Starting /dee2/code/volunteer_pipeline.sh SRR6958362 current disk space = 1549200842752 free memory = 1597730944 SRR6958362 SRAfilesize 7941fea281bbca57a6e9771e2fab3598 SRR6958362.sra SRR6958362.sra file validated SRR6958362 is paired end SRR6958362 is conventional basespace SRR6958362 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958362_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.73075 18.0 18.0 25.0 18.0 32.0 2 21.07075 18.0 18.0 25.0 18.0 30.0 3 25.43075 27.0 25.0 28.0 18.0 31.0 4 26.3845 27.0 25.0 30.0 15.0 33.0 5 29.26925 31.0 29.0 33.0 25.0 33.0 6 34.512 37.0 34.0 38.0 29.0 38.0 7 35.361 37.0 35.0 38.0 31.0 38.0 8 35.985 38.0 36.0 38.0 32.0 38.0 9 36.47775 38.0 37.0 38.0 34.0 38.0 10-14 36.99725 38.0 38.0 38.0 35.4 38.0 15-19 37.1707 38.0 38.0 38.0 36.2 38.0 20-24 37.312850000000005 38.0 38.0 38.0 36.4 38.0 25-29 37.27045 38.0 38.0 38.0 36.4 38.0 30-34 37.0685 38.0 38.0 38.0 36.0 38.0 35-39 37.14254999999999 38.0 38.0 38.0 36.0 38.0 40-44 36.8638 38.0 38.0 38.0 35.2 38.0 45-49 37.07755 38.0 38.0 38.0 35.8 38.0 50-54 37.0346 38.0 38.0 38.0 35.8 38.0 55-59 36.6018 38.0 38.0 38.0 34.0 38.0 60-64 36.18075 38.0 37.2 38.0 32.8 38.0 65-69 35.832300000000004 38.0 36.6 38.0 30.6 38.0 70-74 35.73255 38.0 36.4 38.0 30.2 38.0 75-79 36.218599999999995 38.0 37.0 38.0 32.8 38.0 80-84 36.279650000000004 38.0 37.0 38.0 33.2 38.0 85-89 35.801750000000006 38.0 36.6 38.0 30.6 38.0 90-94 36.0575 38.0 37.0 38.0 32.4 38.0 95-99 35.801100000000005 38.0 36.6 38.0 31.0 38.0 100-104 35.294050000000006 38.0 35.8 38.0 29.2 38.0 105-109 34.89915 38.0 34.8 38.0 27.6 38.0 110-114 34.2875 38.0 34.0 38.0 24.0 38.0 115-119 33.625150000000005 37.4 33.6 38.0 21.4 38.0 120-124 33.52739999999999 37.4 33.4 38.0 19.0 38.0 125-129 34.01285 38.0 33.8 38.0 23.2 38.0 130-134 34.03625000000001 38.0 34.0 38.0 23.6 38.0 135-139 33.82725000000001 38.0 34.0 38.0 22.6 38.0 140-144 33.05475 37.0 33.2 38.0 17.2 38.0 145-149 31.444 36.0 31.8 38.0 11.4 38.0 150-151 26.28525 33.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 2.0 16 0.0 17 1.0 18 0.0 19 0.0 20 1.0 21 4.0 22 3.0 23 11.0 24 9.0 25 16.0 26 19.0 27 39.0 28 44.0 29 72.0 30 93.0 31 137.0 32 195.0 33 263.0 34 368.0 35 705.0 36 1228.0 37 788.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.967800571280186 17.657751233445858 6.985198649701377 51.38924954557258 2 17.424999999999997 27.35 23.575 31.65 3 23.724999999999998 20.65 23.95 31.674999999999997 4 27.474999999999998 25.525 21.325 25.674999999999997 5 24.50612653163291 31.057764441110276 21.8304576144036 22.605651412853213 6 21.875 34.050000000000004 24.175 19.900000000000002 7 15.7 23.200000000000003 41.425 19.675 8 21.025 23.775 26.775 28.425 9 19.15 21.6 33.95 25.3 10-14 21.83 27.295 25.71 25.165 15-19 22.125 25.755 26.525 25.595000000000002 20-24 23.119999999999997 25.985000000000003 26.115 24.779999999999998 25-29 22.18 26.135 26.25 25.435000000000002 30-34 21.745 25.955000000000002 26.85 25.45 35-39 22.45 25.874999999999996 26.795 24.88 40-44 22.814999999999998 25.365 26.334999999999997 25.485000000000003 45-49 22.735 25.255 26.75 25.259999999999998 50-54 22.86 25.324999999999996 26.25 25.564999999999998 55-59 22.78 25.729999999999997 26.27 25.22 60-64 22.134999999999998 25.805 26.605 25.455 65-69 22.58 25.985000000000003 26.450000000000003 24.985 70-74 22.465 25.974999999999998 26.384999999999998 25.174999999999997 75-79 22.43 25.14 26.945000000000004 25.485000000000003 80-84 23.24 25.535000000000004 26.125 25.1 85-89 22.14 25.814999999999998 26.384999999999998 25.66 90-94 22.49 25.535000000000004 26.435 25.540000000000003 95-99 22.745 25.36 26.545 25.35 100-104 22.34 25.52 26.66 25.480000000000004 105-109 23.369999999999997 25.615 26.015 25.0 110-114 22.295 26.16 26.790000000000003 24.755 115-119 22.88 25.5 26.02 25.6 120-124 23.07 25.790000000000003 25.955000000000002 25.185000000000002 125-129 22.835 25.91 25.345000000000002 25.91 130-134 23.325000000000003 25.490000000000002 26.05 25.135 135-139 22.78 25.790000000000003 26.484999999999996 24.945 140-144 23.06 25.61 26.105 25.224999999999998 145-149 22.66 25.745 26.095000000000002 25.5 150-151 23.0375 25.25 26.387500000000003 25.324999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.0 26 1.0 27 1.5 28 2.0 29 2.0 30 4.0 31 11.5 32 15.0 33 20.5 34 30.5 35 38.0 36 47.0 37 66.0 38 92.5 39 122.5 40 151.5 41 163.0 42 188.5 43 207.0 44 225.0 45 244.5 46 233.5 47 216.5 48 202.5 49 188.0 50 167.0 51 153.0 52 137.5 53 116.0 54 105.0 55 94.0 56 87.0 57 80.0 58 69.5 59 58.0 60 52.0 61 61.0 62 52.0 63 38.0 64 36.0 65 33.5 66 31.0 67 28.5 68 22.5 69 18.5 70 18.0 71 17.0 72 12.0 73 8.5 74 12.0 75 8.0 76 3.0 77 2.5 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.7249999999999996 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3515821195379206 0.7000000000000001 3 0.05022601707684581 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.9125000000000001 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.05 0.0 0.0 0.0 0.0 114-115 1.2 0.0 0.0 0.0 0.0 116-117 1.2625 0.0 0.0 0.0 0.0 118-119 1.4 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.8375 0.0 0.0 0.0 0.0 124-125 2.05 0.0 0.0 0.0 0.0 126-127 2.2125 0.0 0.0 0.0 0.0 128-129 2.5250000000000004 0.0 0.0 0.0 0.0 130-131 2.7125000000000004 0.0 0.0 0.0 0.0 132-133 2.85 0.0 0.0 0.0 0.0 134-135 3.0875 0.0 0.0 0.0 0.0 136-137 3.275 0.0 0.0 0.0 0.0 138-139 3.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958362 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958362_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82625 33.0 33.0 34.0 32.0 34.0 2 32.8605 33.0 33.0 34.0 32.0 34.0 3 32.85975 34.0 33.0 34.0 32.0 34.0 4 32.82575 34.0 33.0 34.0 32.0 34.0 5 32.9565 34.0 33.0 34.0 32.0 34.0 6 37.05225 38.0 38.0 38.0 36.0 38.0 7 36.8045 38.0 38.0 38.0 35.0 38.0 8 36.804 38.0 38.0 38.0 35.0 38.0 9 36.8625 38.0 38.0 38.0 35.0 38.0 10-14 36.80135 38.0 38.0 38.0 35.2 38.0 15-19 36.85965 38.0 38.0 38.0 35.4 38.0 20-24 36.92265 38.0 38.0 38.0 35.6 38.0 25-29 36.8395 38.0 38.0 38.0 35.2 38.0 30-34 36.7253 38.0 38.0 38.0 34.8 38.0 35-39 36.724650000000004 38.0 38.0 38.0 35.0 38.0 40-44 36.5306 38.0 38.0 38.0 34.2 38.0 45-49 36.625949999999996 38.0 38.0 38.0 34.6 38.0 50-54 36.5133 38.0 38.0 38.0 34.0 38.0 55-59 36.58605 38.0 38.0 38.0 34.8 38.0 60-64 36.44505 38.0 38.0 38.0 33.8 38.0 65-69 36.36775 38.0 38.0 38.0 33.8 38.0 70-74 36.396499999999996 38.0 38.0 38.0 34.0 38.0 75-79 36.23775 38.0 37.6 38.0 33.6 38.0 80-84 36.04455 38.0 37.0 38.0 32.6 38.0 85-89 35.982150000000004 38.0 37.0 38.0 32.4 38.0 90-94 36.00665 38.0 37.0 38.0 33.0 38.0 95-99 35.92615 38.0 37.0 38.0 32.2 38.0 100-104 35.3033 38.0 36.2 38.0 29.2 38.0 105-109 34.8922 38.0 35.4 38.0 26.8 38.0 110-114 34.4978 38.0 35.0 38.0 24.8 38.0 115-119 34.3745 38.0 34.6 38.0 24.4 38.0 120-124 34.08655 38.0 34.0 38.0 23.2 38.0 125-129 33.0972 37.8 33.2 38.0 17.4 38.0 130-134 32.3417 36.6 31.4 38.0 14.6 38.0 135-139 31.10125 35.6 27.8 38.0 13.8 38.0 140-144 30.730849999999997 35.2 28.2 38.0 13.6 38.0 145-149 30.49465 35.8 29.6 38.0 8.6 38.0 150-151 25.842125 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 0.0 5 2.0 6 3.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 2.0 13 1.0 14 2.0 15 3.0 16 4.0 17 4.0 18 5.0 19 7.0 20 8.0 21 8.0 22 18.0 23 12.0 24 25.0 25 18.0 26 22.0 27 45.0 28 65.0 29 62.0 30 76.0 31 102.0 32 140.0 33 201.0 34 285.0 35 524.0 36 938.0 37 1408.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.25 19.975 14.075 30.7 2 30.675 23.724999999999998 27.400000000000002 18.2 3 21.5 27.625 27.925 22.95 4 24.7 32.675 20.424999999999997 22.2 5 26.0 33.425 20.225 20.349999999999998 6 23.974999999999998 34.949999999999996 20.4 20.674999999999997 7 21.325 19.075 37.3 22.3 8 24.9 23.3 23.25 28.549999999999997 9 23.225 22.425 28.65 25.7 10-14 25.374999999999996 26.325 24.08 24.22 15-19 25.45 25.96 25.074999999999996 23.515 20-24 25.44 26.35 24.565 23.645 25-29 25.5 25.979999999999997 24.915000000000003 23.605 30-34 25.490000000000002 26.119999999999997 25.290000000000003 23.1 35-39 25.81 25.650000000000002 25.174999999999997 23.365 40-44 25.55 26.135 24.875 23.44 45-49 25.314999999999998 26.419999999999998 25.324999999999996 22.939999999999998 50-54 25.855 26.165 25.245 22.735 55-59 24.75 26.340000000000003 25.39 23.52 60-64 25.455 26.02 25.45 23.075000000000003 65-69 25.165 26.39 25.290000000000003 23.155 70-74 25.174999999999997 25.6 24.975 24.25 75-79 25.564999999999998 26.290000000000003 25.415 22.73 80-84 25.66 26.21 25.41 22.720000000000002 85-89 25.825 26.32 25.424999999999997 22.43 90-94 25.259999999999998 26.08 25.31 23.35 95-99 25.395 25.835 26.085 22.685 100-104 25.14 26.484999999999996 25.635 22.74 105-109 25.595000000000002 26.07 26.025 22.31 110-114 25.374999999999996 26.235000000000003 25.14 23.25 115-119 25.27 26.179999999999996 25.465 23.085 120-124 25.955000000000002 26.640000000000004 24.6 22.805 125-129 25.779999999999998 26.765 24.6 22.855 130-134 26.075 27.02 24.97 21.935 135-139 25.790000000000003 26.075 25.835 22.3 140-144 26.765 25.695 25.314999999999998 22.225 145-149 26.46 26.384999999999998 25.275 21.88 150-151 26.35 26.687499999999996 24.6125 22.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.0 25 1.5 26 0.5 27 1.0 28 3.0 29 3.5 30 3.5 31 5.0 32 15.5 33 22.5 34 24.0 35 32.5 36 42.0 37 63.5 38 86.0 39 115.5 40 144.0 41 165.0 42 182.0 43 182.0 44 202.5 45 216.0 46 210.5 47 209.0 48 191.5 49 171.0 50 165.5 51 155.0 52 132.0 53 132.5 54 122.0 55 98.5 56 95.5 57 87.5 58 84.0 59 83.0 60 76.5 61 63.5 62 56.0 63 52.5 64 52.0 65 49.5 66 38.0 67 28.0 68 25.5 69 23.0 70 17.5 71 15.5 72 13.0 73 12.0 74 7.5 75 6.5 76 5.5 77 3.0 78 1.5 79 0.5 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09067946451124 98.075 2 0.8082849204344532 1.6 3 0.07577671129072998 0.22499999999999998 4 0.025258903763576663 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.6499999999999999 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.15 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.325 0.0 0.0 0.0 0.0 120-121 1.4874999999999998 0.0 0.0 0.0 0.0 122-123 1.7625000000000002 0.0 0.0 0.0 0.0 124-125 1.9874999999999998 0.0 0.0 0.0 0.0 126-127 2.1625 0.0 0.0 0.0 0.0 128-129 2.4749999999999996 0.0 0.0 0.0 0.0 130-131 2.6624999999999996 0.0 0.0 0.0 0.0 132-133 2.8 0.0 0.0 0.0 0.0 134-135 3.0125 0.0 0.0 0.0 0.0 136-137 3.225 0.0 0.0 0.0 0.0 138-139 3.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 768010 spots for SRR6958362.sra Written 768010 spots for SRR6958362.sra Read 768010 spots for SRR6958362.sra Written 768010 spots for SRR6958362.sra Read 768010 spots for SRR6958362.sra Written 768010 spots for SRR6958362.sra Read 768010 spots for SRR6958362.sra Written 768010 spots for SRR6958362.sra Read 768010 spots for SRR6958362.sra Written 768010 spots for SRR6958362.sra Read 768010 spots for SRR6958362.sra Written 768010 spots for SRR6958362.sra Read 768014 spots for SRR6958362.sra Written 768014 spots for SRR6958362.sra Read 768010 spots for SRR6958362.sra Written 768010 spots for SRR6958362.sra Read 768010 spots for SRR6958362.sra Written 768010 spots for SRR6958362.sra Read 768010 spots for SRR6958362.sra Written 768010 spots for SRR6958362.sra Read 768010 spots for SRR6958362.sra Written 768010 spots for SRR6958362.sra Read 768010 spots for SRR6958362.sra Written 768010 spots for SRR6958362.sra Read 768010 spots for SRR6958362.sra Written 768010 spots for SRR6958362.sra Read 768010 spots for SRR6958362.sra Written 768010 spots for SRR6958362.sra Read 768010 spots for SRR6958362.sra Written 768010 spots for SRR6958362.sra Read 768010 spots for SRR6958362.sra Written 768010 spots for SRR6958362.sra Read 768010 spots for SRR6958362.sra Written 768010 spots for SRR6958362.sra Read 768010 spots for SRR6958362.sra Written 768010 spots for SRR6958362.sra Read 768010 spots for SRR6958362.sra Written 768010 spots for SRR6958362.sra Read 768010 spots for SRR6958362.sra Written 768010 spots for SRR6958362.sra SRR ids: ['SRR6958362.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pwisgq3z SRR6958362.sra spots: 15360204 blocks: [[1, 768010], [768011, 1536020], [1536021, 2304030], [2304031, 3072040], [3072041, 3840050], [3840051, 4608060], [4608061, 5376070], [5376071, 6144080], [6144081, 6912090], [6912091, 7680100], [7680101, 8448110], [8448111, 9216120], [9216121, 9984130], [9984131, 10752140], [10752141, 11520150], [11520151, 12288160], [12288161, 13056170], [13056171, 13824180], [13824181, 14592190], [14592191, 15360204]] SRR6958362 file size 5183368 SRR6958362 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958362 SRR6958362_1.fastq SRR6958362_2.fastq Input file: SRR6958362_1.fastq Paired file: SRR6958362_2.fastq trimmed: SRR6958362-trimmed-pair1.fastq, SRR6958362-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:02:42 2024 >> started Fri Dec 6 21:02:58 2024 >> done (16.470s) 15360204 read pairs processed; of these: 12338 ( 0.08%) short read pairs filtered out after trimming by size control 9889 ( 0.06%) empty read pairs filtered out after trimming by size control 15337977 (99.86%) read pairs available; of these: 6358795 (41.46%) trimmed read pairs available after processing 8979182 (58.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 0 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 5 0.00% 25 3 0.00% 26 2 0.00% 27 2 0.00% 28 2 0.00% 29 8 0.00% 30 2 0.00% 31 9 0.00% 32 9 0.00% 33 2 0.00% 34 13 0.00% 35 4 0.00% 36 8 0.00% 37 7 0.00% 38 10 0.00% 39 7 0.00% 40 13 0.00% 41 16 0.00% 42 17 0.00% 43 17 0.00% 44 23 0.00% 45 13 0.00% 46 22 0.00% 47 15 0.00% 48 31 0.00% 49 29 0.00% 50 21 0.00% 51 34 0.00% 52 43 0.00% 53 43 0.00% 54 41 0.00% 55 53 0.00% 56 70 0.00% 57 74 0.00% 58 78 0.00% 59 81 0.00% 60 129 0.00% 61 126 0.00% 62 110 0.00% 63 165 0.00% 64 164 0.00% 65 196 0.00% 66 200 0.00% 67 209 0.00% 68 242 0.00% 69 253 0.00% 70 323 0.00% 71 357 0.00% 72 408 0.00% 73 481 0.00% 74 494 0.00% 75 589 0.00% 76 628 0.00% 77 751 0.00% 78 781 0.01% 79 924 0.01% 80 1015 0.01% 81 1221 0.01% 82 1449 0.01% 83 1574 0.01% 84 2277 0.01% 85 2672 0.02% 86 2769 0.02% 87 2753 0.02% 88 2944 0.02% 89 3222 0.02% 90 3471 0.02% 91 3797 0.02% 92 4101 0.03% 93 4419 0.03% 94 4865 0.03% 95 4925 0.03% 96 5268 0.03% 97 5752 0.04% 98 5808 0.04% 99 6315 0.04% 100 6651 0.04% 101 7269 0.05% 102 7819 0.05% 103 8392 0.05% 104 8903 0.06% 105 9555 0.06% 106 10068 0.07% 107 10140 0.07% 108 10702 0.07% 109 11537 0.08% 110 11590 0.08% 111 12594 0.08% 112 13390 0.09% 113 14464 0.09% 114 15411 0.10% 115 16551 0.11% 116 17142 0.11% 117 17775 0.12% 118 18363 0.12% 119 19088 0.12% 120 20142 0.13% 121 20747 0.14% 122 22043 0.14% 123 23744 0.15% 124 24970 0.16% 125 26485 0.17% 126 27950 0.18% 127 29459 0.19% 128 30508 0.20% 129 31904 0.21% 130 33699 0.22% 131 35413 0.23% 132 38280 0.25% 133 41726 0.27% 134 44504 0.29% 135 48600 0.32% 136 52163 0.34% 137 56619 0.37% 138 61314 0.40% 139 67341 0.44% 140 73858 0.48% 141 81284 0.53% 142 89853 0.59% 143 97640 0.64% 144 106708 0.70% 145 121120 0.79% 146 144877 0.94% 147 199357 1.30% 148 320924 2.09% 149 675962 4.41% 150 3383218 22.06% 151 8979182 58.54% 15337977 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=20 prefix-density=0.50 prefix-fanout=2.8 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=34.64 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.8 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=3.17 fanout-score-rank=25 prefix-density=0.43 prefix-fanout=2.7 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=27 fanout-score=44.75 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=7.7 sequence=CAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGACACGGGGAGGTAGTGACAATAAATAACAATACCGGGCACATTAGTGTCTGGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGACTTTGGGCCGGGTCGGCCGGTCCGCCTCACGGCGAGCACCGACCTACTCGACCCTTCAGCCGGCGATGCGCTCCTAGCCTTAATTGGCCGGGTCGTGCCTCCGGCATCGTTACTTTGAAGAAATTAGAGTGCTCAAAGCAAGCCATCGCTCTGGATACATTAGCATGGGATAACATCATAGGATTCCGGTCCTATTGTGTTGGCCTTCGGGATCGGAGTAATGATTAATAGGGACAGTCGGGGGCATTCGTATTTCATAGTCAGAGGTGAAATTCTTGGATTTATGAAA SRR6958362 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:03:40 Started mapping on | Dec 06 21:03:40 Finished on | Dec 06 21:05:04 Mapping speed, Million of reads per hour | 657.34 Number of input reads | 15337977 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14639010 Uniquely mapped reads % | 95.44% Average mapped length | 296.47 Number of splices: Total | 17399212 Number of splices: Annotated (sjdb) | 16437306 Number of splices: GT/AG | 17178066 Number of splices: GC/AG | 202304 Number of splices: AT/AC | 7273 Number of splices: Non-canonical | 11569 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 181852 % of reads mapped to multiple loci | 1.19% Number of reads mapped to too many loci | 37625 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.54% % of reads unmapped: other | 1.58% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 524785 524785 524785 N_multimapping 181852 181852 181852 N_noFeature 519320 14254714 623591 N_ambiguous 332513 1901 53562 UnstrandedReadsAssigned:13787177 PositiveStrandReadsAssigned:382395 NegativeStrandReadsAssigned:13961857 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958362 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958362-trimmed-pair1.fastq SRR6958362-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,337,977 reads, 14,023,668 reads pseudoaligned [quant] estimated average fragment length: 268.822 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52973 SRR6958362.ke.tsv 35125 SRR6958362.se.tsv 88098 total ==> SRR6958362.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 668.475 0 0 PNS24247 1044 776.178 51.8558 7.26131 PNS24249 1928 1660.18 16.5548 1.0838 PNS24246 1044 776.178 51.8558 7.26131 PNS24248 1044 776.178 51.8558 7.26131 PNS24244 1471 1203.18 27.8778 2.5183 PNS24243 293 82.706 0 0 KQK14069 1603 1335.18 2283.21 185.86 KQK14071 474 221.488 40.8572 20.0492 ==> SRR6958362.se.tsv <== BRADI_1g14170v3 2590 BRADI_1g53295v3 247 BRADI_1g59795v3 159 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 242 BRADI_1g74790v3 72 BRADI_1g09890v3 0 BRADI_1g77505v3 175 BRADI_1g48960v3 0 SRR6958362 completed mapping pipeline successfully