38.0 38.0 38.0 38.0 10-14 37.51925 38.0 38.0 38.0 38.0 38.0 15-19 37.4473 38.0 38.0 38.0 38.0 38.0 20-24 37.4462 38.0 38.0 38.0 38.0 38.0 25-29 37.479850000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.51765 38.0 38.0 38.0 38.0 38.0 35-39 37.460649999999994 38.0 38.0 38.0 38.0 38.0 40-44 37.234249999999996 38.0 38.0 38.0 37.0 38.0 45-49 36.88185 38.0 37.8 38.0 35.2 38.0 50-54 36.44775 38.0 37.0 38.0 31.8 38.0 55-59 37.3152 38.0 38.0 38.0 37.0 38.0 60-64 37.4465 38.0 38.0 38.0 37.8 38.0 65-69 37.32854999999999 38.0 38.0 38.0 37.0 38.0 70-74 36.4884 38.0 38.0 38.0 34.0 38.0 75-79 37.015100000000004 38.0 38.0 38.0 36.2 38.0 80-84 35.3733 38.0 36.2 38.0 24.8 38.0 85-89 37.0642 38.0 38.0 38.0 35.8 38.0 90-94 37.071349999999995 38.0 38.0 38.0 36.0 38.0 95-99 37.016600000000004 38.0 38.0 38.0 36.0 38.0 100-104 36.8918 38.0 38.0 38.0 35.2 38.0 105-109 36.6421 38.0 38.0 38.0 34.4 38.0 110-114 36.69965 38.0 38.0 38.0 34.8 38.0 115-119 36.713699999999996 38.0 38.0 38.0 34.8 38.0 120-124 36.517 38.0 38.0 38.0 33.6 38.0 125-129 36.18375 38.0 38.0 38.0 33.0 38.0 130-134 35.8797 38.0 37.4 38.0 32.2 38.0 135-139 34.98885 38.0 35.6 38.0 27.8 38.0 140-144 32.962399999999995 38.0 31.6 38.0 20.4 38.0 145-149 32.789249999999996 38.0 32.6 38.0 17.2 38.0 150-151 28.14575 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 1.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 0.0 18 0.0 19 4.0 20 2.0 21 5.0 22 7.0 23 4.0 24 5.0 25 13.0 26 13.0 27 15.0 28 17.0 29 25.0 30 36.0 31 60.0 32 69.0 33 91.0 34 174.0 35 284.0 36 811.0 37 2356.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.699999999999996 18.075 11.899999999999999 35.325 2 29.075 24.325 28.225 18.375 3 21.099999999999998 27.675 27.650000000000002 23.575 4 24.825 31.374999999999996 21.85 21.95 5 28.475 32.9 20.9 17.724999999999998 6 23.75 36.275 20.9 19.075 7 22.7 19.525000000000002 35.05 22.725 8 23.150000000000002 24.15 26.525 26.174999999999997 9 24.349999999999998 23.925 27.85 23.875 10-14 25.480000000000004 27.0 24.279999999999998 23.24 15-19 24.88 26.790000000000003 25.555 22.775000000000002 20-24 24.945 26.855 25.314999999999998 22.884999999999998 25-29 25.27 26.32 25.290000000000003 23.119999999999997 30-34 25.31 26.095000000000002 25.15 23.445 35-39 24.685000000000002 26.605 25.285000000000004 23.425 40-44 24.915000000000003 26.650000000000002 25.615 22.82 45-49 24.325 26.640000000000004 25.840000000000003 23.195 50-54 24.735 26.505000000000003 25.85 22.91 55-59 25.555 26.840000000000003 25.074999999999996 22.53 60-64 25.1 26.919999999999998 24.965 23.015 65-69 24.695 27.250000000000004 25.715 22.34 70-74 25.035 26.645000000000003 25.6 22.720000000000002 75-79 24.425 26.55 25.919999999999998 23.105 80-84 24.54 26.729999999999997 26.16 22.57 85-89 25.735000000000003 26.305 25.645 22.314999999999998 90-94 24.745 26.615 26.224999999999998 22.415 95-99 25.224999999999998 26.200000000000003 26.0 22.575 100-104 25.064999999999998 27.13 25.05 22.755 105-109 24.88 27.11 25.955000000000002 22.055 110-114 25.080000000000002 26.729999999999997 25.580000000000002 22.61 115-119 25.695 26.365 25.75 22.189999999999998 120-124 24.875 26.665 27.075 21.385 125-129 25.41 27.095000000000002 25.074999999999996 22.42 130-134 26.0 26.634999999999998 25.39 21.975 135-139 25.21 26.96 26.39 21.44 140-144 25.290000000000003 27.025 25.905 21.78 145-149 25.319999999999997 26.784999999999997 26.150000000000002 21.745 150-151 25.775 26.875 25.7375 21.6125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 2.5 23 2.0 24 0.0 25 0.0 26 1.0 27 3.5 28 4.5 29 5.5 30 10.0 31 10.5 32 12.0 33 17.5 34 28.0 35 36.0 36 44.5 37 61.0 38 84.0 39 115.0 40 145.5 41 167.5 42 204.5 43 228.0 44 219.5 45 234.5 46 229.5 47 210.0 48 189.0 49 173.0 50 175.0 51 156.5 52 134.5 53 120.0 54 106.0 55 93.5 56 86.5 57 81.5 58 75.5 59 73.0 60 71.5 61 60.5 62 50.0 63 44.0 64 41.0 65 39.0 66 36.5 67 30.5 68 25.0 69 19.0 70 12.0 71 8.5 72 7.0 73 6.5 74 3.0 75 2.0 76 1.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14228052472251 98.25 2 0.8324924318869829 1.6500000000000001 3 0.0 0.0 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.45 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.9125 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.0375 0.0 0.0 0.0 0.0 118-119 1.1625 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.4874999999999998 0.0 0.0 0.0 0.0 124-125 1.6875 0.0 0.0 0.0 0.0 126-127 1.9375 0.0 0.0 0.0 0.0 128-129 2.2 0.0 0.0 0.0 0.0 130-131 2.4749999999999996 0.0 0.0 0.0 0.0 132-133 2.7750000000000004 0.0 0.0 0.0 0.0 134-135 3.0625 0.0 0.0 0.0 0.0 136-137 3.3625 0.0 0.0 0.0 0.0 138-139 3.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCCTAC 10 0.006830828 145.0 6 >>END_MODULE Read 816288 spots for SRR6958360.sra Written 816288 spots for SRR6958360.sra Read 816288 spots for SRR6958360.sra Written 816288 spots for SRR6958360.sra Read 816288 spots for SRR6958360.sra Written 816288 spots for SRR6958360.sra Read 816288 spots for SRR6958360.sra Written 816288 spots for SRR6958360.sra Read 816288 spots for SRR6958360.sra Written 816288 spots for SRR6958360.sra Read 816288 spots for SRR6958360.sra Written 816288 spots for SRR6958360.sra Read 816288 spots for SRR6958360.sra Written 816288 spots for SRR6958360.sra Read 816288 spots for SRR6958360.sra Read 816288 spots for SRR6958360.sra Written 816288 spots for SRR6958360.sra Read 816288 spots for SRR6958360.sra Written 816288 spots for SRR6958360.sra Written 816288 spots for SRR6958360.sra Read 816288 spots for SRR6958360.sra Written 816288 spots for SRR6958360.sra Read 816288 spots for SRR6958360.sra Written 816288 spots for SRR6958360.sra Read 816288 spots for SRR6958360.sra Written 816288 spots for SRR6958360.sra Read 816288 spots for SRR6958360.sra Read 816288 spots for SRR6958360.sra Written 816288 spots for SRR6958360.sra Read 816288 spots for SRR6958360.sra Written 816288 spots for SRR6958360.sra Written 816288 spots for SRR6958360.sra Read 816288 spots for SRR6958360.sra Written 816288 spots for SRR6958360.sra Read 816288 spots for SRR6958360.sra Read 816288 spots for SRR6958360.sra Written 816288 spots for SRR6958360.sra Written 816288 spots for SRR6958360.sra Read 816306 spots for SRR6958360.sra Written 816306 spots for SRR6958360.sra SRR ids: ['SRR6958360.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7g3jwqoo SRR6958360.sra spots: 16325778 blocks: [[1, 816288], [816289, 1632576], [1632577, 2448864], [2448865, 3265152], [3265153, 4081440], [4081441, 4897728], [4897729, 5714016], [5714017, 6530304], [6530305, 7346592], [7346593, 8162880], [8162881, 8979168], [8979169, 9795456], [9795457, 10611744], [10611745, 11428032], [11428033, 12244320], [12244321, 13060608], [13060609, 13876896], [13876897, 14693184], [14693185, 15509472], [15509473, 16325778]] SRR6958360 file size 5510570 SRR6958360 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958360 SRR6958360_1.fastq SRR6958360_2.fastq Input file: SRR6958360_1.fastq Paired file: SRR6958360_2.fastq trimmed: SRR6958360-trimmed-pair1.fastq, SRR6958360-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:55:19 2024 >> started Fri Dec 6 20:55:37 2024 >> done (17.393s) 16325778 read pairs processed; of these: 8278 ( 0.05%) short read pairs filtered out after trimming by size control 8580 ( 0.05%) empty read pairs filtered out after trimming by size control 16308920 (99.90%) read pairs available; of these: 6888277 (42.24%) trimmed read pairs available after processing 9420643 (57.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 1 0.00% 24 4 0.00% 25 2 0.00% 26 2 0.00% 27 2 0.00% 28 4 0.00% 29 4 0.00% 30 0 0.00% 31 0 0.00% 32 6 0.00% 33 0 0.00% 34 5 0.00% 35 9 0.00% 36 2 0.00% 37 3 0.00% 38 5 0.00% 39 10 0.00% 40 7 0.00% 41 6 0.00% 42 9 0.00% 43 4 0.00% 44 11 0.00% 45 12 0.00% 46 20 0.00% 47 8 0.00% 48 6 0.00% 49 11 0.00% 50 12 0.00% 51 15 0.00% 52 30 0.00% 53 26 0.00% 54 18 0.00% 55 20 0.00% 56 28 0.00% 57 49 0.00% 58 45 0.00% 59 52 0.00% 60 54 0.00% 61 53 0.00% 62 71 0.00% 63 73 0.00% 64 94 0.00% 65 91 0.00% 66 105 0.00% 67 134 0.00% 68 153 0.00% 69 162 0.00% 70 169 0.00% 71 208 0.00% 72 215 0.00% 73 286 0.00% 74 287 0.00% 75 315 0.00% 76 407 0.00% 77 435 0.00% 78 472 0.00% 79 516 0.00% 80 604 0.00% 81 696 0.00% 82 799 0.00% 83 894 0.01% 84 1194 0.01% 85 1465 0.01% 86 1587 0.01% 87 1722 0.01% 88 1922 0.01% 89 1949 0.01% 90 2087 0.01% 91 2382 0.01% 92 2562 0.02% 93 2682 0.02% 94 3026 0.02% 95 3359 0.02% 96 3637 0.02% 97 3895 0.02% 98 4211 0.03% 99 4519 0.03% 100 4781 0.03% 101 5334 0.03% 102 5678 0.03% 103 6204 0.04% 104 6601 0.04% 105 7034 0.04% 106 7632 0.05% 107 8021 0.05% 108 8491 0.05% 109 9244 0.06% 110 9568 0.06% 111 10182 0.06% 112 10865 0.07% 113 11151 0.07% 114 12125 0.07% 115 12926 0.08% 116 13861 0.08% 117 14299 0.09% 118 15264 0.09% 119 16134 0.10% 120 16494 0.10% 121 17788 0.11% 122 18346 0.11% 123 19633 0.12% 124 20857 0.13% 125 22348 0.14% 126 23246 0.14% 127 24429 0.15% 128 25705 0.16% 129 27815 0.17% 130 30407 0.19% 131 30391 0.19% 132 32302 0.20% 133 34653 0.21% 134 36922 0.23% 135 39431 0.24% 136 42841 0.26% 137 45980 0.28% 138 48542 0.30% 139 53302 0.33% 140 58645 0.36% 141 65078 0.40% 142 73197 0.45% 143 82992 0.51% 144 97700 0.60% 145 120401 0.74% 146 152503 0.94% 147 209969 1.29% 148 332148 2.04% 149 693911 4.25% 150 4144959 25.42% 151 9420643 57.76% 16308920 reads passed initial QC criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=16 prefix-density=0.99 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=39.55 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.7 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCAATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=3.49 fanout-score-rank=16 prefix-density=0.77 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=27.46 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=5.6 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958360 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:56:20 Started mapping on | Dec 06 20:56:21 Finished on | Dec 06 20:57:42 Mapping speed, Million of reads per hour | 724.84 Number of input reads | 16308920 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16032193 Uniquely mapped reads % | 98.30% Average mapped length | 297.46 Number of splices: Total | 19508675 Number of splices: Annotated (sjdb) | 18440354 Number of splices: GT/AG | 19255829 Number of splices: GC/AG | 224471 Number of splices: AT/AC | 7064 Number of splices: Non-canonical | 21311 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.40 Insertion rate per base | 0.01% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 132920 % of reads mapped to multiple loci | 0.82% Number of reads mapped to too many loci | 11095 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.40% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 146971 146971 146971 N_multimapping 132920 132920 132920 N_noFeature 514377 15594088 639361 N_ambiguous 374468 2001 62588 UnstrandedReadsAssigned:15143348 PositiveStrandReadsAssigned:436104 NegativeStrandReadsAssigned:15330244 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958360 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958360-trimmed-pair1.fastq SRR6958360-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,308,920 reads, 15,340,390 reads pseudoaligned [quant] estimated average fragment length: 244.804 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,171 rounds 52973 SRR6958360.ke.tsv 35125 SRR6958360.se.tsv 88098 total ==> SRR6958360.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 692.498 0 0 PNS24247 1044 800.196 54.049 6.78024 PNS24249 1928 1684.2 14.9008 0.888118 PNS24246 1044 800.196 54.049 6.78024 PNS24248 1044 800.196 54.049 6.78024 PNS24244 1471 1227.2 10.9523 0.895872 PNS24243 293 82.6227 0 0 KQK14069 1603 1359.2 3606.32 266.34 KQK14071 474 235.073 49.3797 21.0863 ==> SRR6958360.se.tsv <== BRADI_1g14170v3 3979 BRADI_1g53295v3 128 BRADI_1g59795v3 169 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 182 BRADI_1g74790v3 64 BRADI_1g09890v3 0 BRADI_1g77505v3 201 BRADI_1g48960v3 0 SRR6958360 completed mapping pipeline successfully