Starting /dee2/code/volunteer_pipeline.sh SRR6958361 current disk space = 1549239562240 free memory = 1597135096 SRR6958361 SRAfilesize ff54768a6967aeb5d23cfe2e5d60a11f SRR6958361.sra SRR6958361.sra file validated SRR6958361 is paired end SRR6958361 is conventional basespace SRR6958361 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958361_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.89525 30.0 18.0 33.0 18.0 33.0 2 28.765 31.0 27.0 33.0 18.0 33.0 3 28.5895 31.0 27.0 33.0 18.0 33.0 4 29.97925 31.0 29.0 33.0 25.0 33.0 5 31.87225 33.0 32.0 33.0 30.0 33.0 6 35.3685 37.0 35.0 38.0 29.0 38.0 7 36.219 38.0 37.0 38.0 33.0 38.0 8 36.506 38.0 37.0 38.0 34.0 38.0 9 36.74375 38.0 38.0 38.0 34.0 38.0 10-14 37.06955 38.0 38.0 38.0 35.6 38.0 15-19 37.14265 38.0 38.0 38.0 36.0 38.0 20-24 37.2735 38.0 38.0 38.0 36.4 38.0 25-29 37.378750000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.22045 38.0 38.0 38.0 36.2 38.0 35-39 37.1933 38.0 38.0 38.0 36.4 38.0 40-44 37.18805 38.0 38.0 38.0 36.0 38.0 45-49 37.1917 38.0 38.0 38.0 36.2 38.0 50-54 37.0227 38.0 38.0 38.0 35.6 38.0 55-59 36.536899999999996 38.0 37.6 38.0 34.0 38.0 60-64 36.061699999999995 38.0 37.0 38.0 32.2 38.0 65-69 35.728300000000004 38.0 36.4 38.0 29.8 38.0 70-74 35.7678 38.0 36.4 38.0 30.2 38.0 75-79 36.354099999999995 38.0 37.0 38.0 33.4 38.0 80-84 36.3688 38.0 37.2 38.0 33.2 38.0 85-89 36.20765 38.0 37.0 38.0 33.2 38.0 90-94 36.081 38.0 37.0 38.0 32.4 38.0 95-99 35.7279 38.0 36.6 38.0 31.0 38.0 100-104 35.44375 38.0 35.8 38.0 29.6 38.0 105-109 34.921 38.0 35.0 38.0 27.4 38.0 110-114 34.255900000000004 38.0 34.0 38.0 23.8 38.0 115-119 33.61465 37.8 33.6 38.0 20.4 38.0 120-124 33.3757 37.2 33.4 38.0 17.8 38.0 125-129 34.23825 38.0 34.0 38.0 24.4 38.0 130-134 33.9987 38.0 34.0 38.0 22.6 38.0 135-139 33.808049999999994 38.0 34.0 38.0 22.6 38.0 140-144 33.2375 38.0 33.4 38.0 18.4 38.0 145-149 31.8111 36.6 32.2 38.0 11.4 38.0 150-151 26.737875000000003 34.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 0.0 18 0.0 19 2.0 20 3.0 21 1.0 22 3.0 23 10.0 24 17.0 25 16.0 26 29.0 27 29.0 28 63.0 29 53.0 30 75.0 31 132.0 32 136.0 33 244.0 34 343.0 35 580.0 36 1135.0 37 1127.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.168354776895704 9.526416643854366 8.623049548316452 36.68217903093348 2 24.8 12.85 34.9 27.450000000000003 3 21.025 19.15 27.0 32.824999999999996 4 26.1 25.1 22.900000000000002 25.900000000000002 5 25.494120590442833 29.772329246935204 23.367525644233176 21.36602451838879 6 22.375 33.4 23.1 21.125 7 15.625 23.75 41.225 19.400000000000002 8 20.349999999999998 23.375 28.925 27.35 9 18.625 22.075 34.425 24.875 10-14 22.155 26.99 25.885 24.97 15-19 22.384999999999998 25.724999999999998 26.66 25.230000000000004 20-24 22.34 26.695 25.590000000000003 25.374999999999996 25-29 22.175 26.19 26.169999999999998 25.465 30-34 22.215 26.1 26.43 25.255 35-39 22.49 26.38 26.224999999999998 24.905 40-44 21.905 25.735000000000003 26.729999999999997 25.629999999999995 45-49 22.689999999999998 26.19 27.02 24.099999999999998 50-54 22.36 26.284999999999997 26.455000000000002 24.9 55-59 22.415 26.015 26.650000000000002 24.92 60-64 22.065 25.85 26.355 25.729999999999997 65-69 22.225 25.735000000000003 26.384999999999998 25.655 70-74 22.33 25.82 26.179999999999996 25.669999999999998 75-79 21.955 26.474999999999998 26.035000000000004 25.535000000000004 80-84 22.355 25.505 26.31 25.83 85-89 22.695 25.924999999999997 25.91 25.47 90-94 23.005 25.905 25.835 25.255 95-99 23.105 25.629999999999995 26.064999999999998 25.2 100-104 22.41 25.919999999999998 26.91 24.759999999999998 105-109 23.03 25.595000000000002 26.505000000000003 24.87 110-114 22.25 25.83 26.224999999999998 25.695 115-119 21.865000000000002 26.3 26.064999999999998 25.77 120-124 22.73 26.025 26.08 25.165 125-129 22.705000000000002 26.135 25.740000000000002 25.419999999999998 130-134 22.73 25.4 26.355 25.515 135-139 22.770000000000003 25.979999999999997 25.69 25.56 140-144 22.725 26.384999999999998 25.485000000000003 25.405 145-149 22.895 25.775 25.85 25.480000000000004 150-151 23.4875 25.724999999999998 26.075 24.712500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 2.5 27 5.0 28 5.0 29 5.5 30 7.5 31 7.5 32 17.0 33 29.5 34 37.0 35 49.0 36 62.0 37 70.0 38 80.5 39 110.0 40 130.0 41 144.5 42 164.5 43 193.5 44 234.0 45 238.5 46 226.0 47 216.5 48 214.0 49 203.0 50 177.5 51 150.0 52 136.5 53 131.0 54 113.5 55 104.0 56 97.0 57 82.5 58 68.5 59 57.5 60 60.0 61 60.5 62 46.5 63 39.5 64 36.5 65 33.0 66 28.0 67 26.0 68 24.0 69 19.5 70 14.5 71 11.0 72 8.0 73 5.5 74 6.0 75 3.5 76 1.5 77 1.0 78 1.5 79 2.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.674999999999999 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.9624999999999999 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.2125 0.0 0.0 0.0 0.0 112-113 1.2625000000000002 0.0 0.0 0.0 0.0 114-115 1.4 0.0 0.0 0.0 0.0 116-117 1.6124999999999998 0.0 0.0 0.0 0.0 118-119 1.7875 0.0 0.0 0.0 0.0 120-121 1.9249999999999998 0.0 0.0 0.0 0.0 122-123 2.125 0.0 0.0 0.0 0.0 124-125 2.3499999999999996 0.0 0.0 0.0 0.0 126-127 2.6 0.0 0.0 0.0 0.0 128-129 2.975 0.0 0.0 0.0 0.0 130-131 3.2249999999999996 0.0 0.0 0.0 0.0 132-133 3.525 0.0 0.0 0.0 0.0 134-135 3.925 0.0 0.0 0.0 0.0 136-137 4.199999999999999 0.0 0.0 0.0 0.0 138-139 4.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958361 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958361_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.872 33.0 33.0 34.0 32.0 34.0 2 32.91975 33.0 33.0 34.0 32.0 34.0 3 32.8455 33.0 33.0 34.0 32.0 34.0 4 32.9705 34.0 33.0 34.0 32.0 34.0 5 32.8345 34.0 33.0 34.0 32.0 34.0 6 36.83625 38.0 38.0 38.0 35.0 38.0 7 36.709 38.0 38.0 38.0 35.0 38.0 8 36.64 38.0 38.0 38.0 34.0 38.0 9 36.7515 38.0 38.0 38.0 35.0 38.0 10-14 36.80695000000001 38.0 38.0 38.0 35.0 38.0 15-19 36.989549999999994 38.0 38.0 38.0 36.0 38.0 20-24 37.0726 38.0 38.0 38.0 36.2 38.0 25-29 36.97085 38.0 38.0 38.0 36.0 38.0 30-34 36.9024 38.0 38.0 38.0 35.8 38.0 35-39 36.7419 38.0 38.0 38.0 34.8 38.0 40-44 36.7319 38.0 38.0 38.0 35.2 38.0 45-49 36.749199999999995 38.0 38.0 38.0 35.0 38.0 50-54 36.75534999999999 38.0 38.0 38.0 35.2 38.0 55-59 36.7556 38.0 38.0 38.0 35.0 38.0 60-64 36.6486 38.0 38.0 38.0 34.4 38.0 65-69 36.60495 38.0 38.0 38.0 34.6 38.0 70-74 36.54815 38.0 38.0 38.0 34.0 38.0 75-79 36.35585 38.0 38.0 38.0 33.8 38.0 80-84 36.1068 38.0 37.6 38.0 32.8 38.0 85-89 36.09955 38.0 37.2 38.0 33.0 38.0 90-94 36.0737 38.0 37.0 38.0 33.0 38.0 95-99 35.9073 38.0 37.2 38.0 32.2 38.0 100-104 35.6608 38.0 36.8 38.0 31.0 38.0 105-109 35.16265 38.0 35.6 38.0 28.2 38.0 110-114 34.85445 38.0 35.2 38.0 27.0 38.0 115-119 34.6451 38.0 35.0 38.0 26.4 38.0 120-124 34.30245 38.0 34.8 38.0 23.8 38.0 125-129 33.742999999999995 38.0 34.0 38.0 22.2 38.0 130-134 32.7716 37.8 33.0 38.0 14.8 38.0 135-139 31.2965 35.8 29.0 38.0 13.8 38.0 140-144 31.0704 35.4 29.6 38.0 13.8 38.0 145-149 31.0212 36.0 31.0 38.0 8.6 38.0 150-151 26.655375 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 2.0 5 1.0 6 1.0 7 0.0 8 1.0 9 1.0 10 0.0 11 2.0 12 2.0 13 2.0 14 3.0 15 4.0 16 3.0 17 6.0 18 4.0 19 4.0 20 10.0 21 10.0 22 13.0 23 10.0 24 18.0 25 23.0 26 29.0 27 32.0 28 43.0 29 57.0 30 75.0 31 95.0 32 120.0 33 169.0 34 300.0 35 426.0 36 948.0 37 1579.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.75 19.425 13.950000000000001 30.875000000000004 2 29.549999999999997 24.15 27.175 19.125 3 22.400000000000002 26.125 30.2 21.275 4 25.324999999999996 33.050000000000004 20.275000000000002 21.349999999999998 5 26.224999999999998 33.625 18.625 21.525 6 23.200000000000003 36.425000000000004 20.724999999999998 19.650000000000002 7 22.15 19.475 36.35 22.025 8 25.124999999999996 23.625 24.6 26.650000000000002 9 24.6 22.525000000000002 27.700000000000003 25.174999999999997 10-14 25.435000000000002 26.435 24.64 23.49 15-19 25.324999999999996 26.305 25.385 22.985 20-24 24.865000000000002 27.089999999999996 24.915000000000003 23.13 25-29 25.21 26.295 25.45 23.044999999999998 30-34 25.319999999999997 26.63 25.014999999999997 23.035 35-39 25.119999999999997 26.484999999999996 25.380000000000003 23.015 40-44 25.27 26.16 25.124999999999996 23.445 45-49 25.235000000000003 25.66 25.86 23.244999999999997 50-54 25.255 26.185000000000002 25.385 23.175 55-59 25.729999999999997 26.52 25.115 22.634999999999998 60-64 25.790000000000003 25.97 25.555 22.685 65-69 25.41 26.619999999999997 24.87 23.1 70-74 26.075 25.71 25.245 22.97 75-79 25.230000000000004 25.94 25.505 23.325000000000003 80-84 25.55 26.484999999999996 25.085 22.88 85-89 25.590000000000003 26.040000000000003 25.365 23.005 90-94 25.474999999999998 26.665 25.474999999999998 22.384999999999998 95-99 25.55 26.400000000000002 25.66 22.39 100-104 25.180000000000003 26.314999999999998 25.485000000000003 23.02 105-109 25.115 26.52 25.385 22.98 110-114 26.06 25.705 25.485000000000003 22.75 115-119 25.25 26.565 25.3 22.884999999999998 120-124 25.729999999999997 26.19 25.83 22.25 125-129 25.855 26.915 24.975 22.255 130-134 26.090000000000003 25.805 25.25 22.855 135-139 26.112611261126112 26.487648764876486 25.18251825182518 22.217221722172216 140-144 26.466616654163538 26.811702925731435 24.541135283820957 22.18054513628407 145-149 25.8 26.669999999999998 25.585 21.945 150-151 26.700000000000003 26.5 25.087500000000002 21.712500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 1.5 27 1.5 28 1.5 29 3.5 30 9.0 31 12.0 32 15.0 33 20.0 34 25.5 35 35.5 36 48.5 37 65.0 38 81.5 39 99.5 40 130.0 41 169.5 42 194.5 43 213.5 44 209.0 45 208.0 46 223.0 47 216.5 48 203.0 49 189.0 50 168.5 51 147.5 52 131.0 53 113.5 54 98.0 55 91.5 56 97.0 57 93.5 58 81.0 59 73.0 60 67.0 61 60.5 62 57.0 63 52.0 64 48.0 65 44.0 66 43.0 67 38.0 68 25.5 69 20.0 70 22.5 71 20.0 72 12.0 73 6.0 74 3.0 75 3.0 76 1.5 77 2.5 78 2.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.025 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.8374999999999999 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.3125 0.0 0.0 0.0 0.0 114-115 1.45 0.0 0.0 0.0 0.0 116-117 1.6875 0.0 0.0 0.0 0.0 118-119 1.8624999999999998 0.0 0.0 0.0 0.0 120-121 2.0 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.425 0.0 0.0 0.0 0.0 126-127 2.675 0.0 0.0 0.0 0.0 128-129 3.05 0.0 0.0 0.0 0.0 130-131 3.3 0.0 0.0 0.0 0.0 132-133 3.6 0.0 0.0 0.0 0.0 134-135 3.975 0.0 0.0 0.0 0.0 136-137 4.199999999999999 0.0 0.0 0.0 0.0 138-139 4.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTAGAT 10 0.006830828 145.0 8 TCCAGAT 10 0.006830828 145.0 7 GAGTTCA 10 0.006830828 145.0 9 TATTAGA 10 0.006830828 145.0 7 GCCAAGT 10 0.006830828 145.0 5 >>END_MODULE Read 920539 spots for SRR6958361.sra Written 920539 spots for SRR6958361.sra Read 920539 spots for SRR6958361.sra Written 920539 spots for SRR6958361.sra Read 920539 spots for SRR6958361.sra Written 920539 spots for SRR6958361.sra Read 920539 spots for SRR6958361.sra Written 920539 spots for SRR6958361.sra Read 920539 spots for SRR6958361.sra Written 920539 spots for SRR6958361.sra Read 920539 spots for SRR6958361.sra Written 920539 spots for SRR6958361.sra Read 920539 spots for SRR6958361.sra Written 920539 spots for SRR6958361.sra Read 920539 spots for SRR6958361.sra Written 920539 spots for SRR6958361.sra Read 920539 spots for SRR6958361.sra Written 920539 spots for SRR6958361.sra Read 920539 spots for SRR6958361.sra Written 920539 spots for SRR6958361.sra Read 920539 spots for SRR6958361.sra Written 920539 spots for SRR6958361.sra Read 920539 spots for SRR6958361.sra Written 920539 spots for SRR6958361.sra Read 920539 spots for SRR6958361.sra Written 920539 spots for SRR6958361.sra Read 920539 spots for SRR6958361.sra Written 920539 spots for SRR6958361.sra Read 920539 spots for SRR6958361.sra Written 920539 spots for SRR6958361.sra Read 920539 spots for SRR6958361.sra Written 920539 spots for SRR6958361.sra Read 920539 spots for SRR6958361.sra Written 920539 spots for SRR6958361.sra Read 920539 spots for SRR6958361.sra Written 920539 spots for SRR6958361.sra Read 920554 spots for SRR6958361.sra Written 920554 spots for SRR6958361.sra Read 920539 spots for SRR6958361.sra Written 920539 spots for SRR6958361.sra SRR ids: ['SRR6958361.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_944ri2ts SRR6958361.sra spots: 18410795 blocks: [[1, 920539], [920540, 1841078], [1841079, 2761617], [2761618, 3682156], [3682157, 4602695], [4602696, 5523234], [5523235, 6443773], [6443774, 7364312], [7364313, 8284851], [8284852, 9205390], [9205391, 10125929], [10125930, 11046468], [11046469, 11967007], [11967008, 12887546], [12887547, 13808085], [13808086, 14728624], [14728625, 15649163], [15649164, 16569702], [16569703, 17490241], [17490242, 18410795]] SRR6958361 file size 6217113 SRR6958361 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958361 SRR6958361_1.fastq SRR6958361_2.fastq Input file: SRR6958361_1.fastq Paired file: SRR6958361_2.fastq trimmed: SRR6958361-trimmed-pair1.fastq, SRR6958361-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:01:17 2024 >> started Fri Dec 6 21:01:36 2024 >> done (19.502s) 18410795 read pairs processed; of these: 14215 ( 0.08%) short read pairs filtered out after trimming by size control 10477 ( 0.06%) empty read pairs filtered out after trimming by size control 18386103 (99.87%) read pairs available; of these: 7785510 (42.34%) trimmed read pairs available after processing 10600593 (57.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 2 0.00% 21 4 0.00% 22 8 0.00% 23 4 0.00% 24 4 0.00% 25 6 0.00% 26 4 0.00% 27 5 0.00% 28 8 0.00% 29 10 0.00% 30 11 0.00% 31 9 0.00% 32 6 0.00% 33 4 0.00% 34 9 0.00% 35 4 0.00% 36 7 0.00% 37 22 0.00% 38 10 0.00% 39 10 0.00% 40 9 0.00% 41 17 0.00% 42 14 0.00% 43 22 0.00% 44 26 0.00% 45 20 0.00% 46 25 0.00% 47 30 0.00% 48 35 0.00% 49 46 0.00% 50 44 0.00% 51 43 0.00% 52 45 0.00% 53 57 0.00% 54 69 0.00% 55 80 0.00% 56 80 0.00% 57 106 0.00% 58 117 0.00% 59 115 0.00% 60 153 0.00% 61 168 0.00% 62 217 0.00% 63 252 0.00% 64 296 0.00% 65 279 0.00% 66 298 0.00% 67 336 0.00% 68 418 0.00% 69 432 0.00% 70 538 0.00% 71 636 0.00% 72 690 0.00% 73 862 0.00% 74 922 0.01% 75 1058 0.01% 76 1097 0.01% 77 1168 0.01% 78 1336 0.01% 79 1504 0.01% 80 1718 0.01% 81 1953 0.01% 82 2297 0.01% 83 2601 0.01% 84 3396 0.02% 85 3957 0.02% 86 4177 0.02% 87 4298 0.02% 88 4547 0.02% 89 4660 0.03% 90 4977 0.03% 91 5607 0.03% 92 5984 0.03% 93 6308 0.03% 94 6940 0.04% 95 7281 0.04% 96 7411 0.04% 97 7870 0.04% 98 8057 0.04% 99 8614 0.05% 100 9085 0.05% 101 9669 0.05% 102 10347 0.06% 103 11291 0.06% 104 12148 0.07% 105 12749 0.07% 106 13280 0.07% 107 13512 0.07% 108 13945 0.08% 109 14622 0.08% 110 15187 0.08% 111 16112 0.09% 112 17157 0.09% 113 17915 0.10% 114 19770 0.11% 115 20610 0.11% 116 21746 0.12% 117 22097 0.12% 118 23260 0.13% 119 23722 0.13% 120 24865 0.14% 121 26302 0.14% 122 27819 0.15% 123 29277 0.16% 124 31510 0.17% 125 33377 0.18% 126 34638 0.19% 127 36605 0.20% 128 38002 0.21% 129 40077 0.22% 130 41899 0.23% 131 44226 0.24% 132 47530 0.26% 133 51849 0.28% 134 55647 0.30% 135 60704 0.33% 136 65095 0.35% 137 70925 0.39% 138 76638 0.42% 139 84433 0.46% 140 92064 0.50% 141 100962 0.55% 142 111792 0.61% 143 120984 0.66% 144 132824 0.72% 145 147594 0.80% 146 177609 0.97% 147 245040 1.33% 148 394848 2.15% 149 824936 4.49% 150 4080751 22.19% 151 10600593 57.66% 18386103 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=3.29 fanout-score-rank=21 prefix-density=0.40 prefix-fanout=2.9 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=29 fanout-score=75.86 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=10.8 sequence=CAGCTGCAGCTTCTTCTGTCACTTGGGACGCCTGCTGCAGAGTGCAGATAAGGTTGCGGTCCCCGTACACGTTGTCCACACGACATGTTGTTGGCCAGAACTTGGCACCCCGAAGCCAAGCCGCAGGGAACGCGGCGTACTCCCTAGAGTACGGCTTAGTCCATGCATCGCTCATCAGGAGTTGGGGTGGGTGAGGAGCGCCCTTCAGGACATTGTTGTGCGCATCTGCTTTGCCATTTTCTACCTCTGCAATTTCTTCCCTGATTGAGATAAGGGCATCACAGAACCTGTCTAGTTCAGCCTTGCTTTCGCTTTCAGTGGGTTCAATCATAAGTGTGCCTGGAACAGGCCATGACATGGTTGGTCCGTGGAATCCATAGTCCATCAAGCGCTTTGCCACATCCTCGGGCTCTATACCAGCAGTTGCCTTAAACCCTCTTAAGTCAATAATGAATTCATGGGCAACAGTTCCATTGACTCCACGGAAAAGAACCGGGTAGTGCTTCTCCAG criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.89 fanout-score-rank=21 prefix-density=0.34 prefix-fanout=3.3 sequence=GGCAAGACCATCACCCTTGAGGTGGAGTCATCTGACACCATCGA criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=24.72 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=10.4 sequence=AGAAGATCAAGG SRR6958361 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:02:19 Started mapping on | Dec 06 21:02:19 Finished on | Dec 06 21:04:35 Mapping speed, Million of reads per hour | 486.69 Number of input reads | 18386103 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17571488 Uniquely mapped reads % | 95.57% Average mapped length | 295.51 Number of splices: Total | 20579103 Number of splices: Annotated (sjdb) | 19404141 Number of splices: GT/AG | 20298268 Number of splices: GC/AG | 234277 Number of splices: AT/AC | 7753 Number of splices: Non-canonical | 38805 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 238980 % of reads mapped to multiple loci | 1.30% Number of reads mapped to too many loci | 9442 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.76% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 585425 585425 585425 N_multimapping 238980 238980 238980 N_noFeature 700894 17069827 832758 N_ambiguous 436624 2126 67946 UnstrandedReadsAssigned:16433970 PositiveStrandReadsAssigned:499535 NegativeStrandReadsAssigned:16670784 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958361 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958361-trimmed-pair1.fastq SRR6958361-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,386,103 reads, 16,649,486 reads pseudoaligned [quant] estimated average fragment length: 269.127 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52973 SRR6958361.ke.tsv 35125 SRR6958361.se.tsv 88098 total ==> SRR6958361.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 668.281 0 0 PNS24247 1044 775.873 62.1592 7.26305 PNS24249 1928 1659.87 29.1844 1.59397 PNS24246 1044 775.873 62.1592 7.26305 PNS24248 1044 775.873 62.1592 7.26305 PNS24244 1471 1202.87 38.3381 2.88945 PNS24243 293 83.8743 0 0 KQK14069 1603 1334.87 2192.2 148.883 KQK14071 474 222.81 40.8913 16.638 ==> SRR6958361.se.tsv <== BRADI_1g14170v3 2651 BRADI_1g53295v3 1843 BRADI_1g59795v3 121 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 492 BRADI_1g74790v3 135 BRADI_1g09890v3 0 BRADI_1g77505v3 317 BRADI_1g48960v3 0 SRR6958361 completed mapping pipeline successfully